Skip to main content
NCBI home page
RNA logoLink to RNA
. 2006 Apr;12(4):666–673. doi: 10.1261/rna.2225206

Comparative study of the effects of heptameric slippery site composition on −1 frameshifting among different eukaryotic systems

EWAN P PLANT 1, JONATHAN D DINMAN 1
PMCID: PMC1421095  PMID: 16497657

Abstract

Studies of programmed −1 ribosomal frameshifting (−1 PRF) have been approached over the past two decades by many different laboratories using a diverse array of virus-derived frameshift signals in translational assay systems derived from a variety of sources. Though it is generally acknowledged that both absolute and relative −1 PRF efficiency can vary in an assay system-dependent manner, no methodical study of this phenomenon has been undertaken. To address this issue, a series of slippery site mutants of the SARS-associated coronavirus frameshift signal were systematically assayed in four different eukaryotic translational systems. HIV-1 promoted frameshifting was also compared between Escherichia coli and a human T-cell line expression systems. The results of these analyses highlight different aspects of each system, suggesting in general that (1) differences can be due to the assay systems themselves; (2) phylogenetic differences in ribosome structure can affect frameshifting efficiency; and (3) care must be taken to employ the closest phylogenetic match between a specific −1 PRF signal and the choice of translational assay system.

Keywords: frameshifting, virus, ribosome, slippery site

INTRODUCTION

Ribosomes use messenger RNA as the template for making proteins. This process, called translation, is both highly efficient and very specific, resulting in few errors (for review, see Ogle and Ramakrishnan 2005). Aberrations include incorporation of the wrong tRNA, readthrough of termination codons, and alterations in reading frame. A number of viruses have been shown to contain programmed −1 ribosomal frameshift (−1 PRF) signals and frameshifting at these elements typically results in proteins with extended C termini encoding additional functions (Bekaert and Rousset 2005). Viruses that use −1 PRF infect a broad range of eukaryotic host cells, and the sequences that promote −1 PRF are diverse. Programmed −1 ribosomal frameshifting is an example of disruption, in a controlled manner, of ribosomal frame maintenance. The disruption is directional and limited to the repositioning of the tRNAs by a single nucleotide relative to the mRNA.

There are three major mRNA features that contribute to −1 PRF: a heptameric nucleotide sequence N NNW WWH (where the incoming reading frame is indicated by spacing), which permits the aminoacylated- and peptidyl-tRNAs to disengage from the mRNA and reengage codons in the −1 frame (Jacks et al. 1988); a stimulatory structure that is often an mRNA pseudoknot (for review, see Giedroc et al. 2000); and a spacer region between the slippery site and pseudoknot (Napthine et al. 1999; Bekaert et al. 2003). The tRNAs that decode the slippery site are also integral to −1 PRF (Napthine et al. 2003), and it has been proposed that modifications to these tRNAs could affect the stability of the codon:anticodon interaction altering frameshifting efficiency (Tsuchihashi and Brown 1992). It has also been observed that the species from which the ribosomes are derived can influence the type and frequency of frameshifting (e.g., Matsufuji et al. 1996; Sung and Kang 2003).

Examination of two decades of research reveals that both the absolute and relative frequencies of −1 PRF tend to vary depending on the sources of −1 PRF signals and ribosomes. However, to date, no systematic study of this phenomenon has been undertaken. The current study seeks to address this deficiency. Here, mutations were made in the slippery site of the frameshift signal from the SARS-associated coronavirus (SARS-CoV), and −1 PRF efficiencies determined using four different eukaryotic systems: Vero cells, reticulocyte lysates, wheat germ lysates, and yeast cells. This approach allowed for comparison of the effects of a single variable between multiple systems. HIV-1 mediated −1 PRF efficiencies were also compared between Escherichia coli, often used as an inexpensive and convenient assay system, and Jurkat cells, a transformed T-cell line more representative of the natural host cell. Assay system-specific differences observed in this study identify numerous issues that can affect −1 PRF efficiency and suggest that care should be used to find the most natural match between the source of assay system and specific −1 PRF signal to be analyzed.

RESULTS

The absolute efficiency of −1 PRF varies depending on the species of ribosome

There are numerous examples in the literature where different groups using different translational assay systems obtained differences in −1 PRF efficiencies. For example, the percentage of −1 PRF promoted by the SARS-CoV frameshift signal was observed to vary widely in an assay system–dependent manner (Plant et al. 2005). These discrepancies have resulted in considerable confusion in the literature. To address this issue, the wild-type SARS-CoV frameshift signal, encompassing the U UUA AAC heptameric slippery site and three-stemmed pseudoknot, was cloned between the Renilla and firefly luciferase genes such that the firefly protein can only be expressed via a frameshift event (Plant et al. 2005). Programmed −1 ribosomal frameshifting efficiencies were measured as described in the methods using two in vivo (Vero and yeast cells) and two in vitro (lysates of rabbit reticulocytes and wheat germ) eukaryotic systems. The −1 PRF efficiency from this wild-type sequence was similar in Vero cells and reticulocyte lysates (12.8% and 17.9%), higher in wheat germ lysate (23%), and lower in yeast (3.1%) (Fig. 1 ▶).

FIGURE 1.

FIGURE 1.

Open in a new tab

Frameshifting efficiency from individual slippery sites varies depending on the translational assay system. Luminescence from test constructs is expressed as a percentage of the nonframe-shifting control for different slippery sites. The shading of the bars represents frameshifting stimulated by different translational systems: dark gray for Vero cells, light gray for reticulocyte lysate, white for yeast cells, and black for wheat germ lysate. Percentages of frameshifting and standard errors are indicated in both the figure and the table below.

To follow up on this observation, the slippery site was mutated to two other known slippery sequences: U UUU UUU and A AAA AAU. In both cases, the absolute amount of frameshifting was less than that of the wild-type sequence in the Vero cells and in vitro assay systems. However, while frameshifting from the wild-type sequence was higher in lysates of wheat germ compared to reticulocytes, the opposite was true when the slippery sequence A AAA AAU was used. This result suggested that −1 PRF efficiencies depended on both the slippery site sequence and the source of ribosomes. This observation prompted an in-depth analysis of the interactions between different ribosome sources and different nucleotides in the slippery site.

A-site codon effects: Influence of P-site codon context

To examine the affect of A-site codons on different ribosomes, a series of mutations was made to the sequence of the wild-type SARS-CoV slippery site that the aminoacyl-tRNA anticodon base-pairs with after a −1 PRF event. Only A AAZ and U UUZ were examined, as triplets of G or C had previously been shown to not promote efficient frameshifting (Dinman et al. 1991; Brierley et al. 1992; Dinman and Wickner 1992), and in all cases the nucleotide in the zero frame wobble position (Z) was kept the same. In the first series of experiments, the wild-type SARS frameshift slippery site was altered from U UUA AAC to U UUU UUC and frameshifting was determined by dual luciferase assays. The relative frameshifting efficiencies promoted by U UUU UUC remained almost identical in Vero and yeast cells, and in reticulocyte lysates as compared to the wild-type sequence (Fig. 2A ▶; Table 1 ▶). The exception was observed in wheat germ lysates, where there was a notable increase in frameshifting efficiency (p = 7.6 × 10−4). More dramatic differences were observed when the P-site contained a glycine codon (G GGA AAC vs. G GGU UUC). In this P-site context, frameshifting frequencies were consistently lower with UUU in the A-site. The biggest difference was a 66% decrease in yeast (P-value of 5.4 × 10−9). These data suggest that in general U UUC is less preferable in the A-site than A AAC, and that the extent of that preference is dependent on the P-site codon context.

FIGURE 2.

FIGURE 2.

Open in a new tab

Influence of the A- and the P-site codons on −1 frame-shifting in different translational systems. (A) Influence of the A-site codon. (B) Influence of the P-site codon. Frameshifting efficiencies were determined and expressed as fold change of the wild-type sequence (U UUA AAC) for each construct. The shading of the bars is the same as in Figure 1 ▶. P-values for fold change are in Table 1 ▶.

TABLE 1.

Fold change in frameshifting as determined in four different systems

Slippery site Vero cells Retic lysate Yeast cells Wheat germ
A-site changes (SARS-CoV slippery site)
U UUA AAC 1 1 1 1
U UUU UUC 0.96 (5.6 × 10−1) 0.90 (2.8 × 10−1) 0.92 (2.5 × 10−1) 1.6 (7.6 × 10−4)
A-site changes (L–A slippery site)
G GGA AAC 1 1 1 1
G GGU UUC 0.49 (4.7 × 10−5) 0.84 (1.9 × 10−2) 0.33 (5.4 × 10−9) 0.80 (3.3 × 10−1)
P-site changes
U UUA AAC 1 1 1 1
G GGA AAC 0.31 (1.8 × 10−9) 0.61 (2.3 × 10−11) 0.93 (3.4 × 10−1) 0.65 (2.3 × 10−3)
C CCA AAC 0.13 (4.7 × 10−10) 0.14 (8.8 × 10−22) 1.15 (1.8 × 10−1) 1.28 (6.8 × 10−2)
A AAA AAC 0.34 (2.1 × 10−9) 0.44 (4.0 × 10−13) 1.25 (8.4 × 10−3) 0.10 (5.1 × 10−14)
Seventh position changes (SARS-CoV slippery site)
U UUA AAC 1 1 1 1
U UUA AAU 0.25 (9.1 × 10−11) 0.60 (5.9 × 10−9) 1.10 (1.6 × 10−1) 1.45 (3.4 × 10−2)
U UUA AAA 0.22 (2.5 × 10−10) 0.63 (2.7 × 10−7) 1.05 (5.6 × 10−1) 1.24 (2.3 × 10−1)
U UUA AAG 0.13 (1.4 × 10−11) 0.26 (2.6 × 10−20) 0.17 (2.4 × 10−20) 0.82 (6.8 × 10−2)
Seventh position changes (L–A slippery site)
G GGU UUC 1 1 1 1
G GGU UUU 0.86 (2.9 × 10−1) 0.84 (3.0 × 10−2) 2.43 (1.1 × 10−6) 1.76 (2.5 × 10−4)
G GGU UUA 1.84 (1.9 × 10−4) 1.17 (1.5 × 10−2) 1.69 (2.3 × 10−9) 1.98 (2.9 × 10−6)
G GGU UUG 0.30 (2.5 × 10−6) 0.45 (1.8 × 10−8) 0.41 (4.9 × 10−11) 0.45 (1.8 × 10−4)
Open in a new tab

Fold changes were calculated for each type of slippery site. P-values shown in parentheses were determined as previously described in Jacobs and Dinman (2004).

P-site codon effects: Ribosome source effects on frameshifting efficiency

The first three nucleotides of the slippery site were mutated from U UU to A AA, G GG or C CC, all of which have been shown to support efficient −1 PRF (Dinman et al. 1991; Brierley et al. 1992; Dinman and Wickner 1992). In yeast, frameshifting was stimulated to the greatest extent with poly-A or poly-C in the P-site (Fig. 2B ▶; Table 1 ▶). In contrast, −1 PRF was reduced in the metazoans (Vero cells and reticulocyte lysates) in the presence of poly-A, -G or -C (P-values from 1.8 × 10−9 to 8.8 × 10−22), the lowest level of stimulation being produced by the poly-C sequence. In plants (wheat germ lysates) frameshifting efficiencies were stimulated to a greater degree by pyrimidines than by purines in the P-site, with maximal enhancement by the poly-C sequence. In summary, the yeast, metazoan, and plant ribosomes all responded differently to the various P-site codon contexts.

Effects of the wobble position of the zero frame A-site codon are dependent on the identity of both the A- and the P-site codons

Previous studies showed that A, C, or U in the seventh position of the slippery site were able to stimulate efficient frameshifting in yeast and reticulocyte lysates (Dinman et al. 1991; Brierley et al. 1992; Dinman and Wickner 1992). To examine this parameter the seventh position was mutated to each of the four possible nucleotides in two different heptameric slippery site contexts: U UUA AAN and G GGU UUN. In yeast cells frameshifting was more efficient when the last nucleotide of the slippery site was A or U (Fig. 3A ▶; Table 1 ▶), a trend that was more pronounced when the −1 frame P- and A-site triplets were poly-G and poly-U, respectively (Fig. 3B ▶; Table 1 ▶). A cytosine in the seventh position also promoted efficient frameshifting when the A- and P-site codons were poly-U and poly-A, respectively (the wild-type U UUA AAC sequence) (Fig. 3A ▶; Table 1 ▶). Frameshifting efficiency was diminished when the seventh position was a guanine no matter the A- and the P-site context. In wheat germ lysates, variations in fold change generally matched those of yeast except for the unexpectedly efficient −1 PRF promoted by the U UUA AAG slippery site.

FIGURE 3.

FIGURE 3.

Open in a new tab

Effects of the seventh position of the slippery site on −1 frameshifting in different translational systems. (A) Effects with a SARS-like slippery site. (B) Effects with a (L–A)-like slippery site. Frameshifting efficiencies were determined and expressed as fold change of the SARS wild-type sequence (U UUA AAC) for each construct. The shading of the bars is the same as in Figure 1 ▶. P-values for fold change are in Table 1 ▶.

Though the trends using reticulocyte lysates and Vero cells differed somewhat from those of yeast cells and wheat germ lysates, they were generally similar with each other with some exceptions. For example, the effects of the seventh base positions were less pronounced in reticulocyte lysates, and frameshifting efficiencies were generally higher in reticulocyte lysates when the −1 frame A- and P-site triplets were poly-G and poly-U (Fig. 3B ▶; Table 1 ▶). Additionally, when the A- and the P-site triplets were poly-U and poly-A, −1 PRF was stimulated to a greater degree by A or U in the seventh position in reticulocyte lysates as compared to Vero cells (Fig. 3A ▶; Table 1 ▶). There was a slight preference for A over U or C when the P-site codon was GGG (Fig. 3B ▶; Table 1 ▶). As with the yeast cells, frameshifting efficiency was minimal when guanine was the seventh nucleotide regardless of the A- and the P-site codons.

Comparison of HIV-1 mediated −1 PRF between a human T-cell line and E. coli expression systems

Assay systems are often chosen for cost and convenience. For example, many experiments analyzing the HIV-1 frameshift signal have been performed using relatively inexpensive and convenient E. coli–based translational assay systems instead of the natural host cell, i.e., human T-cells. To investigate whether this might affect measurements of frameshifting HIV-1 promoted −1 PRF was assayed in both in E. coli and a human T-cell line (Jurkat cells)-based assay systems. Frameshifting as measured by the dual luciferase assay was threefold higher in the Jurkat cells (P = 4.2 × 10−4) (Table 2 ▶). These findings suggest that there are significant functional differences between the two systems and raises the question of the utility of heterologous assay systems for mechanistic and pharmacological investigations.

TABLE 2.

Analysis of HIV-1 frameshifting in E. coli and Jurkat cells

HIV-1-directed frameshifting
% Frameshifting Fold change P-value
E. coli 2.4
Jurkat cells 9.6 3.1 4.2 × 10−4
Open in a new tab

Fold changes were calculated for the HIV-1 frameshift signal in a prokaryote cell and in a human T-cell. P-values were determined as previously described in Jacobs and Dinman (2004).

DISCUSSION

Over the past two decades, the number of known −1 PRF signals has increased exponentially. However, assays to monitor frameshifting from these signals have often utilized translational systems derived from sources very distant from the species that the viruses normally infect. We show here that, even within a kingdom, different ribosomes frameshift with different efficiencies in both ribosome and frameshift signal-dependent manners. For example, frameshifting at the infectious bronchitis virus −1 PRF signal in E. coli was pseudoknot-independent and also appeared to require slippage of only a single tRNA, in direct contrast to the requirement for pseudoknots and dual-tRNA slippage in rabbit reticulocyte lysates (Brierley et al. 1997). Thus, while analyses using “mixed” systems may highlight the importance of host features, mechanistic conclusions about the viral frameshift signal could be compromised. Our studies demonstrating significant differences in −1 PRF between E. coli and Jurkat cells (a human T-cell line) sustain this view (Table 2 ▶). This is further supported by studies from other groups highlighting differences in frameshifting mechanism between prokaryotic and eukaryotic systems (Garcia et al. 1993; Sung and Kang 2003). These considerations cast a shadow on the interpretation of mechanistic studies utilizing such “mixed” systems, e.g., those examining HIV-1 frameshifting in E. coli (Weiss et al. 1989; Yelverton et al. 1994; Horsfield et al. 1995; Leger et al. 2004) and should be seriously considered in designing anti-viral drug screens.

Examination of absolute −1 PRF efficiencies shows that in vitro assay systems consistently produced higher values than did the in vivo systems (Fig. 1 ▶; Table 1 ▶). Examination of the raw data (data not shown) also reveals that while the ratios of firefly to Renilla luciferase activities for the readthrough control were similar for the in vivo analyses (yeast = 0.29, Vero cells = 0.30), they were significantly lower in the in vitro cell lysate-based systems (reticulocyte lysate = 0.11, wheat germ lysate = 0.0003). These findings suggest that a higher fraction of translational events were incomplete in the in vitro systems and may reflect gross differences in fidelity between in vitro and in vivo assay systems. However, presentation of the analyses between systems as differences in fold change was used to control for such differences in translation efficiency. The very low activity observed in wheat germ lysates may also reflect differences in the codon usage of the luciferase genes and of wheat genes. Lower frameshifting efficiencies in wheat germ lysates compared to reticulocyte lysates has been previously observed (Garcia et al. 1993). However, codon usage at the slippery site did not correlate with observed differences in frameshifting for each of the systems tested (data not shown).

Examination of absolute frameshift efficiencies may also illuminate how phylogenetic differences in ribosome structure may affect function. It has long been known that the size of ribosome subunits from metazoans are greater than those from fungal and plant ribosomes (“The Comparative RNA Web Site,” http://www.rna.icmb.utexas.edu), and cryo-electron microscopic studies are revealing kingdom-specific differences on a finer scale. For example, a comparison of the architecture of ribosomes from humans and from yeast reveals significantly more mass around the periphery of the human ribosome, mostly attributable to the presence of additional expansion segments, and the E. coli ribosome is even smaller (Spahn et al. 2004). It is possible that these differences may qualitatively affect the interaction between the ribosome and the pseudoknot, affecting the phasing of the slippery site relative to the A- and the P-sites. By this theory, the HIV-1 and SARS-CoV −1 PRF signals would have evolved to optimize frameshifting efficiency in the context of the larger metazoan ribosome.

Analyses of the fold changes for each slippery site in a particular lysate relative to a wild type slippery sequence can be used to highlight different predilections of the various systems for different −1 frame P- and A-site codons and for the wobble nucleotide in the seventh position of the slippery site. For example, regardless of the translation efficacy, the trends for the two metazoan systems, reticulocyte lysate and Vero cells, were similar (Figs. 2 ▶, 3 ▶; Table 1 ▶). The exception was the increase in frameshifting efficiency in reticulocyte lysate when poly-G was in the −1 frame P-site (Figs. 2B ▶, 3 ▶, cf. A and B). We do not know if this difference was a result of reduced efficacy of the in vitro system or if it represents real differences in slippery site specific interactions between monkey (Vero cells) and rabbit (reticulocyte lysate) ribosomes.

In comparing the −1 frame A-site variants, A AAC decoded by tRNAAsn versus U UUC decoded by tRNAPhe, there was an indication of some dependence on the P-site sequence (Fig. 2A ▶; Table 1 ▶). The lower frameshifting efficiencies with the glycine codons in the P-site observed in each system suggests that the strength of the base-pairing of the codon:anticodon interaction in the P-site may be an important determinant of frameshifting. The A-site tRNAs, tRNAAsn and tRNAPhe, each decode two synonymous codons (AAC/AAU and UUC/UUU, respectively) (Marck and Grosjean 2002). The tRNAAsn will be mismatched at the wobble position after repositioning on the −1 AAA codon, whereas tRNAPhe will not. The lack of difference between −1 PRF efficiencies from the U UUA AAC and U UUU UUC signals in Vero cells, yeast cells, and reticulocyte lysates suggests that the ability to repair at the wobble position in the A-site after −1 PRF does not contribute to frameshifting efficiency.

−1 PRF efficiencies differed significantly between the systems depending on the identity of the P-site codon (Fig. 2B ▶; Table 1 ▶). The order of preference for poly-N in the P-site for Vero cells and reticulocyte lysates was U > G > A > C, the same as that determined for the avian infectious bronchitis coronavirus frameshift signal in reticulocyte lysates (Brierley et al. 1992). A similar trend was observed when the BWYV frameshift signal was analyzed in reticulocyte and wheat germ lysates, with poly-U eliciting higher levels of frameshifting than poly-G (Garcia et al. 1993). In contrast, yeast cells displayed very little nucleotide preference for poly-U or poly-G at the P-site in the context of the SARS-CoV. Frameshifting efficiency had previously been shown to be more than sixfold higher with poly-U compared to poly-G in the context of the L-A frameshift signal G GGU UUA (Dinman et al. 1991). This result, and the difference seen between the G GGA AAC and G GGU UUC slippery sites (Fig. 2A ▶; Table 1 ▶), may stem from the different tRNAGly decoding each P-site. These results do not correlate with the strength of P-site hydrogen bonding suggested above but rather suggest that the tRNAs themselves modulate −1 PRF. This could be due to interactions between the peptidyl-tRNA and the ribosome (e.g., see Meskauskas and Dinman 2001), and/or perhaps interactions between the peptidyl- and aminoacyl-tRNAs. The latter seems quite likely when the results from mutations to the seventh position of the slippery site are considered. The identity of peptidyl-tRNA has also been shown to affect the out of frame binding of the A-site tRNA in Ty3 frameshifting (Vimaladithan and Farabaugh 1994).

Similar trends within each system were recorded when the seventh position was mutated and the P-site sequence was either U UUA or G GGU (Fig. 3 ▶; Table 1 ▶). The exceptions were decreased frameshifting in Vero cells with G GGU UUC compared to U UUA AAC, and increased frameshifting in wheat germ lysates when the seventh position was A or U and the P-site was G GGU rather than U UUA. These data clearly indicate that the specific interactions of different ribosomes with particular tRNAs in the A-site affects frameshifting efficiency. The A-site codon has also been shown to affect the rate of P-site frameshifting in eubacteria (Barak et al. 1996). Interestingly, even though the asparagine and phenylalanine codons (AAU/AAC and UUU/UUC, respectively) are each likely decoded by the same tRNA (Marck and Grosjean 2002), frameshifting was different for these codons in each system tested (Fig. 3A ▶, cf. U UUA AAC and U UUA AAU; 3B, cf. G GGU UUC and G GGU UUU). It is possible that these differences stem from the different stability of the codon:anticodon interaction. Modification of the tRNA around the anticodon modulates the stability of this interaction, and conversely, the affinity of these tRNAs for the ribosome (discussed in Agris 2004). It is unclear what effects these modifications have on −1 PRF. tRNAs lacking modifications at position 34 of the tRNA have been shown to promote higher levels of frameshifting in vitro (Carlson et al. 1999, 2000). However, cos 7 (monkey kidney) cells cultured in media with or without queuine, required for a position 34 modification, showed no differences in −1 PRF (Marczinke et al. 2000). Similarly, yeast strains deficient in modifications at position 37 of the tRNA also had no affect on −1 PRF (Dinman and Wickner 1994; Urbonavicius et al. 2003). The different frameshifting frequencies stimulated by tRNAAsn and tRNAPhe may be due to changes in the tRNA structure resulting from the stabilization of the codon:anticodon interaction after the initial selection that then affects ribosomal fidelity.

In conclusion, the data presented here show that there are differences in frameshifting efficiencies in the different systems assayed. These differences may be due to a number of factors, including (1) differences in fidelity between in vivo and in vitro systems; (2) differences in the slipperiness of individual tRNAs; (3) differences in the structure of the tRNAs after decoding; and (4) differences in the structure of different ribosomes. Because of these differences, caution should be taken to match the source of translational systems to as closely as possible to the −1 PRF signal to account for host ribosome specificities.

MATERIALS AND METHODS

Strains, genetic methods, and programmed ribosomal frameshifting assays

E. coli strain DH5α was used to amplify plasmids, and E. coli transformations were performed using the high efficiency transformation method of Inoue et al. (1990). Yeast strain JD932 (MATa ade 2–1 trp1–1 ura3–1 leu2–3,112 his3–11,15 can1–100), Jurkat cells, and African green monkey Vero cells were used for in vivo measurements of −1 PRF. YPAD and synthetic complete medium (H-) were used as described previously in Dinman and Wickner (1994) for yeast culture. Yeast cells were transformed using the alkali cation method (Ito et al. 1983). African green monkey Vero cells and Jurkat cells were cultured in DMEM with L-glutamine or RPMI-1640 with L-glutamine and 25 mM HEPES, respectively (BioWhittaker), supplemented with 10% FBS at 37°C in 5% CO2. Cells cultured without antibiotics were transfected with plasmid DNA using Amaxa Nucleofector solution according to the manufacturer’s instructions (Amaxa). Dual luciferase assays for programmed ribosomal frameshifting in yeast were performed as previously described in Harger and Dinman (2003). Dual luciferase assays using Vero cells or Jurkat cells were performed the day following transfection with cells lysed with the Passive Lysis Buffer (Dual-Luciferase Reporter System, Promega) as previously described in Plant et al. (2005). E. coli cells were cultured in LB media with carbenicillin for plasmid maintenance overnight. They were diluted 1:20 in fresh LB with isopropyl-β-D-thiogalactopyranoside to a final concentration of 1 mM to induce dual luciferase production and cultured for an additional 3 h. Cells were harvested by centrifugation and lysed for 15 min in Passive Lysis Buffer prior to the luciferase assay. Wheat germ and rabbit reticulocyte lysates containing tRNAs from Ambion were used to monitor frameshifting in vitro using synthetic mRNA transcripts (Ambion mMESSAGE mMACHINE transcription kit), generated with T7 polymerase from plasmids that had been digested with SspI, Proteinase K–treated, phenol/chloroform- and chloroform-extracted, and ammonium acetate–precipitated. At least three readings were taken for each assay, and the assays were repeated (n = 2–12) until the data were normally distributed to enable statistical analyses both within and between experiments (Jacobs and Dinman 2004).

Plasmid construction, oligonucleotides, and mutagenesis

The SARS-CoV frameshift signal has previously been characterized and dual luciferase plasmids containing the sequence responsible were described in Plant et al. (2005). Three sets of plasmids were used in this work: the first for expression in yeast, the second set for analyses in tissue culture and cell lysates, and the third for expression in E. coli. The yeast zero-frame control plasmid pJD474 has the frameshift signal cloned such that the luciferase coding regions are in frame with respect to each other, while test plasmid pJD465 requires a frameshift event for the expression of the downstream firefly protein, which is in the −1 frame with respect to the Renilla open reading frame. The second set of plasmids, the zero frame control pJD464 and −1 PRF test construct pJD502, contain the SV40 early promoter, T7 promoter, and SV40 late polyadenylation signal for expression in mammalian tissue culture and transcription of RNAs for in vitro analyses in cell free lysates. pJD465 and pJD502 were used as templates for site-directed mutagenesis of the slippery site. Vectors with the HIV frameshift signal cloned into the dual luciferase plasmids for transfection into mammalian cells have previously been described (Grentzmann et al. 1998). PCR primers were used to amplify the dual luciferase cassette from both the control and test plasmid such that the cassette could be cloned into pBluescript II SK+ as a HindIII-BcuI fragment. Expression of the dual luciferase proteins was induced in E. coli as described above. These are now summarized in Table 3 ▶.

TABLE 3.

Summary of plasmids and slippery sites

Slippery site Plasmid (yeast) Plasmid (othera)
U UUA AAC pJD465 pJD502
U UUA AAU pJD678 pJD681
U UUA AAG pJD679 pJD682
U UUA AAA pJD680 pJD683
G GGU UUC pJD576 pJD648
G GGU UUU pJD698 pJD658
G GGU UUA pJD575 pJD647
G GGU UUG pJD577 pJD649
G GGA AAC pJD572 pJD646
C CCA AAC pJD696 pJD656
A AAA AAC pJD697 pJD657
A AAA AAU pJD654 pJD584
HIV-1 frameshift indicator N.A. pJD786 (E. coli)
HIV-1 control N.A. pJD787 (E. coli)
Open in a new tab

Plasmids used to monitor frameshifting in yeast are as indicated.

aUsed to indicate plasmids used to monitor frameshifting in Vero cells, rabbit reticulocyte lysates, and wheat germ lysates.

In general, the slippery site can be defined as N NNW WWH, where N is any three identical bases; W is A or U; and H is A, C, or U (the frame of the initiator AUG is indicated by the spacing) (Dinman et al. 1991; Brierley et al. 1992; Dinman and Wickner 1992). The SARS wild-type slippery site was mutated from the native UUUAAAC sequence to an assortment of variations that conform to the known N NNW WWH requirements. Mutatgenesis was performed using the Stratagene QuikChange XL II kit using oligonucleotides synthesized and purified by IDT (Table 4 ▶). All mutations were confirmed by sequencing. Sequences of genes encoding tRNAs and known tRNA were obtained from the Web site http://www.uni-bayreuth.de/departments/biochemie/sprinzl/trna/ (Sprinzl et al. 1998).

TABLE 4.

Synthetic oligonucleotides employed for site-directed mutagenesis

slipmut1F GCTCCGGATCCGTTTTTGAAMGGGTTTGCGGTGTAAGTG
slipmut1R CACTTACACCGCAAACCCKTTCAAAAACGGATCCGGAGC
slipmut2F GCGCTCCGGATCCGTTTTTTTTYGGGTTTGCGGTGTAAGTGCAG
slipmut2R CTGCACTTACACCGCAAACCCRAAAAAAAACGGATCCGGAGCGC
slipmut3F GCGCTCCGGATCCGTTGGGAAACGGGTTTGCGGTG
slipmut3R CACCGCAAACCCGTTTCCCAACGGATCCGGAGCGC
slipmut5F GCTCCGGATCCGTTGGGTTTWGGGTTTGCGGTGTAAGTGC
slipmut5R GCACTTACACCGCAAACCCSAAACCCAACGGATCCGGAGC
slipmut6F GATCTAGCGCTCCGGATCCGTTAAAAAATGGGTTTGCGGTGTAAGTGC
slipmut6R GCACTTACACCGCAAACCCATTTTTTAACGGATCCGGAGCGCTAGATC
SARSuadF CGTTTTTAAADGGGTTTGCGGTGTAAGTGCAGC
SARSuahDLR AACCCHTTTAAAAACGGATCCGTCGACATTTG
SARSguuF CGTTGGGTTTTGGGTTTGCGGTGTAAGTGCAGC
SARSguuDLR AACCCAAAACCCAACGGATCCGTCGACATTTG
SARSaacF CGTTAAAAAACGGGTTTGCGGTGTAAGTGCAGC
SARSaacDLR AACCCGTTTTTTAACGGATCCGTCGACATTTG
SARScacF CGTTCCCAAACGGGTTTGCGGTGTAAGTGCAGC
SARScacDLR AACCCGTTTGGGAACGGATCCGTCGACATTTG
Hind II Fluc TTCAAGCTTACAATTTGGACTTTCC
Bcu I Rluc CCACTAGTAATGACTTCGAAGTTTATG
Open in a new tab

Acknowledgments

We thank members of Dinman lab for invigorating discussion and Dr. J. DeSefano for the Jurkat cells. This work was supported by a grant to J.D.D. from the NIH (GM58859).

Article published online ahead of print. Article and publication date are at http://www.rnajournal.org/cgi/doi/10.1261/rna.2225206.

REFERENCES

  1. Agris, P.F. 2004. Decoding the genome: A modified view. Nucleic Acids Res. 32: 223–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barak, Z., Gallant, J., Lindsley, D., Kwieciszewki, B., and Heidel, D. 1996. Enhanced ribosome frameshifting in stationary phase cells. J. Mol. Biol. 263: 140–148. [DOI] [PubMed] [Google Scholar]
  3. Bekaert, M. and Rousset, J.P. 2005. An extended signal involved in eukaryotic −1 frameshifting operates through modification of the E site tRNA. Mol. Cell 17: 61–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bekaert, M., Bidou, L., Denise, A., Duchateau-Nguyen, G., Forest, J.P., Froidevaux, C., Hatin, I., Rousset, J.P., and Termier, M. 2003. Towards a computational model for −1 eukaryotic frameshifting sites. Bioinformatics 19: 327–335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brierley, I., Jenner, A.J., and Inglis, S.C. 1992. Mutational analysis of the “slippery-sequence” component of a coronavirus ribosomal frameshifting signal. J. Mol. Biol. 227: 463–479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brierley, I., Meredith, M.R., Bloys, A.J., and Hagervall, T.G. 1997. Expression of a coronavirus ribosomal frameshift signal in Escherichia coli: Influence of tRNA anti-codon modification on frameshifting. J. Mol. Biol. 270: 360–373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Carlson, B.A., Kwon, S.Y., Chamorro, M., Oroszlan, S., Hatfield, D.L., and Lee, B.J. 1999. Transfer RNA modification status influences retroviral ribosomal frameshifting. Virology 255: 2–8. [DOI] [PubMed] [Google Scholar]
  8. Carlson, B.A., Kwon, S.Y., Lee, B.J., and Hatfield, D. 2000. Yeast asparagine (Asn) tRNA without Q base promotes eukaryotic frameshifting more efficiently than mammalian Asn tRNAs with or without Q base. Mol. Cells 10: 113–118. [DOI] [PubMed] [Google Scholar]
  9. Dinman, J.D. and Wickner, R.B. 1992. Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast m1 double-stranded RNA virus propagation. J. Virol. 66: 3669–3676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. ———. 1994. Translational maintenance of frame: Mutants of Saccharomyces cerevisiae with altered −1 ribosomal frameshifting efficiencies. Genetics 136: 75–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dinman, J.D., Icho, T., and Wickner, R.B. 1991. A −1 ribosomal frameshift in a double-stranded RNA virus forms a gag–pol fusion protein. Proc. Natl. Acad. Sci. 88: 174–178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Garcia, A., Vanduin, J., and Pleij, C.W.A. 1993. Differential response to frameshift signals in eukaryotic and prokaryotic translational systems. Nucleic Acids Res. 21: 401–406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Giedroc, D.P., Theimer, C.A., and Nixon, P.L. 2000. Structure, stability and function of RNA pseudoknots involved in stimulating ribosomal frameshifting. J. Mol. Biol. 298: 167–185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Grentzmann, G., Ingram, J.A., Kelly, P.J., Gesteland, R.F., and Atkins, J.F. 1998. A dual-luciferase reporter system for studying recoding signals. RNA 4: 479–486. [PMC free article] [PubMed] [Google Scholar]
  15. Harger, J.W. and Dinman, J.D. 2003. An in vivo dual-luciferase assay system for studying translational recoding in the yeast Saccharomyces cerevisiae. RNA 9: 1019–1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Horsfield, J.A., Wilson, D.N., Mannering, S.A., Adamski, F.M., and Tate, W.P. 1995. Prokaryotic ribosomes recode the Hiv-1 gag–pol-1 frameshift sequence by an E/P site post-translocation simultaneous slippage mechanism. Nucleic Acids Res. 23: 1487–1494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Inoue, H., Nojima, H., and Okayama, H. 1990. High efficiency transformation of Escherichia coli with plasmids. Gene 96: 23–28. [DOI] [PubMed] [Google Scholar]
  18. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153: 163–168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jacks, T., Power, M.D., Masiarz, F.R., Luciw, P.A., Barr, P.J., and Varmus, H.E. 1988. Characterization of ribosomal frameshifting in Hiv-1 gag–pol expression. Nature 331: 280–283. [DOI] [PubMed] [Google Scholar]
  20. Jacobs, J.L. and Dinman, J.D. 2004. Systematic analysis of bicistronic reporter assay data. Nucleic Acids Res. 32: E160–E170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Leger, M., Sidani, S., and Brakier-Gingras, L. 2004. A reassessment of the response of the bacterial ribosome to the frameshift stimulatory signal of the human immunodeficiency virus type 1. RNA 10: 1225–1235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Marck, C. and Grosjean, H. 2002. TRNomics: Analysis of tRNA genes from 50 genomes of eukarya, archaea, and bacteria reveals anti-codon-sparing strategies and domain-specific features. RNA 8: 1189–1232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Marczinke, B., Hagervall, T., and Brierley, I. 2000. The Q-base of asparaginyl-tRNA is dispensable for efficient −1 ribosomal frame-shifting in eukaryotes. J. Mol. Biol. 295: 179–191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Matsufuji, S., Matsufuji, T., Wills, N.M., Gesteland, R.F., and Atkins, J.F. 1996. Reading two bases twice: Mammalian antizyme frameshifting in yeast. EMBO J. 15: 1360–1370. [PMC free article] [PubMed] [Google Scholar]
  25. Meskauskas, A. and Dinman, J.D. 2001. Ribosomal protein L5 helps anchor peptidyl-tRNA to the P-site in Saccharomyces cerevisiae. RNA 7: 1084–1096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Napthine, S., Liphardt, J., Bloys, A., Routledge, S., and Brierley, I. 1999. The role of RNA pseudoknot stem 1 length in the promotion of efficient −1 ribosomal frameshifting. J. Mol. Biol. 288: 305–320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Napthine, S., Vidakovic, M., Girnary, R., Namy, O., and Brierley, I. 2003. Prokaryotic-style frameshifting in a plant translation system: Conservation of an unusual single-tRNA slippage event. EMBO J. 22: 3941–3950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ogle, J.M. and Ramakrishnan, V. 2005. Structural insights into translational fidelity. Annu. Rev. Biochem. 74: 129–177. [DOI] [PubMed] [Google Scholar]
  29. Plant, E.P., Perez-Alvarado, G.C., Jacobs, J.L., Mukhopadhyay, B., Hennig, M., and Dinman, J.D. 2005. A three-stemmed mRNA pseudoknot in the SARS coronavirus frameshift signal. PLoS Biol. 3: 1012–1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Spahn, C.M., Jan, E., Mulder, A., Grassucci, R.A., Sarnow, P., and Frank, J. 2004. Cryo-Em visualization of a viral internal ribosome entry site bound to human ribosomes: The ires functions as an RNA-based translation factor. Cell 118: 465–475. [DOI] [PubMed] [Google Scholar]
  31. Sprinzl, M., Horn, C., Brown, M., Ioudovitch, A., and Steinberg, S. 1998. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 26: 148–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sung, D. and Kang, H. 2003. Prokaryotic and eukaryotic translational machineries respond differently to the frameshifting RNA signal from plant or animal virus. Virus Res. 92: 165–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tsuchihashi, Z. and Brown, P.O. 1992. Sequence requirements for efficient translational frameshifting in the Escherichia-coli-Dnax gene and the role of an unstable interaction between transfer RNA(Lys) and an Aag lysine codon. Genes & Dev. 6: 511–519. [DOI] [PubMed] [Google Scholar]
  34. Urbonavicius, J., Stahl, G., Durand, J.M., Ben Salem, S.N., Qian, Q., Farabaugh, P.J., and Bjork, G.R. 2003. Transfer RNA modifications that alter +1 frameshifting in general fail to affect −1 frameshifting. RNA 9: 760–768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Vimaladithan, A. and Farabaugh, P.J. 1994. Special peptidyl-transfer-RNA molecules can promote translational frameshifting without slippage. Mol. Cell. Biol. 14: 8107–8116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Weiss, R.B., Dunn, D.M., Shuh, M., Atkins, J.F., and Gesteland, R.F. 1989. E. coli ribosomes re-phase on retroviral frameshift signals at rates ranging from 2 to 50 percent. New Biol. 1: 159–169. [PubMed] [Google Scholar]
  37. Yelverton, E., Lindsley, D., Yamauchi, P., and Gallant, J.A. 1994. The function of a ribosomal frameshifting signal from human immunodeficiency virus −1 in Escherichia coli. Mol. Microbiol. 11: 303–313. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from RNA are provided here courtesy of The RNA Society

RESOURCES