Activation of MEK/ERK and PI3K/Akt pathways by fibronectin requires integrin αv‐mediated ADAM activity in hepatocellular carcinoma: A novel functional target for gefitinib

Abstract

We have shown that the epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor gefitinib (‘Iressa’, ZD1839) inhibits the development of intrahepatic metastases of hepatocellular carcinoma CBO140C12, and EGFR transactivation by tumor necrosis factor‐α is a possible target of gefitinib. In the present study, we focused on the fibronectin (FN)‐dependent signaling pathway to further elucidate the antimetastatic activity of gefitinib in CBO140C12 cells. We initially observed that FN induced activation of extracellular signal‐regulated kinase (ERK), p38 and Akt, as well as cell proliferation and CBO140C12 cell invasion. These responses were mediated by EGFR tyrosine kinase, because gefitinib inhibited these effects of FN. FN‐induced ERK, p38 and Akt activation was partly blocked by the Arg‐Gly‐Asp (RGD)‐pseudo‐peptide FC‐336, anti‐αv integrin antibody RMV‐7, the broad‐spectrum matrix metalloprotease inhibitor GM6001 and the broad spectrum a disintegrin and metalloprotease (ADAM) inhibitor TAPI‐1. But these inhibitors had no effect on EGF‐induced signaling pathways, suggesting that integrins and ADAM may be upstream components of EGFR in these responses. These results suggest that FN‐induced activation of ERK, p38, Akt, cell proliferation and invasion was mediated, at least in part, via integrins, ADAM and EGFR, and that this FN‐induced signaling pathway might be involved in the antimetastatic activity of gefitinib. (Cancer Sci 2006; 97: 155 –162)

Abbreviations:

ADAM

a disintegrin and metalloprotease

EGF

epidermal growth factor

EGFR

epidermal growth factor receptor

EGFR‐TK

epidermal growth factor receptor tyrosine kinase

ERK

extracellular signal‐regulated kinase

FBS

fetal bovine serum

FN

fibronectin

GPCR

G protein‐coupled receptor

MAPK

mitogen‐activated protein kinase

MEK

MAPK/ERK kinase

MMP

matrix metalloprotease

PCR

polymerase chain reaction

PI3K

phosphatidylinositol‐3‐kinase

RGD

Arg‐Gly‐Asp

RT

reverse transcription.

Epidermal growth factor receptor is a 170‐kDa cell‐surface glycoprotein with tyrosine kinase activity; activation of the EGFR‐TK initiates a cascade of intracellular signaling events.^{( 1 )} High expression of EGFR has been observed in many human tumors, including lung, colon, breast, head and neck, ovarian, bladder and liver cancer, and has been shown to correlate with advanced tumor stage and poor clinical prognosis.^{( 2} , ^{3 )} The EGFR signaling pathway is associated with metastatic properties, including cell motility, adhesion and invasion in vitro. ^{( 4} , ^{5 )}

Gefitinib (‘Iressa’, ZD1839), an ATP‐competitive kinase inhibitor, was the first EGFR‐directed agent that received approval for the treatment of non‐small cell lung cancer, and is now being used as third‐line treatment upon failure of established chemotherapies.^{( 6 )} We originally demonstrated that gefitinib exerts an antimetastatic effect on intrahepatic metastases of hepatocellular carcinoma CBO140C12 by blocking EGFR‐dependent metastatic properties.^{( 7 )} Moreover, the results of a recent study we carried out suggest that the antimetastatic activity of gefitinib might be in part mediated by the inhibition of EGFR transactivation of tumor necrosis factor‐α.^{( 8 )}

Fibronectin is a multifunctional glycoprotein distributed in blood, body fluids and tissues. FN plays crucial roles in various cellular functions, including cell adhesion, migration, proliferation and differentiation.^{( 9} , ^{10 )} FN also plays important roles in the development and pathogenesis of many disorders, including cancer and fibrosis.^{( 11} , ^{12 )} In fact, the expression of cellular FN is increased in fibrotic liver and hepatocellular carcinoma.^{( 13 )} Most of the biological effects of FN are mediated through integrins, which are a family of heterodimeric and transmembrane receptors that lead to activation of several signal transduction pathways, including ERK, p38 and PI3K/Akt.^{( 14} , ^{15 )} Curiously, recent studies suggest a crosstalk between EGFR and integrins. Integrin‐mediated migration of human pancreatic carcinoma cells and murine B82L fibroblasts depends on EGFR.^{( 16} , ^{17 )} Integrin α5/β1 mediates FN‐dependent epithelial cell proliferation through EGFR activation.^{( 18 )} Interaction of tenascin‐C, an extracellular matrix glycoprotein induced in pulmonary vascular disease, with αvβ3 integrins induces EGFR phosphorylation in pulmonary vascular smooth muscle cells.^{( 19 )} Adhesion of human primary skin fibroblasts and ECV304 endothelial cells to immobilized matrix proteins or β1 or αv integrin antibodies stimulates tyrosine phosphorylation of EGFR.^{( 20 )} EGFR phosphorylation is furthermore induced by α2β1 integrins in A431 cells.^{( 21 )} Thus, there has been accumulating evidence on FN‐mediated EGFR transactivation; however, little is yet known about the extracellular molecular steps linking integrins to the activation of EGFR.

In the present study, we examined whether MMP and EGFR are involved in the FN‐induced activation of signal transduction pathways, cell proliferation and invasion. We found that integrin αv, ADAM and EGFR are key mediators of the mechanism of activation of the MEK/ERK and PI3K/Akt pathways by FN.

Materials and methods

Materials

Gefitinib (4‐[3‐chloro‐4‐fluoroanilino]‐7‐methoxy‐6‐[3‐morpholinopropoxy]‐quinazoline), which was kindly provided by AstraZeneca (Macclesfield, UK), was dissolved in dimethylsulfoxide. EGF and FN were purchased from Upstate Biotechnology (Waltham, MA, USA) and Iwaki Glass (Tokyo, Japan), respectively. Human GM6001, GM6001 negative control, TAPI‐1, U0126 and SB203580 were purchased from Calbiochem (Darmstadt, Germany). Anti‐integrin αv antibody and LY294002 were purchased from eBioscience and Alomone Laboratories (Jerusalem, Israel). FC‐336, Ph(CH₂NH‐DR‐COCH₂CH₂‐D)₂, was synthesized as described previously.^{( 15 )}

Cells

The CBO140C12 murine hepatocellular carcinoma cell line was kindly provided by Dr K. Ogawa (First Department of Pathology, Asahikawa Medical College, Asahikawa, Japan) and maintained in Dulbecco's Modified Eagle Medium: F‐12 (Ham) (Invitrogen, Carlsbad, CA, USA) supplemented with 10% FBS (Lot 9354F; ICN Biomedicals, Aurora, OH, USA), 320 mg/L l‐glutamine and 2 g/L glucose.

Western blot analysis

CBO140C12 cells were cultured in medium containing 0.5% FBS for 24 h. After the indicated treatment, the cells were rinsed with ice‐cold phosphate‐buffered saline and lysed in sample buffer (24 mM Tris‐HCl [pH 6.8], 5%[w/v] glycerol, 1%[w/v] sodium dodecylsulfate, 0.05% w/v Bromophenol Blue). Cell lysates were subjected to sodium dodecylsulfate–polyacrylamide gel electrophoresis and transferred to Immobilon‐P membranes (Millipore, Bedford, MA, USA). Blots were incubated with Block Ace (Dainipponseiyaku, Suita, Japan) and probed with the indicated primary antibodies. Protein content was visualized using horseradish peroxidase‐conjugated secondary antibodies followed by enhanced chemiluminescence (Amersham, Buckinghamshire, UK). Experiments were carried out at least twice, and the results of a representative experiment are shown. Phospho‐EGFR, phospho‐ERK, phospho‐p38 and phospho‐Akt antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). The intensity of each band was quantified using the ChemiDoc XRS system (Bio‐Rad, Tokyo, Japan).

Cell proliferation assay

CBO140C12 cells (3.3 × 10³ cells/well) were seeded in 100 µL of medium containing 0.5% FBS onto 50 µg/mL FN‐coated 96‐well plates in the absence or presence of inhibitors. After 48 h, proliferative activity was determined using a Cell Counting Kit (Dojindo, Kumamoto, Japan).

Cell invasion assay

The haptotactic invasion of CBO140C12 cells was measured using Transwell cell culture chambers (Costar 3422, Cambridge, MA, USA) as described previously^{( 22 )} but with some modifications. The filter's lower surface was precoated with 1 µg FN, and then 5 µg Matrigel was applied to the upper surface of the filters. CBO140C12 cells suspended in medium containing 0.1% bovine serum albumin (Sigma, St Louis, MO, USA) (1 × 10⁵/100 µL) were placed in the upper compartment of the chamber in the presence of inhibitors. After a 12‐h incubation period, the filters were fixed and cells that had invaded to the lower surface were detected by crystal violet staining.

Reverse transcription–polymerase chain reaction

The mRNA expression of integrins was evaluated by semiquantitative RT‐PCR. Briefly, total RNA from CBO140C12 cells was extracted using the RNeasy Mini Kit (Qiagen, CA, USA) according to manufacturer's instruments. First‐strand cDNA was prepared from total RNA (1 µg) using the oligo(dT)18 primer and SuperScript II reverse transcriptase (Invitrogen). The RT reaction was carried out at 42°C for 50 min, followed by 70°C for 15 min. The PCR amplification was carried out by denaturation at 94°C for 30 s, annealing at 60°C for 1 min, and extension at 72°C for 105 s with a Takara Ex Taq (Takara‐Bio, Shiga, Japan). The sequences of primers were as follows: integrin α3 sense 5′‐CCAGGGGATGTTCTTACG‐3′ and antisense 5′‐CCACGGTCTCTCTTTGTT‐3′; integrin α5 sense 5′‐CTGCAGCTGCATTTCCGAGTCTG‐3′ and antisense 5′‐GAAGCCGAGCTTGTAGAGGACGTA‐3′; integrin α6 sense 5′‐TCCAAGAGCCAATCACAG‐3′ and antisense 5′‐CCACATCATAGCCAAACG‐3′; integrin αv sense 5′‐GCACCAGCAGTCAGAGATG‐3′ and antisense 5′‐CACAGCAGCCTTTTCGG‐3′; and integrin β1 sense 5′‐ACTCCGACGCCTTTTC‐3′ and antisense 5′‐TCCCCACTCAGCAATG‐3′. The PCR products were electrophoresed on 1.5% agarose gels and detected by ethidium bromide staining.

Statistical analysis

Statistical comparisons were carried out using Mann–Whitney's test or the Student's two‐tailed t‐test. P < 0.05 was considered to be significant.

Results

Gefitinib blocks cell proliferation and invasion induced by FN in CBO140C12 cells

We have shown that gefitinib selectively inhibits EGFR phosphorylation, and subsequent metastatic properties in CBO140C12 cells.^{( 7} , ^{8 )} We first examined the effect of gefitinib on FN‐induced proliferative and invasive properties of CBO140C12 cells. CBO140C12 cells cultured on FN‐coated plates show a dose‐dependent proliferation (2.5–50 µg/mL) (data not shown). Treatment with gefitinib for 48 h resulted in a significant inhibition of FN‐induced cell proliferation (Fig. 1a). Next, we investigated the effect of gefitinib on the haptoinvasion of CBO140C12 cells (Fig. 1b). When the lower surface of the filter was coated with FN, haptotactic invasion of CBO140C12 cells was stimulated. The FN‐induced invasion was significantly inhibited by gefitinib. These results suggest that FN‐induced cell proliferative and invasive properties are mediated by EGFR phosphorylation.

Figure 1.

Inhibition of fibronectin (FN)‐induced cell proliferation and invasion by gefitinib. (a) CBO140C12 cells were seeded in culture medium containing 0.5% fetal bovine serum onto 50 µg/mL FN‐coated wells in the absence or the presence of 1 µM gifitinib. After a 48‐h incubation, proliferative activity was determined. These data are presented as percentage of the control for mean absorbance. (b) CBO140C12 cells were seeded onto the filters, which were precoated with Matrigel (5 µg) on the upper surface with or without FN (1 µg) on the lower surface, in the presence of 1 µM gefitinib. After a 12‐h incubation, the cells that had invaded into the lower surface were counted by crystal violet staining. Each column and bar represents the mean value ± SD of four wells. *P < 0.05.

FN induces phosphorylation of MAPK and Akt in CBO140C12 cells

It has been demonstrated that activation of ERK, p38 and Akt might be linked to cell proliferation and invasion induced by various stimuli.^{( 23} , ²⁴ , ²⁵ , ^{26 )} We examined the influence of soluble FN on ERK, p38 and Akt activation in CBO140C12 cells (Fig. 2). In CBO140C12 cells treated with 50 µg/mL FN a transient phosphorylation of ERK and Akt was observed. This reached a peak at 7 min and thereafter it declined to basal levels over 20–40 min (Fig. 2a,b). FN also transiently activated p38; however, the time course for p38 activation differed from that of ERK and Akt with maximal phosphorylation appearing 1–3 min after stimulation (Fig. 2a,b). We also treated CBO140C12 cells with different concentrations of FN (10–100 µg/mL) for 10 min to investigate the dose dependency of FN‐induced phosphorylation of MAPK and Akt. As shown in Fig. 2c, FN activated ERK, p38 and Akt phosphorylation in a concentration‐dependent manner. It is noteworthy that FN‐induced phosphorylation of p38 occurred considerably earlier than that of ERK and Akt, implying that FN induces activation of p38 and ERK/Akt in mutual pathways.

Figure 2.

Induction of extracellular signal‐regulated kinase (ERK), p38 and Akt phosphorylation by fibronectin (FN). (a,b) Time course of ERK, p38 and Akt phosphorylation. Serum‐starved CBO140C12 cells were stimulated with 50 µg/mL FN for the indicated time. (c) Dose‐dependent increase in ERK, p38 and Akt phosphorylation. Serum‐starved CBO140C12 cells were treated with the indicated concentration of FN for 10 min. Phospho‐ERK, phospho‐p38 and phospho‐Akt were determined by western blotting using phospho‐ERK (Thr202 and Tyr204), phospho‐p38 (Thr180, Tyr182) and phospho‐Akt (Ser473) antibodies, respectively.

FN‐induced cell proliferation and invasion require MAPK and Akt activation in CBO140C12 cells

To investigate the role of ERK, p38 and Akt on cell proliferation and invasion, we examined the effect of SB203580, LY294002 and U0126, which are specific inhibitors of p38, PI3K and MEK, respectively (Fig. 3). FN‐induced proliferation of CBO140C12 cells was inhibited by treatment with SB203580, LY294002 and U0126 for 48 h (Fig. 3a). These compounds also inhibited FN‐induced invasion of CBO140C12 cells (Fig. 3b). These data suggest that MAPK and Akt activation play crucial roles in FN‐induced cell proliferation and invasion.

Figure 3.

Effects of p38, phosphatidylinositol‐3‐kinase (PI3K) and mitogen‐activated protein kinase/extracellular signal‐regulated kinase (MAPK) inhibitors on cell proliferation and invasion induced by fibronectin (FN). (a) CBO140C12 cells were seeded onto 50 µg/mL FN‐coated wells with culture medium containing 0.5% fetal bovine serum in the absence or presence of 10 µM SB203580, 20 µM LY294002 or 10 µM U0126. After a 48‐h incubation, proliferative activity was determined. These data are presented as percentage of the control for mean absorbance. (b) CBO140C12 cells were seeded onto the filters, which were precoated with Matrigel (5 µg) on the upper surface with or without coating with FN (1 µg) on the lower surface, in the presence of 10 µM SB203580, 20 µM LY294002 or 10 µM U0126. After a 12‐h incubation, the cells that had invaded into the lower surface were counted by crystal violet staining. Each column and bar represents the mean ± SD of four wells. *P < 0.05.

Gefitinib blocks FN‐induced MAPK and Akt phosphorylation in CBO140C12 cells

To determine the effect of gefitinib on FN‐induced MAPK and Akt phosphorylation, cells were treated with FN in the presence of gefitinib. As shown in Fig. 4, 0.1 µM gefitinib prevented ERK and Akt activation by FN, whereas only partial inhibition of p38 activation was achieved with 1 µM gefitinib. Given that EGFR phosphorylation is completely inhibited by 1 µM gefitinib in CBO140C12 cells,^{( 7 )} these findings suggest that FN‐induced p38 phosphorylation occurs via EGFR‐TK‐dependent as well as EGFR‐TK‐independent pathways.

Figure 4.

Inhibitory effect of gefitinib on extracellular signal‐regulated kinase (ERK), p38 and Akt phosphorylation induced by fibronectin (FN). Serum‐starved CBO140C12 cells were treated for 15 min with the indicated concentration of gefitinib, followed by stimulation with 50 µg/mL FN for 10 min. Phospho‐ERK, phospho‐p38 and phospho‐Akt were determined by western blotting using phospho‐ERK (Thr202 and Tyr204), phospho‐p38 (Thr180, Tyr182) and phospho‐Akt (Ser473) antibodies, respectively.

Integrins are involved in the induction of MAPK and Akt phosphorylation by FN in CBO140C12 cells

Reverse transcription–polymerase chain reaction analysis revealed that CBO140C12 cells express α3, α5, α6, αv and β1 integrin subunits (data not shown). To investigate the role of integrins in the FN‐induced signaling pathway we used integrin‐targeted agents, including FC‐336 and anti‐αv integrin antibody (Fig. 5). FC‐336 is a pseudo‐peptide analog of the RGD sequence within the central cell‐binding domain of FN.^{( 27 )} We have previously shown that FC‐336 inhibits tumor adhesion and invasion by saturating cell surface integrins.^{( 28} , ^{29 )} As shown in Fig. 5a, FC‐336 completely inhibited FN‐induced ERK and p38 phosphorylation, whereas Akt phosphorylation was not affected, implying that ERK and p38 activation is largely dependent on the RGD sequence in FN and RGD‐binding integrins such as α5β1 and αvβ1.

Figure 5.

Involvement of integrins in the fibronectin (FN)‐induced signaling pathway. (a) Effect of FC‐336. Serum‐starved CBO140C12 cells were treated for 30 min with FC‐336 (FC) (5 mg/mL) and gefitinib (Gf) (5 µM), followed by stimulation with 50 µg/mL FN for 10 min. (b) Effect of anti‐αv integrin subunit monoclonal antibody RMV‐7. Serum‐starved CBO140C12 cells were treated for 10 min with RMV‐7, followed by stimulation with 50 µg/mL FN for 10 min. (c) Effect of FC‐336 and RMV‐7. Serum‐starved CBO140C12 cells were treated for 30 min with FC‐336 (FC) (5 mg/mL), RMV‐7 and gefitinib (Gf) (1 µM), followed by stimulation with 50 ng/mL EGF for 5 min. Cell lysates were subjected to western blotting with phosphor‐EGFR (Tyr‐1068), phospho‐ERK (Thr202 and Tyr204), phospho‐p38 (Thr180, Tyr182) and phospho‐Akt (Ser473) antibodies, respectively.

Alpha‐v integrin is one of the most important integrin subunits of the FN receptor.^{( 30 )} CBO140C12 cells were pretreated with RMV‐7 monoclonal antibody to the αv integrin subunit, followed by stimulation with FN for 10 min. RMV‐7 inhibited ERK and Akt phosphorylation, but not p38 phosphorylation (Fig. 5b). In addition, FC‐336 and RMV‐7 had no significant effect on EGF induction of these pathways and EGFR phosphorylation (Fig. 5c). Gefitinib completely inhibited FN‐induced activation of ERK and Akt (Fig. 4). Collectively, these data imply that the integrin‐mediated pathways activated by FN, especially the αv integrin subunit, might be associated with EGFR transactivation in CBO140C12 cells.

ADAM is involved in the induction of MAPK and Akt phosphorylation by FN in CBO140C12 cells

It is well accepted that one of the molecular mechanisms of GPCR‐mediated EGFR transactivation involves the processing of transmembrane growth factor precursors by metalloproteases that have been recently identified as members of the ADAM family of zinc‐dependent proteases.^{( 31} , ^{32 )} GM6001 is a potent broad‐spectrum hydroxamic acid inhibitor of MMP, which has been used to inhibit ectodomain shedding of transmembrane EGF family precursors from the cell surface.^{( 33 )} As shown in Fig. 6a, GM6001 inhibited ERK and Akt phosphorylation induced by FN, but did not affect p38 phosphorylation. GM6001‐N, a structurally similar compound without metalloprotease inhibitory activity, did not inhibit FN‐induced phosphorylation of ERK and Akt. To focus on the involvement of the ADAM family, we used the broad spectrum ADAM inhibitor TAPI‐1. TAPI‐1 inhibited ERK and Akt phosphorylation induced by FN, but not p38 phosphorylation (Fig. 6a). In addition, GM6001 and TAPI‐1 had no effect on EGFR, ERK or Akt activation by EGF (data not shown, and reference^{( 8 )}). Moreover, FN‐induced proliferation of CBO140C12 cells was inhibited by GM6001 and TAPI‐1 (Fig. 6b). These results suggest that the ADAM family, at least in part, participates as an upstream component in EGFR activation in response to FN in CBO140C12 cells.

Figure 6.

Involvement of a disintegrin and metalloprotease (ADAM) on fibronectin (FN)‐induced signaling pathways and proliferation. (a) Serum‐starved CBO140C12 cells were treated for 30 min with GM6001 (GM) (10 µM), TAPI‐1 (TAPI) (10 µM) and GM6001‐negative control (GM‐N) (10 µM), and then stimulated with 50 µg/mL FN for 10 min. Cell lysates were subjected to western blotting with phospho‐ERK (Thr202 and Tyr204), phospho‐p38 (Thr180, Tyr182) and phospho‐Akt (Ser473) antibodies, respectively. (b) CBO140C12 cells were seeded onto 50 µg/mL FN‐coated wells with culture medium containing 0.5% FBS in the absence or presence of GM6001 (GM) (10 µM) or TAPI‐1 (TAPI) (10 µM). After a 48‐h incubation, proliferative activity was determined. These data are presented as percentage of the control for mean absorbance. Each column and bar represents the mean ± SD of four wells. *P < 0.05.

ERK and Akt activation by FN are mutually dependent after EGFR transduction

To determine the relationship between the FN‐induced ERK and Akt signaling pathways, CBO140C12 cells were treated with FN in the presence or absence of U0126 or LY294002. Inhibition of PI3K by LY294002 attenuated FN‐ and EGF‐induced Akt phosphorylation, but not ERK phosphorylation (Fig. 7 and data not shown), suggesting that PI3K is involved in FN‐stimulated and EGF‐stimulated Akt activation. In contrast, inhibition of MEK by U0126 attenuated FN‐induced and EGF‐induced ERK phosphorylation, but not Akt phosphorylation (Fig. 7 and data not shown). Given that the selective EGFR‐TK inhibitor gefitinib abrogated FN‐induced and EGF‐induced activation of ERK and Akt (Fig. 4 and reference^{( 8 )}), these results suggest that FN activates the MEK/ERK and PI3K/Akt pathways independently, and that EGFR may be a common upstream component of both pathways.

Figure 7.

Extracellular signal‐regulated kinase (ERK) activation and Akt activation by fibronectin (FN) are mutually independent. Serum‐starved CBO140C12 cells were treated for 30 min with LY294002 (LY) (20 µM) and U0126 (10 µM), and then with FN (50 µg/mL) for 10 min. Cell lysates were subjected to western blotting with antiphospho‐ERK, p38 and Akt antibodies, and reprobed with anti‐ERK, p38 and Akt antibodies, respectively.

Discussion

It is well documented that GPCR transactivate receptor tyrosine kinases, particularly EGFR‐TK, in different cell types, including cancer cells. Recent findings suggested two independent mechanisms of EGFR transactivation by GPCR. One is an intracellular pathway, which is mediated by the βγ complex of G proteins and Src family non‐receptor tyrosine kinases;^{( 34 )} the other is an extracellular pathway, which is mediated by processing of the transmembrane pro‐form of EGFR ligands by metalloproteases.^{( 31} , ^{32 )}

Besides GPCR, a crosstalk between integrins and the receptor tyrosine kinases is suggested by a number of examples.^{( 35 )} The mechanism by which integrins can transactivate EGFR signaling pathways is intracellular direct phosphorylation of EGFR by integrin signaling. In the human endothelial cell line ECV304, cell–matrix adhesion results in the association of integrins with EGFR, c‐Src kinase and p130Cas. As a consequence of cell adhesion, EGFR is phosphorylated and tranduces signals to ERK, Akt and Rac, which control cell survival and actin cytoskeleton organization.^{( 36 )} However, the involvement of ADAM in FN‐induced signaling pathways remains to be elucidated.

Our findings are summarized in Fig. 8. We demonstrated that soluble FN induces ERK, p38 and Akt phosphorylation in CBO140C12 cells, and cell proliferative and invasive abilities were stimulated by immobile FN (2, 3). Activation of EGFR‐TK is required for ERK, p38 and Akt activation, cell proliferation and invasion in response to FN, as treatment with the selective EGFR‐TK inhibitor gefitinib attenuated the phosphorylation of these signaling proteins and activation of metastatic properties (1, 4). Moreover, FN‐induced ERK and p38 activation was inhibited by RGD‐pseudo‐peptide FC‐336, and FN‐induced ERK and Akt activation is inhibited by the anti‐αv integrin monoclonal antibody RMV‐7 (Fig. 5), indicating that FN receptor integrins, especially RGD‐binding integrins and the αv integrin subunit, are required for FN‐induced responses. The MMP inhibitor GM6001 and the ADAM inhibitor TAPI‐1 blocked FN‐induced ERK and Akt activation but not the EGF‐induced response (Fig. 6 and data not shown), suggesting that the ADAM family acts as an upstream component in EGFR transactivation in response to FN, and plays an important role in activating ERK and Akt pathways. Moreover, experiments using the MEK inhibitor U0126 and the PI3K inhibitor LY294002 revealed that the Akt pathway was mediated through PI3K activity, which is independent of the ERK pathway induced by FN (Fig. 7).

Figure 8.

Proposed mechanism of gefitinib on inhibitory effect of intrahepatic metastasis in CBO140C12 cells. Extracellular fibronectin (FN) binds to integrins, which is partly consist with αv subunit, and induces the activation of a disintegrin and metalloproteases (ADAM) on the cell surface. Subsequent release of epidermal growth factor (EGF)‐like ligands by ADAM results in p38, ERK and Akt activation, followed by induction of cell proliferation and invasion. This pathway might be a novel functional target of gefitinib (solid line). However, p38 could also be activated by an EGF receptor (EGFR)‐independent pathway (dotted line).

Interestingly, phosphorylation of ERK and Akt induced by FN followed almost the same time course and showed similar sensitivity to the anti‐αv integrin monoclonal antibody GM6001, TAPI‐1 and gefitinib, but not to FC‐336. These data suggest that the FN signaling pathway is mediated mainly through integrin αv/ADAM/EGFR/MEK/ERK and integrin αv/ADAM/EGFR/PI3K/Akt in CBO140C12 cells. The different sensitivity to FC‐336 of the ERK and Akt pathways may be due to a dependence on the combination of α and β subunits of integrins. Although further studies are needed to identify which integrins and which ADAM are involved in FN‐induced EGFR transactivation, this is the first evidence that interaction of FN with integrin αv induces ADAM‐mediated EGFR transactivation.

In contrast, the FN‐induced phosphorylation of p38 occurred within 1 min, and was sensitive to FC‐336 and gefitinib, but not to RMV‐7, GM6001 or TAPI‐1. These data suggest that FN‐induced phosphorylation of p38 might require RGD‐binding integrins such as α5β1 integrin, which do not contain the integrin αv subunit, and might be mediated through an ADAM‐independent intracellular pathway. Thus, future investigations need to focus on intracellular regulators such as FAK and Src for p38 activation in response to FN stimulation.

RGD‐containing peptides have been reported to inhibit tumor metastasis, tumor‐induced angiogenesis and tumor‐elicited platelet aggregation. In fact, we have reported that intravenously administered FC‐336 inhibits liver metastasis of colon 26‐L5 carcinoma cells and intrahepatic metastasis of CBO140C12 tumor.^{( 29} , ^{37 )} In the present study, we showed that FC‐336 inhibited FN‐induced ERK and p38 activation, which is mediated via EGFR. Taken together, the antimetastatic mechanism of FC‐336 might be, at least in part, the inhibition of EGFR transactivation in tumor cells.

In conclusion, this is the first study to demonstrate that the mechanism of FN‐induced EGFR transactivation is, at least in part, mediated by integrin αv and ADAM, and that EGFR transactivation results in the proliferation and invasion of hepatocellular carcinoma cells in vitro. Thus, this study establishes a further connection between integrins and EGFR with putative functional consequences for tumor growth and metastasis. Furthermore, it suggests a novel suppressive mechanism of gefitinib against the intrahepatic metastasis of hepatocellular carcinoma CBO140C12.