Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Mar 1.
Published in final edited form as: ISME J. 2008 Nov 13;3(3):271–282. doi: 10.1038/ismej.2008.109

The Biofilm Life-Cycle and Virulence of Pseudomonas aeruginosa are Dependent on a Filamentous Prophage

Scott A Rice 1,2, Chuan Hao Tan 1,2,*, Per Jensen Mikkelsen 1,2,, Vanderlene Kung 3, Jerry Woo 1,2, Martin Tay 1,2, Alan Hauser 3, Diane McDougald 1,2, Jeremy S Webb 1,2,, Staffan Kjelleberg 1,2,**
PMCID: PMC2648530  NIHMSID: NIHMS93848  PMID: 19005496

Abstract

Mature Pseudomonas aeruginosa biofilms undergo specific developmental events. Using a bacteriophage mutant, generated by deletion of the entire filamentous Pf4 prophage, we show that the phage is essential for several stages of the biofilm life-cycle and that it significantly contributes to the virulence of P. aeruginosa in vivo. Here, we show for the first time that biofilms of the Pf4 phage deficient mutant did not develop hollow centres or undergo cell death, typical of the differentiation process of wild-type P. aeruginosa PAO1 biofilms. Furthermore, microcolonies of the Pf4 mutant were significantly smaller in size and less stable compared to the wild-type biofilm. Small colony variants (SCVs) were detectable in the dispersal population of the wild-type biofilm at the time of dispersal and cell death, whilst no SCVs were detected in the effluent of the Pf4 biofilm. This study shows that at the time when cell death occurs in biofilms of the wild-type, the Pf4 phage converts into a superinfective form, which correlates with the appearance of variants in the dispersal population. Unexpectedly, mice infected with the Pf4 mutant survived significantly longer than those infected with its isogenic wild-type strain, demonstrating that Pf4 contributes to the virulence of P. aeruginosa. Hence, a filamentous prophage is a major contributor to the life cycle and adaptive behaviour of P. aeruginosa and offers an explanation for the prevalence of phage in this organism.

Keywords: biofilm, filamentous phage, prophage, Pseudomonas aeruginosa, small colony variant, virulence

Introduction

Bacteriophage have been suggested to be one of the most abundant biological agents on the planet, estimated at a total of 1 ×1031 (Rohwer and Edwards, 2002), compared to 2–6 ×1030 bacterial cells (Whitman et al, 1998), outnumbering prokaryotes approximately 10:1. Given this numerical dominance, it is not surprising that phage play important roles in the biosphere despite being unable to replicate independently. For example, it has been suggested that phage are the major cause of bacterial death in the environment and thus, bacteriophage are thought to have a significant impact on nutrient cycling due to bacterial lysis (Wilhelm and Suttle, 1999). Bacteriophage also play important roles in the transfer of genetic material between bacteria and clearly represent an important factor in bacterial evolution. Furthermore, the strong selective pressure of phage-mediated lysis can drive evolution of the target population, so that infection resistant mutants may become dominant in the population. For example, Brockhurst et al. (Brockhurst et al, 2005) have shown that phage mediate changes in the bacterial population, controlling the emergence of different variants. The selective pressure of lytic bacteriophage has also been shown to drive the appearance of mutator phenotypes in the host, which have the potential to escape infection (Pal et al, 2007).

Selective pressures are also likely to operate on lysogenic phage, which integrate themselves into the host genome. This relationship is not neutral, where the integrated phage can represent a genetic, eg. replicative, burden to the host. Thus the prophage must either confer a selective advantage on the host or it risks accumulating mutations that render it defective. For example, the pyocins of P. aeruginosa appear to be remnants of phage tail spike genes, and thus have been maintained because they provide a competitive advantage by killing off sensitive bacteria (Nakayama et al, 2000). It has also been shown that the lambda encoded gene products Bor and Lom respectively are important as virulence factors for attachment or immune system evasion during infection (Tinsley et al, 2006). Thus, based on their abundance and effects on the prokaryotic community, it is clear that viruses play a significant role in bacterial survival, activity and evolution.

Bacteria predominantly live in high-density communities, called biofilms, where there are likely to be significant interactions between bacteriophage and their host. This may be particularly important if bacteriophage play active roles in the biofilm life-cycle or if they mediate bacterial diversity during biofilm development. For example, it has recently been shown that filamentous phage can be isolated from biofilms of P. aeruginosa during the dispersal phase of the biofilm life-cycle and that the appearance of the phage correlated with the appearance of small colony variants (SVCs) (Webb et al, 2004; Webb et al, 2003). The appearance of dispersal variants has been linked to increased adaptability of the dispersal population (Boles et al, 2004; Koh et al, 2007; Mai-Prochnow et al, 2004; Purevdorj-Gage et al, 2005). SVCs are particularly important during chronic infection of the lungs of cystic fibrosis patients, where the appearance of SCVs correlates with poor lung function and increased resistance to antibiotic therapies (Haussler et al, 1999). It was further shown that the addition of purified phage to biofilms of P. aeruginosa resulted in the induction of cell death within microcolonies and the emergence of SVCs linking the phage to both phenomena (Webb et al, 2004; Webb et al, 2003). This is supported by the observation that the Pf4 genes are some of the most strongly induced genes in biofilms of P. aeruginosa (Whiteley et al, 2001). In our previous attempt to make a Pf4 deletion strain, it was observed that the replicative form (RF) was retained and that infective Pf4 phage could be recovered from biofilm supernatants (Webb et al, 2003). Thus, it is possible that the RF form of the phage could rescue the defective chromosomal prophage. In the present study, we have generated a defined Pf4 a chromosomal deletion mutant of the entire Pf4 prophage genome. Deletion of the chromosomal Pf4 prophage resulted in loss of the RF form of the phage, and we confirmed that the Pf4 mutant did not produce Pf4 phage. Using this mutant, we showed that the phage plays an important role in biofilm development of P. aeruginosa PAO1, the formation of small colony variants as well as the structural integrity of the biofilm. These effects are manifested at the time when the phage becomes capable of superinfection, and we propose that the formation of the superinfective form is essential for key biofilm stages including autolysis, microcolony maturation and stability, and dispersal as well as for the formation of morphotypic variants. Finally, we show that the phage mutant was less virulent than the wild-type (wt), highlighting the overall significance of the phage in the biofilm developmental life-cycle and the ability of P. aeruginosa to infect a host.

Materials and Methods

Bacterial strains and culture conditions

The bacterial strains and plasmids used in this study are listed in Table 1. E. coli and P. aeruginosa strains were maintained on Luria-Bertani (LB) medium (Bertani, 1951), either in the broth or on the LB plates supplemented with 1.5 % w/v agar when necessary. For plasmid maintenance in E. coli, the medium was supplemented with 100 μg/ml ampicillin, 100 μg/ml carbenicillin or 30 μg/ml gentamicin. The P. aeruginosa Pf4 knockout mutant (PAO1ΔPf4) was grown in LB medium supplemented with 30 μg/ml gentamicin. Cultures were incubated overnight at 37°C at 200 rpm.

Table 1.

Bacterial strains and plasmids used in this study.

Strain or plasmid Genotype and/or phenotypea Reference or origin
Strains
E. coli
  DH5α F 80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk, mk+) phoA supE44 thi-1 gyrA96 relA1 tonA (48)
P. aeruginosa
  PAO1 Wild-type (WT) Lab stock
  ΔlasR-rhlR PAO1, double deletion mutation of lasR-rhlR (45)
  PAO1ΔPf4 PAO1, Δ(Pf4)::Gmr This study
 Plasmids
  pPS856 ApR, GmR; 0.83-kb blunt-ended SacI fragment from pUCGM ligated into the EcoRV site of pPS854 (42)
  pDONR221 KmR; Gateway donor vector (40)
  pEX18ApGW ApR; Gateway destination vector (40)
  pEX2.5 pEX18ApGW gene replacement vector carrying a Gmr cassette flanked by a 300 bp Pf4 upstream fragment and a 300 bp Pf4 downstream fragment (attB1-‘Pf4-FRT-Gm-FRT-Pf4′-attB2); ColE1 replicon; sacB Gmr Apr Cbr This study
a

Abbreviations: SmR, streptomycin resistance; GmR, gentamicin resistance; ApR, ampicillin resistance; CbR, carbenicillin resistance; KnR, kanamycin resistance att, attachment site; ‘Pf4, upstream of the Pf4 phage gene cluster; Pf4’, downstream of the Pf4 phage gene cluster (refer to Table 2 for details); FRT, Flp recombinase target; GFP, green fluorescent protein.

Construction of a Pf4 deletion vector

A genomic knockout of the entire Pf4 prophage was generated by cloning the genomic regions flanking the Pf4 prophage into the suicide vector pEX18ApGW (Choi and Schweizer, 2005). The ends of the Pf4 prophage were amplified using two sets of primers Pf4-UpF-GWL and Pf4-UpR-GM (Table 2), which amplify a 300 bp region from position 785011 to 785310 and primers Pf4-DnF-GM and Pf4-DnR-GWR which amplify a 300 bp region corresponding to positions 797748–798047 of the published PAO1 genome (Stover et al, 2000) (www.Pseudomonas.com). Fig. 1 shows a schematic representation of primer binding sites and the final deletion construction. At the same time, a 1053 bp PCR fragment was generated using primers GmF and GmR (Table 2), which amplify the gentamicin cassette plus the flanking FRT region from plasmid pPS856 as described (Hoang et al, 1998). These primers have incorporated sequences that allow for the amplified fragments to be joined by Splicing Overlap Extension PCR (SOE PCR) (Horton et al, 1990). Three PCR cycles were performed without the addition of primers to join the two Pf4 fragments to the FRT-gentamicin-FRT cassette, after which time, primers GWL-attB1 and GWR-attB2 (Table 2) were added and the entire region was amplified. Note that the latter two primers also incorporate att sites at the ends of the PCR fragment. The reaction mixture consisted of 1 × Pwo buffer, 5% DMSO, 200 uM dNTP’s and 0.05 U/ul Pwo polymerase (Roche). Cycle conditions were: 94°C hot start for 2 min, after which the polymerase was added, followed by 3 cycles of 94°C for 30 s, 55°C for 30 s, 68°C for 1 min. After the 3 cycles, primers GWL-attB1 and GWR-attB2 were added for the second PCR stage which consisted of: 94°C for 30 s, 56°C for 30 s, 68°C for 5 min for a total of 25 cycles followed by a final 10 min step at 68°C. The gel purified PCR fragment was then cloned into plasmid pDONR221 using the clonase method (Invitrogen) and subsequently transferred into pEX18ApGW as described (Choi and Schweizer, 2005) to generate plasmid pEX2.5. The construct and correct insertion into pEX18ApGW was confirmed by sequencing from the M13 primer sites that are located outside the cloning site.

Table 2.

Primers used in this study

Primer number Primer Sequence (5′−3′)1 Chromosomal position Amplified product
1 Pf4-UpF- GWL tacaaaaaagcaggctTCTGGGAATACGACGGGGGC 785011 5′ of attL
2 Pf4-UpR- GM tcagagcgcttttgaagctaattcgGATCCCAATGCAAAAGCCCC 785310 3′ of attL

3 Pf4-DnF- GM aggaacttcaagatccccaattcgCGTCATGAGCTTGGGAAGCT 797748 5′ of attR
4 Pf4-DnR- GWR tacaagaaagctgggtTGGCAGCAGACCCAGGACGC 798047 3′ of attR

5 GmF CGAATTAGCTTCAAAAGCGCTCTGA Gentamicin cassette with FRT sites
6 GmR CGAATTGGGGATCTTGAAGTTCCT From pPS856

7 GWL-attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCT
8 GWR-attB2 GGGGACCACTTTGTACAAGAAAGCTGGGT

9 RF-F AGCAGCGCGATGAAGCAAT 797111 – 797129 3′ of attL
10 RF-R TAGAGGCCATTTGTGACTGGA 785538 – 785518 5′ of attR

11 Pre-Pfk-F GTGGTTGCTTCCCTGTTCAT 784716 – 784735 596 bp 5′ attL
12 Pre-Pfk-R ACTTCCATATCCGCGAAGTG 798259 – 798240 513 bp 3′ of attR

13 GendelF ATCTTTCCCGGGCTTTACG 785227 – 785245 85 bp 5′ of attL
14 GendelR GCAATTGGCAAAGTGTTCGA 786046 – 786027 3′ of attL

M13 F GTAAACGACGGCCAGT
M13 R AAACAGCTATGACCATG
1

, Sequences in lower case are common sequences for overlap amplification with either the attB primers or the Gm primers. Sequences in uppercase are gene specific.

Fig. 1.

Fig. 1

Construction of the Pf4 chromosomal deletion and location of primers. A) The genomic organization of the Pf4 prophage in P. aeruginosa PAO1 shown. The integration sites, attL and attR are shown, along with open reading frames, shown as thick arrows. Numbers above the arrows indicate gene numbers (adapted from (Webb et al, 2004)). Solid lines indicate amplification products and numbers indicate primers, as listed in Table 2. Small arrows indicate individual primers and are also numbered with reference to Table 2. B) Organisation of the ΔPf4 genomic region subsequent to deletion of the prophage. Black lines indicate the amplified 3′ and 5′ regions which are ligated to the FRT sites (hatched circles), recognised by the Flp recombinase, and the gentamycin resistance cassette (grey line, Gmr). The figures are not drawn to scale.

Generation of a Pf4 chromosomal deletion in P. aeruginosa PAO1

The pEX2.5 suicide vector was purified using the Wizard® Plus Minipreps DNA purification systems (Promega Inc., Australia) and electroporated into P. aeruginosa PAO1 as described (Choi and Schweizer, 2005). Six ml of an overnight culture grown in LB medium was harvested in four 2 ml tubes by centrifugation at 16 000 g for 2 min at room temperature and washed twice with 1 ml of 300 mM sucrose. Pellets from the four tubes were combined together and resuspended to a final volume of 100 ul of 300 mM sucrose. Five hundred ng of the pEX2.5 suicide vector DNA was mixed with 100 ul of electrocompetent cells in an electroporation cuvette. Electroporation was performed using a GenePulserXcell electroporator (Bio-Rad, USA) at 25 μF, 200 Ohm and 2.5 kV. One ml of LB medium was added immediately after electroporation, the cells were transferred to a 2 ml tube and incubated for 2 hours at 37 °C with constant shaking at 200 rpm. The culture was concentrated to 100 ul and plated onto LB agar supplemented with 30 μg/ml of gentamicin (LB+Gm30) and incubated at 37 °C for 24 h. Transformant colonies were patched onto LB+Gm30 and LB+Cb200 (LB agar supplemented with 200 μg/ml of carbenicillin) plates to differentiate single cross-over mutants from double cross-over mutants. Transformants which were gentamicin resistant and carbenicillin sensitive were considered to be putative double cross-over deletion mutants.

Confirmation of the deletion strain

Colonies of putative double crossover mutants were resuspended in 50 μl of sterile water and incubated at 100 °C for 7 min. Cell debris was removed by centrifugation at 16 000 g for 2 min and the supernatant was transferred to an ice-cold 1.5 ml tube. Five ul of the supernatant was used as the template DNA for PCR: 2 mM MgCl2, 1× AmpliTaq PCR buffer, 600 uM of each primer (Sigma Genosys Pty Ltd, NSW, Australia) (Table 2), 0.4 μM dNTPs and 0.05 U/ul of AmpliTaq Polymerase (Applied Biosystems, USA). PCR cycling conditions were 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 55 °C to 60 °C for 30 s depending on the primer set used (Table 2) and 72 °C for 2 min; with a final extension at 72 °C for 10 min. PCR products were visualized via gel electrophoresis on a 2 % (w/v) agarose gel.

Biofilm formation and assessment

Biofilms were cultivated in flow cells (channel dimensions, 1 mm × 4 mm × 40 mm), as described by Moller et al. (Moller et al, 1998) with some modifications. The flow cell was sterilized in 10% (v/v) bleach for 4 h, thoroughly rinsed in sterile milliQ water, and connected to sterile silicon tubing (Silastic® laboratory tubings). The flow cell system was flushed with sterile medium (M9 minimal salts medium with glucose: Na2HPO4, 47.8 mM; KH2PO4, 22 mM; NH4Cl, 6.8 mM; NaCl, 18.7 mM; CaCl2, 100 uM; MgSO4, 2 mM or 5.6 mM glucose) for 4 h at a flow rate of 6 ml/h prior to the inoculation of bacterial culture. One ml of an overnight culture of PAO1 (WT) or PAOΔPf4 mutant was injected into the flow cell, and incubated for 1 h without flow at room temperature in an inverted position. The medium flow was resumed at a flow rate of 6 ml/h. Three independent experiments in triplicate were conducted for 7 days. Biofilms were stained with the LIVE/DEAD BacLight® viability probes (Molecular Probes Inc., Eugene, OR) and visualized using an Olympus FV1000 confocal scanning laser microscope (Olympus Optical Co. Ltd., Tokyo, Japan) with argon-ion laser excitation at 488 nm or 594 nm and emission filters at 522–535 nm or 605–632 nm to visualize the live, green fluorescent cells and the dead, red fluorescent cells, respectively. The CSLM images were analyzed using ImageJ version 1.36b (http://rsb.info.nih.gov/ij/) and statistical analysis was performed using Prism 4.03 for Windows (GraphPad Software Inc., USA).

Phage add-back to biofilms

Because the integration site for the Pf4 is removed during mutant construction, it was not possible to perform genetic complementation. Therefore, functional complementation was performed by adding superinfective Pf4 phage to biofilms of the wt and the Pf4 mutant. Superinfective Pf4 phage were collected from the effluent of 5–6 day old biofilms of the wild-type P. aeruginosa. Phage particles were concentrated by the addition an equal volume of phage precipitation buffer (2 M NaCl, 4% Poly Ethylene Glycerol (m.w. 8000)) and incubated at 4 °C for 8 h. Precipitated phage was then concentrated via centrifugation at 15 000 g for 20 min. The pellet containing phage particles was resuspended in 3 ml of SM buffer (100 mM NaCl, 10 mM MgSO4, 50 mM Tris HCl (pH 7.5)). Superinfection and phage titere were determined by quantification of pfu on lawns of both the wild-type and Pf4 mutant. Biofilms of the wt or the ΔPf4 strains were allowed to develop in the flow cell for 3 days, after which time, the medium was changed from M9 medium to M9 medium supplemented with filter sterilized Pf4 (1×106 pfu/ml) for 24 h. Viability of the phage treated biofilms along with the negative controls was determined by LIVE/DEAD staining. Biofilms were stained with the LIVE/DEAD BacLight viability stain (Invitrogen, USA) for 1 h before visualizing with a confocal scanning laser microscope, Olympus LSMGB200 (Olympus Optical Co., Japan), viable cells would be stained green and non-viable cells would be stained red.

Quantification of phage

Phage plaque assays were performed using a modified version of top-layer agar (TLA) method as previously described by Webb et al. (Webb et al, 2003). One ml of culture was collected and centrifuged at 16 000 g for 5 min and filter sterilised using a 0.2 um filter (Acro-disk, Pall Co.). The cell-free supernatant was serially diluted and spotted onto LB medium top layer containing 0.8% (w/v) agar seeded with 1 × 108 cells/ml of P. aeruginosa PAO1 (WT) or the PAO1ΔPf4 mutant. The number of plaques formed after 18 h of incubation at 37 °C, was determined using a Leica ZOOM 2000 dissecting microscope (Bufferlab, USA) and plaque forming units (pfu) per ml for each sample were calculated.

SDS treatment of biofilms

In order to assess the stability of wild type and P. aeruginosa PAO1 and the PAO1ΔPf4 mutant biofilms to SDS treatment, 4-day-old biofilms were fed with M9 medium containing 0.01% SDS for 2 hours. CSLM images were acquired before and after the SDS treatment. As a further control, the P. aeruginosa lasR/rhlR quorum sensing deficient double mutant (Beatson et al, 2002), previously shown to be less stable during SDS treatment than the wild type (Davies et al, 1998; Hentzer et al, 2003; Allesen-Holm et al, 2006), was also included. The CSLM images were analysed using ImageJ version 1.36b.

Infection by the wild-type and Pf4 mutant

Survival experiments comparing wt and the Pf4 mutant were performed using the nasal aspiration mouse model of acute pneumonia (Comolli et al, 1999). Briefly, bacteria were grown for 17 h in MINS medium (Nicas and Iglewski, 1984) at 37°C with shaking, diluted 1:100 in MINS medium 3 h prior to infection, concentrated by centrifugation, and then re-suspended in phosphate-buffered saline (PBS). Bacterial concentrations were determined by measuring optical densities and verified by viable counts on LB plates. Using a pipette tip, approximately 7×107 cfu of bacteria in 50 μL PBS were instilled into the nares of 6- to 8-week-old BALB/c mice anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/ml) and xylazine (20 mg/ml). For each survival experiment, 5 mice each were infected with mutant or wild type bacteria and then monitored for viability over 7 days. Severely ill mice were sacrificed and scored as dead. Results from 3 separate experiments were pooled. Statistical significance was assigned by the log-rank test. All experiments were approved by the Northwestern University Animal Care and Use Committee.

Results

Isolation of a Pf4 knockout

Transformants of P. aeruginosa that had been electroporated with the suicide Pf4 deletion vector pEX2.5 were screened on LB plates for gentamicin resistance and carbenicillin sensitivity to identify putative double-crossover mutants. One clone was identified and selected for further verification by colony PCR. Primers Pre-Pfk-F and Pre-Pfk-R bind to positions 784716–784735 and 798259-798240 (Table 2), which lie outside of the Pf4 genomic region and are not expected to generate a product from either a wild-type (wt) or a single-crossover, but would generate a 2.2 kb product in a double-crossover mutant (also see Fig. 1). Primers GendelF and GendelR bind to positions 785227–785245 and 786046-786027 (Table 2) and will only generate a PCR product in the wt or in a single-crossover but not in the double-crossover mutant. One set of primers, GWL-attB1 and Pre-Pfk-R, was chosen that would amplify an internal fragment of the suicide vector in the event of a single-crossover insertion. Lastly, primers RF-F and RF-R (Table 2) were designed to specifically amplify an 839 bp region of the extra chromosomal replicative form (RF) of the Pf4 filamentous phage. Analysis of the PCR products from the wt as a control and the putative Pf4 mutant demonstrated the expected banding patterns for the wt and a double-crossover respectively (data not shown). Interestingly, while the RF of the Pf4 filamentous phage, which is an extragenic, circular-copy of the phage genome, could be detected in the wt, no product was observed in the putative mutant, suggesting the putative mutant had been spontaneously cured of the RF form (data not shown). To confirm that the pEX2.5 suicide vector had not integrated into the PAO1 genome and to confirm a double cross-over knockout insertion, the PCR fragment generated using primers Pre-Pfk-F and Pre-Pfk-R was purified. Sequence analysis identified the expected flanking sequences disrupted by the gentamicin cassette (data not shown) and no vector sequences were detected, indicating the clone was a true Pf4 deletion mutant.

The Pf4 mutant does not produce infective phage

Overnight cultures of both P. aeruginosa wt and the Pf4 mutant were grown in LB at 37°C. Ten μl of the cell free supernatants were then spotted onto soft-agar lawns of either the PAO1 wt or the mutant to detect plaque formation, indicative of phage infection. Supernatant from the wt produced a zone of clearing on the Pf4 mutant lawn, but not when plated onto the wt lawn, suggesting that the wt supernatant contains active Pf4 phage (Fig. 2). This demonstrates that the wt is resistant to re-infection by the Pf4 phage. In contrast, supernatant from the mutant did not produce clearing zones on either lawn (Fig. 2). Hence the mutant, designated P. aeruginosa PAO1ΔPf4, was confirmed to be deficient for the presence of Pf4 sequences and phage.

Fig. 2.

Fig. 2

Detection of Pf4 phage in the supernatant of overnight cultures. Supernatants from overnight cultures of the P. aeruginosa PAO1 were spotted onto soft-agar lawns of the wild-type PAO1 (A), and the Pf4 mutant (B) and supernatants from overnight cultures of the Pf4 mutant were spotted onto either lawns of the wild-type PAO1 (C) or the ΔPf4 mutant (D).

Maturation, cell death and fitness of ΔPf4 mutant biofilms

Biofilm development by the ΔPf4 mutant was compared to the developmental process of the parental wt in flow cell biofilms over a 7 day period. By day 3, biofilms of both the wt and the ΔPf4 mutant had begun to form, where the wt had formed microcolonies with a diameter of 41.75 ± 2 um while microcolonies of the mutant were 17 ± 1.7 um in diameter (Fig. 3 A–B). By day 5 (Fig. 3 C–D), microcolonies of the wt had expanded to 74.5 ± 4.6 um while the ΔPf4 mutant formed microcolonies that were 51.9 ± 2.7 um. The most striking observation was that on day 5 the microcolonies of the wt had begun to show areas of hollowing (Fig. 3 C), and some microcolonies of the wt had regions of dead cells in their centres (data not shown) as has been commonly reported for PAO1 (Webb et al, 2004; Webb et al, 2003). In contrast, the ΔPf4 mutant biofilm did not undergo cell death or hollowing of the microcolonies (Fig. 3 D). By day 7, microcolonies of the wt biofilm had expanded to an average size of 478 ± 18 um in diameter (Fig. 3 E). These large microcolonies were not entirely empty, where a number of viable cells could be observed in the centres along with dead cells (Fig. 3 E), while the mutant microcolonies were not significantly larger, 52.2 ± 5.5 um, than those observed on day 5 (Fig. 3 F) and no centralised cell death or hollowing was observed. The growth rate and final yield of the wt and the Pf4 mutant were identical when grown planktonically in the biofilm medium (M9 + glucose) at room temperature indicating that deletion of the Pf4 region did not alter growth under the conditions tested (data not shown) and therefore, it is unlikely that the differences in microcolony size is the result of growth defects. Because the phage integration site was deleted in the generation of the Pf4 mutant it was not possible to complement the Pf4 mutant. Therefore, we opted to exogenously add back the phage to confirm its effects on the biofilm. Reinfection of the Pf4 mutant biofilm with purified, superinfective phage restored biofilm killing (data not shown), demonstrating that the lack of cell death in the Pf4 mutant biofilm is not due to resistance to Pf4 infection but rather can be ascribed to the absence of Pf4 activity in the mutant. These data therefore suggest that the Pf4 phage plays an essential role in the formation of hollow colonies and the process of cell death within the microcolonies. Moreover, the data suggest that microcolony expansion in the wt requires the presence of the phage in order for the microcolonies to expand beyond 50 um in diameter. Because the ΔPf4 mutant biofilm was composed of smaller microcolonies that did not appear to undergo cell death, we compared the stability of the wt and the mutant biofilms. As shown in Fig. 4, the ΔPf4 mutant biofilm was less resistant than the wt strain when treated for 2 hours with 0.01% SDS. Analysis of the percentage coverage of the biofilms remaining after treatment revealed that the wt biofilm was unaffected by treatment (106% remained) while the ΔPf4 mutant biofilm was reduced by 61%, which was similar to the control strain ΔLasR/RhlR (59% reduction). The ΔLasR/RhlR strain was included here as a positive control since it was previously shown that QS deficient mutants were sensitive to SDS treatment (Allesen-Holm et al, 2006).

Fig. 3.

Fig. 3

Biofilm formation by wild-type P. aeruginosa wild-type PAO1 and its isogenic ΔPf4 mutant. Confocal microscope images of BacLight, Live-Dead (Molecular Probes, USA) stained biofilms were collected on days 3, 5, and 7 for the wild-type and the ΔPf4 mutant.

Magnification, 400X; Bars, 50 μm.

Fig. 4.

Fig. 4

The Pf4 mutant biofilm is less stable than the wild-type. Biofilms of P. aeruginosa PAO1 wild-type, a quorum sensing mutant, and the Pf4 mutant were formed in flow cells for 4 days in M9 minimal medium, at which time, they were treated with 0.01 % SDS (in M9 medium) under flow conditions for 2h at room temperature. Biofilms were stained with the BacLight Live-Dead staining reagents (Molecular Probes) and imaged using Confocal Scanning Laser Microscopy (CSLM). Images were analyzed to determined coverage in the X-Z plane (thickness) and normalized against the untreated controls, bars represent standard errors (A). CSLM images (X-Z plane) of the treated and untreated biofilms are shown in (B).

Appearance of phage and colony variants during biofilm development

A hallmark of the differentiation process typical of P. aeruginosa biofilms is the generation of phage and the simultaneous appearance of variants, such as small colony variants (SCVs), in the dispersal population. Biofilms were formed for the wt and the ΔPf4 mutant, and effluent was collected to determine phage titre and to identify and enumerate SCV formation to determine if the ΔPf4 mutant was affected in the shedding of SCVs during dispersal. In these experiments, cell-free biofilm effluent was serially diluted and 10 ul drops were plated onto soft agar lawns of both the wt and the ΔPf4 mutant to quantify phage titre over a 5 day period. At the same time, unfiltered biofilm effluent was serially diluted and plated onto LB agar to determine the percentage of SCVs formed. As expected, when cell free effluent from the wt was serially diluted and spotted onto the wt lawn, no plaque formation was observed for first 3 days of biofilm development and plaques were observed from day 4 onward (Fig. 5). Plaque forming units (pfu’s) increased from 1 ×107/ml on day 4 to 1 × 108/ml by day 5. However, when the same effluent samples were spotted onto the ΔPf4 mutant lawns, plaques were detected from day 1 and increased from 1 ×106/ml on day 1 to 1×107/ml on day 4, after which time, the pfu/ml counts were not significantly different on either lawn (Fig. 5). Based on detection of plaques on the Pf4 mutant lawn, it is clear that the Pf4 phage is present from the very initial phase of biofilm formation, but that it can not cause plaque formation on the wt lawn until the time at which cell death and dispersal are observed in the microcolonies (see below). The observation that the phage can only infect the wt from day 4 onwards, suggests that the Pf4 phage has converted into a superinfective form and that the wt cells are no longer protected from Pf4 mediated infection and lysis.

Fig. 5.

Fig. 5

Phage titre of biofilm effluents from P. aeruginosa PAO1 and the ΔPf4 mutant biofilms from days 1 to 5. Biofilm effluent was filtered through a 0.2 um filter to eliminate bacterial cells and serial dilutions were spotted onto soft agar lawns of either the PAO1 wild-type or the Pf4 mutant to quantify the number of phage in the effluent (pfu/ml). The phage titre of P. aeruginosa PAO1 biofilm effluent that were determined on the PAO1 lawn or the Pf4 mutant lawn are shown as black and grey bars, respectively.

When cell free biofilm effluent from the ΔPf4 mutant was spotted onto either the wt or the mutant lawn, no plaques were observed for days 1–5 (data not shown). SCVs were also quantified in the biofilm effluents for both strains. SCVs appeared in the wt biofilm at day 5, which correlated with the timing of conversion of the Pf4 into the superinfective form (Fig. 5) and autolysis within the microcolonies and constituted approximately 10% of the total cfu’s observed. In contrast, no SCVs were detected in the effluent of the ΔPf4 mutant at the time when the phage converted into the superinfective form.

The Pf4 mutant is less virulent than the wild-type strain

To determine if deletion of the Pf4 phage affected the virulence of P. aeruginosa, a mouse model of acute pneumonia was used to assess the in vivo virulence of the ΔPf4 mutant strain. Mice were inoculated with approximately 7 ×107 cfu of bacteria by nasal aspiration and monitored for survival over the subsequent seven days. None of the 15 mice infected with wt bacteria survived to day 7. In contrast, 5 of the 15 mice infected with the ΔPf4 mutant survived for the duration of the experiment (Fig. 6). In terms of mean survival times, mice infected with wt bacteria survived 42.7 h (95% Confidence Interval 32.9 h to 52.4 h), whereas mice infected with the ΔPf4 mutant survived 100.8 h (95% Confidence Interval 74.0 h to 127.6 h), indicating that the ΔPf4 mutant was attenuated in its ability to cause acute pneumonia (P <0.001, log-rank test).

Fig. 6.

Fig. 6

The Pf4 mutant is less virulent than the wild-type P. aeruginosa PAO1. BALB/c mice were infected with approximately 7 × 107 cfu of either the wild-type PAO1 or the Pf4 mutant and were monitored over a period of 168 h to determine survival. Three independent experiments were performed and the results were pooled. Results are presented as the number of surviving mice at different time points post infection.

Discussion

This study demonstrates that the filamentous phage Pf4 plays an essential role in the biofilm life-cycle, mediating mutations (variant formation), and for the first time, shows that the Pf4 plays an important role in the structural integrity of the biofilm (autolysis, microcolony size and stability), and virulence. Filamentous phage have been found associated with 73 % (8 of 11) of isolates from cystic fibrosis (CF) patients (Webb et al, 2003) and filamentous phage activity was present in 100 % (5 of 5) of CF isolates (Kirov et al, 2007). Thus, the phage mediated effects observed are likely to be conserved across P. aeruginosa strains.

Phage are numerically dominant compared to prokaryotes (Rohwer and Edwards, 2002; Whitman et al, 1998), contribute to the control of bacterial numbers by lysis and mediate gene transfer, which impacts on bacterial evolution. It is known that phage can carry foreign genes which may expand the host’s phenotypic capacity. In addition to phage mediated gene transfer, i.e. transduction, bacteriophage can also affect bacterial evolution directly by influencing endogenous mutation rates, resulting in single nucleotide changes. For example, bacteriophage P1 can affect mutation rates through the expression of the hot gene, which can either stabilize or destabilize the proofreading subunit of DNA polymerase III (Chikova and Schaaper, 2006). More generally, Pal et al. (Pal et al, 2007) reported that growth of Pseudomonas fluorescens in the presence of lytic phage gave rise to mutator strains at a high frequency. Mutator strains are now recognised as making significant contribution to the infectivity of a range of human pathogenic bacteria, including Escherichia coli, Haemophilus influenza, Helicobacter pylori, Neiserria meningitidis, Staphylococcus aureus, and Streptococcus pneumoniae (Bucci et al, 1999) reviewed in (Hall and Henderson-Begg, 2006). Both clinical and environmental isolates of P. aeruginosa demonstrate mutator phenotypes (Kenna et al, 2007). As a result of these effects on the host genome, bacteriophage can influence bacterial phenotypes. Phage mediated variation has significant medical implications, where it has been shown that phage can mediate conversion of P. aeruginosa into a mucoid phenotype, which has been associated with poor outcomes for CF patients (Hoiby et al, 2001; Miller and Rubero, 1984). Brockhurst et al. (Brockhurst et al, 2005; Webb et al, 2004) have shown that the presence of bacteriophage drives the selection for smooth, phage resistant morphotypes of P. aerugionsa and that the addition of phage to planktonic cultures of P. aeruginosa leads to the formation of colony variants.

We recently reported that CF clinical strains of P. aeruginosa produce superinfective phage and that biofilms of these isolates also generate SCVs as previously shown for P. aeruginosa PAO1 (Kirov et al, 2007; Webb et al, 2003). This suggests that phage generally may play a significant role in biofilm development and the generation of phenotypic variants in clinically relevant strains. For example, Kirov et al (2007) demonstrated that high phage titres in biofilms of clinical strains correlate with biofilm cell death and an increase in the types and overall percentage of variants (Kirov et al, 2007). Like the mucoid variants, other variants, such as the SCVs are clinically relevant as they commonly show increased antibiotic resistance and biofilm formation (Haussler, 2004). Mooij et al. (2007) observed no correlation between the production of the Pf5 filamentous phage and SCV formation in P. aeruginosa PA14 (Mooij et al, 2007). However, these authors did not observe superinfective phage. In contrast, we have repeatedly observed that conversion of the Pf4 into the superinfective form at the time when SCVs become detectable in the biofilm supernatant. This suggests that superinfection may be a key process in the formation of SCVs by phage activity. One key difference between the Pf5 and Pf4 bacteriophage is that the former does not appear to contain a toxin-antitoxin gene pair; it has been proposed that such addiction molecules are involved in the formation of persister cells (Lewis, 2005) and we have observed that over expression of the parE gene (putative toxin) from a plasmid introduced into P. aeruginosa leads to an increased formation of SCVs (Lau and Kjelleberg, unpublished data). Because such variants are generally slow growing and metabolically inactive, they exhibit enhanced resistance to drug therapy. However, the phenotype is revertable and hence, they represent a population that is capable of initiating infection once the antibiotic pressure is relieved. Thus, their contribution to chronic infection is potentially very important. In conjunction with the observation that bacteriophage have been found in the sputum of patients suffering from chronic lung infections (Hoiby et al, 2001), these data suggest that phage mediated variation plays a significant role in chronic infections in situ.

This is the first report to demonstrate that a filamentous phage plays a role in the virulence of P. aeruginosa. One mechanism by which phage may contribute to virulence, is through the provision of virulence determinants. For example, virulence can be transmitted between strains of V. cholerae by the CTX phage which carries the genes coding for cholerae toxin (CT) and the RTX toxin (Faruque et al, 2003; McLeod et al, 2005). Within the genome of the Pf4 bacteriophage is a pair of genes that encode a toxin-antitoxin (T-A) system (Webb et al, 2004), however, such genes have not been associated with virulence or toxicity to mammalian cells and therefore it is unlikely the T-A genes of Pf4 are directly toxic in the mouse assay used here. Furthermore, T-A genes have not been detected in the genomes of other filamentous phage in P. aeruginosa (Hill et al, 1991; Mooij et al, 2007). With the exception of the Pf4 encoded gene PAO726, no other genes were identified as having homology with known virulence factors (unpublished observation). PA0726, which is conserved in Pf1 (Webb et al, 2004) and Pf5 (Mooij et al, 2007), shares significant homology to the zonula occludens toxin (Zot) encoded by the filamentous CTX phage of V. cholerae (Fasano et al, 1991). Zot disrupts the intercellular tight junctions between cells in the small intestine and has been suggested to synergise the effects of CT in causing diarrhoea (Di Pierro et al, 2001; Fasano et al, 1991). However, zot mutants of V. cholerae were not affected in a pulmonary infection model and Zot was shown to disrupt tight junctions in the small intestine, but not in the colon (Di Pierro et al, 2001; Fullner et al, 2002). Hence, Zot toxin activity appears be tissue specific and suggests that the Pf4 encoded zot homologue is unlikely to act as a virulence factor here. It has been suggested that Zot has an additional function, where the C terminal region harbours the toxin activity and the N terminal domonain plays an essential role in phage assembly (Di Pierro et al, 2001).

It has been estimated that 60 % of all infections are biofilm related (Costerton et al, 1999; Davies, 2003), and there is substantial evidence that biofilms play an important role in the persistent infections of CF lungs by P. aeruginosa. Biofilm formation contributes to infection by protecting the bacteria from the host immune defence as well as mediating antibiotic resistance. Some of the reduced susceptibility of biofilm cells has been attributed to the exopolysaccharide matrix, which may act as a physical barrier to protect the encased cells (reviewed in (Hall-Stoodley et al, 2004)). Therefore, it is possible that the reduced virulence of the ΔPf4 mutant may be linked to effects on biofilm formation or maintenance. Very clearly, biofilms of the ΔPf4 mutant develop abnormally compared to the wt, where is fails to undergo the process of autolysis and makes smaller microcolonies. Centralised cell death has been linked to the production of variants, which as noted above, are important in the infection process. Furthermore, this process of cell death, dispersal and variant formation has been observed in many other strains of P. aeruginosa, arguing that this is a stage of development that is conserved amongst P. aeruginosa strains generally (Kirov et al, 2007).

Alternatively, it is possible that the ΔPf4 biofilms are less stable than the wt. Indeed, we have shown that biofilms of the ΔPf4 mutant were less stable than the wt when challenged with surfactant stress (Fig. 4). The ΔPf4 mutant was as sensitive to SDS as a quorum sensing lasR-rhlR mutant. It has been shown that QS controls the secretion of extracellular DNA (eDNA), and that eDNA makes a significant contribution to the EPS of P. aeruginosa as well as contributing to the matrix of biofilms (Bockelmann et al, 2007; Whitchurch et al, 2002). Biofilms of QS mutants are more susceptible to disruption by surfactants than the wt strain (Davies et al, 1998; Hentzer et al, 2003). It has been proposed that biofilm stability is related to the QS controlled secretion of extracellular DNA (eDNA) into the biofilm matrix (Allesen-Holm et al, 2006). Thus, it is possible that the Pf4 phage, either as free DNA released into the biofilm matrix, or as viral particles, also enhance biofilm stability. Webb et al. (Webb et al, 2004) observed that SCVs, which were isolated from biofilms at the time when superinfective phage could be detected, have high densities of a surface associated material that reacts specifically with Pf4 directed antibodies. These surface associated phage may serve to cross-link cells within the biofilm.

We submit that bacteriophage make a significant contribution to the biofilm life-cycle and virulence of P. aeruginosa. These effects may be mediated by multiple mechanisms, where the prophage encodes potential virulence factors, phage may contribute to microbial evolution through the formation of phenotypic variants, eg. SCVs, and phage particles may physically enhance the stability of biofilms. These data demonstrate for the first time that the bacteriophage Pf4 plays a key role in structural features of the biofilm and in particular, this study is the first to clearly link phage production with centralised cell death and subsequent hollow colony formation. Furthermore, this is the first demonstration that a prophage in P. aeruginosa contributes to infection. Bacteriophage are widely disseminated and numerically dominant in the biosphere. Moreover, they display rapid evolution and the capacity to carry introduction new genes into their hosts. Therefore it is highly likely that phage may play similar roles in mediating ecological adaptation and virulence in other bacterial hosts and thus play significant roles in the evolution of bacterial species.

Acknowledgments

This work was funded by the Australia Research Council (SK), and the National Institute of Health, USA (AH, grants AI053674 and AI065615). Special thanks to H. Schweizer for providing the Gateway vectors and advice on their application.

References

  1. Allesen-Holm M, Barken KB, Yang L, Klausen M, Webb JS, Kjelleberg S, et al. A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol Microbiol. 2006;59:1114–1128. doi: 10.1111/j.1365-2958.2005.05008.x. [DOI] [PubMed] [Google Scholar]
  2. Beatson SA, Whitchurch CB, Semmler ABT, Mattick JS. Quorum sensing is not required for twitching motility in Pseudomonas aeruginosa. J Bacteriol. 2002;184:3598–3604. doi: 10.1128/JB.184.13.3598-3604.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bertani G. Studies on lysogenesis. J Bacteriol. 1951;62:293–300. doi: 10.1128/jb.62.3.293-300.1951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bockelmann U, Lunsdorf H, Szewzyk U. Ultrastructural and electron energy-loss spectroscopic analysis of an extracellular filamentous matrix of an environmental bacterial isolate. Environ Microbiol. 2007;9:2137–2144. doi: 10.1111/j.1462-2920.2007.01325.x. [DOI] [PubMed] [Google Scholar]
  5. Boles BR, Thoendel M, Singh PK. Self-generated diversity produces “Insurance effects” In biofilm communities. Proc Natl Acad Sci USA. 2004;101:16630–16635. doi: 10.1073/pnas.0407460101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brockhurst MA, Buckling A, Rainey PB. The effect of a bacteriophage on diversification of the opportunistic bacterial pathogen, Pseudomonas aeruginosa. Proc Royal Soc B-Biol Sci. 2005;272:1385–1391. doi: 10.1098/rspb.2005.3086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bucci C, Lavitola A, Salvatore P, Del Giudice L, Massardo DR, Bruni CB, et al. Hypermutation in pathogenic bacteria: Frequent phase variation in meningococci is a phenotypic trait of a specialized mutator biotype. Molecular Cell. 1999;3:435–445. doi: 10.1016/s1097-2765(00)80471-2. [DOI] [PubMed] [Google Scholar]
  8. Chikova AK, Schaaper RM. Mutator and antimutator effects of the bacteriophage P1 hot gene product. J Bacteriol. 2006;188:5831–5838. doi: 10.1128/JB.00630-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Choi K-H, Schweizer H. An improved method for rapid generation of unmarked Pseudomonas aeruginosa deletion mutants. BMC Microbiol. 2005;5:30–40. doi: 10.1186/1471-2180-5-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Comolli JC, Hauser AR, Waite L, Whitchurch CB, Mattick JS, Engel JN. Pseudomonas aeruginosa gene products Pilt and pilU are required for cytotoxicity in vitro and virulence in a mouse model of acute pneumonia. Infect Immun. 1999;67:3625–3630. doi: 10.1128/iai.67.7.3625-3630.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: A common cause of peristent infections. Science. 1999;284:1318–1322. doi: 10.1126/science.284.5418.1318. [DOI] [PubMed] [Google Scholar]
  12. Davies D. Understanding biofilm resistance to antibacterial agents. Nat Rev Drug Discov. 2003;2:114–122. doi: 10.1038/nrd1008. [DOI] [PubMed] [Google Scholar]
  13. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW, Greenberg EP. The involvement of cell-cell signals in the development of a bacterial biofilm. Science. 1998;280:295–298. doi: 10.1126/science.280.5361.295. [DOI] [PubMed] [Google Scholar]
  14. Di Pierro M, Lu R, Uzzau S, Wang W, Margaretten K, Pazzani C, et al. Zonula occludens toxin structure-function analysis. Identification of the fragment biologically active on tight junctions and of the zonulin receptor binding domain. J Biol Chem. 2001;276:19160–19165. doi: 10.1074/jbc.M009674200. [DOI] [PubMed] [Google Scholar]
  15. Faruque SM, Zhu J, Asadulghani Kamruzzaman M, Mekalanos JJ. Examination of diverse toxin-coregulated pilus-positive Vibrio cholerae strains fails to demonstrate evidence for vibrio pathogenicity island phage. Infect Immun. 2003;71:2993–2999. doi: 10.1128/IAI.71.6.2993-2999.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, Ketley JM. Vibrio cholerae produces a second enterotoxin, which affects intestinal tight junctions. Proc Natl Acad Sci USA. 1991;88:5242–5246. doi: 10.1073/pnas.88.12.5242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fullner KJ, Boucher JC, Hanes MA, Haines GK, III, Meehan BM, Walchle C, et al. The contribution of accessory toxins of Vibrio cholerae O1 El tor to the proinflammatory response in a murine pulmonary cholera model. J Exp Med. 2002;195:1455–1462. doi: 10.1084/jem.20020318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hall LMC, Henderson-Begg SK. Hypermutable bacteria isolated from humans - a critical analysis. Microbiology. 2006;152:2505–2514. doi: 10.1099/mic.0.29079-0. [DOI] [PubMed] [Google Scholar]
  19. Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: From the natural environment to infectious diseases. Nature Microbiol Rev. 2004;2:95–108. doi: 10.1038/nrmicro821. [DOI] [PubMed] [Google Scholar]
  20. Haussler S. Biofilm formation by the small colony variant phenotype of Pseudomonas aeruginosa. Environ Microbiol. 2004;6:546–551. doi: 10.1111/j.1462-2920.2004.00618.x. [DOI] [PubMed] [Google Scholar]
  21. Haussler S, Tummler B, Weissbrodt H, Rohde M, Steinmetz I. Small-colony variants of Pseudomonas aeruginosa in cystic fibrosis. Clin Infect Dis. 1999;29:621–625. doi: 10.1086/598644. [DOI] [PubMed] [Google Scholar]
  22. Hentzer M, Wu H, Andersen JB, Riedel K, Rasmussen TB, Bagge N, et al. Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. EMBO J. 2003;22:3803–3815. doi: 10.1093/emboj/cdg366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hill DF, Short NJ, Perham RN, Petersen GB. DNA sequence of the filamentous bacteriophage Pf1. J Mol Biol. 1991;218:349–364. doi: 10.1016/0022-2836(91)90717-k. [DOI] [PubMed] [Google Scholar]
  24. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. A broad-host-range flp-frt recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene. 1998;212:77–86. doi: 10.1016/s0378-1119(98)00130-9. [DOI] [PubMed] [Google Scholar]
  25. Hoiby N, Johansen HK, Moser C, Song ZJ, Ciofu O, Kharazmi A. Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth. Microb Infect. 2001;3:23–35. doi: 10.1016/s1286-4579(00)01349-6. [DOI] [PubMed] [Google Scholar]
  26. Horton RM, Cai Z, Ho SN, Pease LR. Gene splicing by overlap extension: Tailor made genes using the polymerase chain reaction. BioTechniques. 1990;8:528–535. [PubMed] [Google Scholar]
  27. Kenna DT, Doherty CJ, Foweraker J, Macaskill L, Barcus VA, Govan JRW. Hypermutability in environmental Pseudomonas aeruginosa and in populations causing pulmonary infection in individuals with cystic fibrosis. Microbiology. 2007;153:1852–1859. doi: 10.1099/mic.0.2006/005082-0. [DOI] [PubMed] [Google Scholar]
  28. Kirov SM, Webb JS, O’May CY, Reid DW, Woo JKK, Rice SA, et al. Biofilm differentiation and dispersal in mucoid Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Microbiology. 2007;153:3264–3274. doi: 10.1099/mic.0.2007/009092-0. [DOI] [PubMed] [Google Scholar]
  29. Koh KS, Lam KW, Alhede M, Queck SY, Labbate M, Kjelleberg S, et al. Phenotypic diversification and adaptation of Serratia marcescens MG1 biofilm-derived morphotypes. J Bacteriol. 2007;189:119–130. doi: 10.1128/JB.00930-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lewis K. Persister cells and the riddle of biofilm survival. Biochemistry (Moscow) 2005;V70:267–274. doi: 10.1007/s10541-005-0111-6. [DOI] [PubMed] [Google Scholar]
  31. Mai-Prochnow A, Evans F, Dalisay-Saludes D, Stelzer S, Egan S, James S, et al. Biofilm development and cell death in the marine bacterium Pseudoalteromonas tunicata. Appl Environ Microbiol. 2004;70:3232. doi: 10.1128/AEM.70.6.3232-3238.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. McLeod SM, Kimsey HH, Davis BM, Waldor MK. CTX and Vibrio cholerae: Exploring a newly recognized type of phage-host cell relationship. Mol Microbiol. 2005;57:347–356. doi: 10.1111/j.1365-2958.2005.04676.x. [DOI] [PubMed] [Google Scholar]
  33. Miller RV, Rubero VJ. Mucoid conversion by phages of Pseudomonas aeruginosa strains from patients with cystic fibrosis. J Clin Microbiol. 1984;19:717–719. doi: 10.1128/jcm.19.5.717-719.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Moller S, Sternberg C, Andersen JB, Christensen BB, Ramos JL, Givskov M, et al. In situ gene expression in mixed-culture biofilms - evidence of metabolic interactions between community members. Appl Environ Microbiol. 1998;64:721–732. doi: 10.1128/aem.64.2.721-732.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mooij MJ, Drenkard E, Llamas MA, Vandenbroucke-Grauls CMJE, Savelkoul PHM, Ausubel FM, et al. Characterization of the integrated filamentous phage Pf5 and its involvement in small-colony formation. Microbiology. 2007;153:1790–1798. doi: 10.1099/mic.0.2006/003533-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nakayama K, Takashima K, Ishihara H, Shinomiya T, Kageyama M, Kanaya S, et al. The R-type pyocin of Pseudomonas aeruginosa is related to P2 phage, and the F-type is related to lambda phage. Mol Microbiol. 2000;38:213–231. doi: 10.1046/j.1365-2958.2000.02135.x. [DOI] [PubMed] [Google Scholar]
  37. Nicas T, Iglewski B. Isolation and characterisation of transposon induced mutants of Pseudomonas aeruginosa deficient in production of exoenzyme S. Infect Immun. 1984;45:470–474. doi: 10.1128/iai.45.2.470-474.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pal C, Macia MD, Oliver A, Schachar I, Buckling A. Coevolution with viruses drives the evolution of bacterial mutation rates. Nature. 2007;450:1079–1081. doi: 10.1038/nature06350. [DOI] [PubMed] [Google Scholar]
  39. Purevdorj-Gage B, Costerton WJ, Stoodley P. Phenotypic differentiation and seeding dispersal in non-mucoid and mucoid Pseudomonas aeruginosa biofilms. Microbiology. 2005;151:1569–1576. doi: 10.1099/mic.0.27536-0. [DOI] [PubMed] [Google Scholar]
  40. Rohwer F, Edwards R. The phage proteomic tree: A genome-based taxonomy for phage. J Bacteriol. 2002;184:4529–4535. doi: 10.1128/JB.184.16.4529-4535.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, et al. Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature. 2000;406:959–964. doi: 10.1038/35023079. [DOI] [PubMed] [Google Scholar]
  42. Tinsley CR, Bille E, Nassif X. Bacteriophages and pathogenicity: More than just providing a toxin? Microb Infect. 2006;8:1365–1371. doi: 10.1016/j.micinf.2005.12.013. [DOI] [PubMed] [Google Scholar]
  43. Webb JS, Lau M, Kjelleberg S. Bacteriophage and phenotypic variation in Pseudomonas aeruginosa biofilm development. J Bacteriol. 2004;186:8066–8073. doi: 10.1128/JB.186.23.8066-8073.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Webb JS, Thompson LS, James S, Charlton T, Tolker-Nielsen T, Koch B, et al. Cell death in Pseudomonas aeruginosa biofilm development. J Bacteriol. 2003;185:4585–4592. doi: 10.1128/JB.185.15.4585-4592.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Whitchurch CB, Tolker-Nielsen T, Ragas PC, Mattick JS. Extracellular DNA required for bacterial biofilm formation. Science. 2002;295:1487. doi: 10.1126/science.295.5559.1487. [DOI] [PubMed] [Google Scholar]
  46. Whiteley M, Bangera MG, Bumgarner RE, Parsek MR, Teitzel GM, Lory S, et al. Gene expression in Pseudomonas aeruginosa biofilms. Nature. 2001;413:860–864. doi: 10.1038/35101627. [DOI] [PubMed] [Google Scholar]
  47. Whitman WB, Coleman DC, Wiebe WJ. Prokaryotes: The unseen majority. Proc Natl Acad Sci USA. 1998;95:6578–6583. doi: 10.1073/pnas.95.12.6578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wilhelm SW, Suttle CA. Viruses and nutrient cycles in the sea. Bioscience. 1999;49:781–783. [Google Scholar]

RESOURCES