Skip to main content
NCBI home page
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2010 Jan 19;24(1):31–37. doi: 10.1002/jcla.20355

Antibiograms and randomly amplified polymorphic DNA‐polymerase chain reactions (RAPD‐PCR) as epidemiological markers of gonorrhea

Ratana Lawung 1, Angkana Charoenwatanachokchai 2, Rungrot Cherdtrakulkiat 1, Sivarak Thammapiwan 1, Tharinda Mungniponpan 1, Leif Bülow 3, Virapong Prachayasittikul 1,✉
PMCID: PMC6647703  PMID: 20087948

Abstract

The development of antimicrobial resistance of Neisseria gonorrhoeae arising from wide dissemination of resistant clones is a major global health problem. In this study, a total of 235 isolates of N. gonorrhoeae isolated from patients of Bangrak Hospital were tested for their antibiotic susceptibilities to penicillin, norfloxacin, ofloxacin, ciprofloxacin, spectinomycin, and ceftriaxone. Mutation (Ser‐91) in the quinolone resistance determining regions of gyrA and random amplification of the polymorphic DNA polymerase chain reaction (RAPD‐PCR) were examined from 145 isolates. Among these, 55 isolates were obtained during January–March 2000, 46 isolates during January–March 2002, and 44 isolates during October–December 2002. The occurrence of combination resistance between penicillin and quinolone was 20% in January–March 2000, which was increased to 57.8% during the period of October–December 2002 (P<0.0001). Mutation of Ser‐91 in gyrA could be directly linked with the resistance or declining of susceptibility to ciprofloxacin. Using RAPD‐PCR, we could classify the 145 isolates into 4 and 5 groups by primers D11344 (5′‐AGTGAATTCGCGGTGAGATGCCA‐3′) and D8635 (5′‐GAGCGGCCAAAGGGAGCA GAC‐3′), respectively. Combination of the data obtained from these two primers produced 11 fingerprint groups. Our findings conclude that monitoring of the Ser‐91 mutation of gyrA and RAPD‐PCR methods are most useful for epidemiological screening. J. Clin. Lab. Anal. 24:31–37, 2010. © 2010 Wiley‐Liss, Inc.

Keywords: Neissseria gonorrhoeae, gonorrhea, gyrase A, RAPD‐PCR

REFERENCES

  • 1. Gerbase AC, Rowley JT, Heymann DH, Berkley SF, Piot P. Global prevalence and incidence estimates of selected curable STDs. Sex Transm Infect 1998;74:S12–S16. [PubMed] [Google Scholar]
  • 2. Gerbase AC, Rowley JT, Mertens TE. Global epidemiology of sexually transmitted diseases. Lancet 1998;351:2–4. [DOI] [PubMed] [Google Scholar]
  • 3. Tapsall JW. Antibiotic resistance in Neisseria gonorrhoeae . Clin Infect Dis 2005;41:S263–S268. [DOI] [PubMed] [Google Scholar]
  • 4.Fact sheets on young people and HIV/AIDS. Young People at the Centre of HIV/AIDS Epidemic. World Health Organization, 2006.
  • 5. World Health Organization . Consensus report on STI, HIV and AIDS epidemiology. Department of Health Manila and WHO Regional Office for the Western Pacific, Philippines. 1999. p 4–5.
  • 6. World Health Organization . Consensus report on STI, HIV and AIDs epidemiology. National Institute of Hygiene and Epidemiology, Hanoi, VietNam, WHO Regional Office for the Western Pacific and Family Health International, Vietnam: 1999. p 7–8. [Google Scholar]
  • 7. Knapp JS, Fox KK, Trees DL, Whittington WL. Fluoroquinolone resistance in Neisseria gonorrhoeae. [Erratum appears in Emerg Infect Dis 1997 Oct–Dec;3(4):584]. Emerg Infect Dis 1997;3:33–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. World Health Organization . Surveillance of antibiotic resistance in Neisseria gonorrhoeae in the WHO Western Pacific Region, 2002. Commun Dis Intell 2003;27:488–491. [DOI] [PubMed] [Google Scholar]
  • 9. Tanaka M, Takahashi K, Saika T, Kobayashi I, Ueno T, Kumazawa J. Development of fluoroquinolone resistance and mutations involving GyrA and ParC proteins among Neisseria gonorrhoeae isolates in Japan. J Urol 1998;159:2215–2219. [DOI] [PubMed] [Google Scholar]
  • 10. Shigemura K, Shirakawa T, Okada H, et al. Mutations in the gyrA and parC genes and in vitro activities of fluoroquinolones in 91 clinical isolates of Neisseria gonorrhoeae in Japan. Sex Transm Dis 2004;31:180–184. [DOI] [PubMed] [Google Scholar]
  • 11. Su X, Lind I. Molecular basis of high‐level ciprofloxacin resistance in Neisseria gonorrhoeae strains isolated in Denmark from 1995 to 1998. Antimicrob Agents Chemother 2001;45:117–123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Alcala B, Arreaza L, Salcedo C, et al. Molecular characterization of ciprofloxacin resistance of gonococcal strains in Spain. Sex Transm Dis 2003;30:395–398. [DOI] [PubMed] [Google Scholar]
  • 13. Chaudhry U, Ray K, Bala M, Saluja D. Mutation patterns in gyrA and parC genes of ciprofloxacin resistant isolates of Neisseria gonorrhoeae from India. Sex Transm Infect 2002;78:440–444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Deguchi T, Yasuda M, Nakano M, et al. Rapid detection of point mutations of the Neisseria gonorrhoeae gyrA gene associated with decreased susceptibilities to quinolones. J Clin Microbiol 1996;34:2255–2258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Li Z, Yokoi S, Kawamura Y, Maeda S, Ezaki T, Deguchi T. Rapid detection of quinolone resistance‐associated gyrA mutations in Neisseria gonorrhoeae with a LightCycler. J Infect Chemother 2002;8:145–150. [DOI] [PubMed] [Google Scholar]
  • 16. Tanaka M, Nakayama H, Haraoka M, Saika T. Antimicrobial resistance of Neisseria gonorrhoeae and high prevalence of ciprofloxacin‐resistant isolates in Japan, 1993 to 1998. J Clin Microbiol 2000;38:521–525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Liao M, Bell K, Gu WM, et al. Clusters of circulating Neisseria gonorrhoeae strains and association with antimicrobial resistance in Shanghai. J Antimicrob Chemother 2008;61:478–487. [DOI] [PubMed] [Google Scholar]
  • 18. Looveren M, Ison C, Ieven M, et al. Evaluation of the discriminatory power of typing methods for Neisseria gonorrhoeae . J Clin Microbiol 1999;37:2183–2188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Palmer HM, Young H, Martin IMC, Ison CA, Spratt BG. The epidemiology of ciprofloxacin resistant isolates of Neisseria gonorrhoeae in Scotland 2002: a comparison of phenotypic and genotypic analysis. Sex Transm Infect 2005;81:403–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. McKnew DL, Freyja Lynn F, Zenilman JM, Bash MC. Porin variation among clinical isolates of Neisseria gonorrhoeae over a 10‐year period, as determined by Por variable region typing. J Infect Dis 2003;187:1213–1222. [DOI] [PubMed] [Google Scholar]
  • 21. Lawung R, Buatiang A, Jittawoutipoka T, Rittiroongrad S, Prachayasittikul V. Increasing trend of multiple resistance and genomic mobility of Neisseria gonorrhoeae to penicillin and quinolone. EXCLI J 2005;4:130–140. [Google Scholar]
  • 22. Ng LK, Martin IE. The laboratory diagnosis of Neisseria gonorrhoeae . Can J Infect Dis Med Microbiol 2005;16:15–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Yasin R, Suan K, Meng C. Comparison of E‐test with agar dilution methods in testing susceptibility of N. gonorrhoeae to azithromycin. Sex Transm Dis 1997;24:257–260. [DOI] [PubMed] [Google Scholar]
  • 24. Clinical and Laboratory Standards Institute . Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard, Ninth Edition: M2‐A9. Pennsylvania, USA: CLSI; 2006. [Google Scholar]
  • 25. Van Looveren M, Ison CA, Ieven M, et al. Evaluation of the discriminatory power of typing methods for Neisseria gonorrhoeae . J Clin Microbiol 1999;37:2183–2188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Begg MD. Analyzing k (2×2) tables under cluster sampling. Biometrics 1999;55:302–307. [DOI] [PubMed] [Google Scholar]
  • 27. Eveillard M, Lancien E, Hidri N, et al. Estimation of methicillin‐resistant Staphylococcus aureus transmission by considering colonization pressure at the time of hospital admission. J Hosp Infect 2005;60:27–31. [DOI] [PubMed] [Google Scholar]
  • 28. Tanaka M, Nakayama H, Haraoka M, Nagafuji T, Saika T, Kobayashi I. Analysis of quinolone resistance mechanisms in a sparfloxacin‐resistant clinical isolate of Neisseria gonorrhoeae . Sex Transm Dis 1998;25:489–493. [DOI] [PubMed] [Google Scholar]
  • 29. Mavroidi A, Tzouvelekis L, Tassios P, Flemetakis A, Daniilidou M, Tzelepi E. Characterization of Neisseria gonorrhoeae strains with decreased susceptibility to fluoroquinolones isolated in Greece from 1996 to 1999. J Clin Microbiol 2000;38:3489–3491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Olive DM, Bean P. Principles and applications of methods for DNA‐based typing of microbial organisms. J Clin Microbiol 1999;37:1661–1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE. DNA diversity among clinical isolates of Helicobacter pylori detected by PCR‐based RAPD fingerprinting. Nucleic Acids Res 1992;20:5137–5142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Unemo M, Strand AS, Akhras M, et al. Molecular characterization of Neisseria gonorrhoeae identifies transmission and resistance of one ciprofloxacin‐resistant strain. APMIS 2007;115:231–241. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES