Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens

Abstract

Objective

To investigate whether genetic modifiers of CF lung disease also predispose to CBAVD in association with CFTR mutations. We tested the hypothesis that polymorphisms of TGFB1 (transforming growth factor) (rs 1982073, rs 1800471) and EDNRA (endothelin receptor type A) (rs 5335, rs 1801708) are associated with the CBAVD phenotype.

Design

Genotyping of subjects with clinical CBAVD.

Setting

Outpatient and hospital based clinical evaluation.

Patients

DNA samples from 80 CBAVD subjects and 51 healthy male controls from various regions of Europe. One of the largest genetic studies of this disease to date.

Interventions

None.

Main outcome measures

Genotype analysis.

Results

For SNP rs 5335, we found increased frequency of the CC genotype among CBAVD subjects. The difference was significant among Turkish patients vs. controls (45.2% vs. 19.4%, p<0.05), and between all cases vs. controls (36% vs. 15.7%, p<0.05). No associations between CBAVD penetrance and polymorphisms rs1982073, rs1800471 or rs1801708 were observed.

Conclusions

Our findings indicate that EDNRA polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

INTRODUCTION

Cystic fibrosis (CF) is a common autosomal recessive disorder among Caucasians, and affects one in 3500 live births in the United States (1). The disease is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (2–4). CF is characterized by lung, pancreatic, liver and other exocrine glandular abnormalities. Approximately 98% of males with CF are infertile, and lack the vas deferens bilaterally (5). More than 1500 disease-causing CFTR mutations have been identified (6). Certain mutations have also been implicated in a variety of CFTR-related pathologic conditions such as disseminated bronchiectasis, allergic bronchopulmonary aspergillosis, diffuse panbronchiolitis, recurrent idiopathic pancreatitis, giant nasal polyposis, and congenital bilateral absence of the vas deferens (CBAVD) (7–9).

CBAVD is associated with normal spermatogenesis and obstructive azoospermia due to lack of the vas (10). A small subset of males without known CFTR defects exhibit CBAVD. However 80–97% of CBAVD subjects posses at least one defective CFTR allele, and 50–93% of individuals with CBAVD carry two variants, including class IV or V CFTR abnormalities (11– 15). CBAVD thus belongs to a group of CF related disorders - and is considered an isolated, urogenital form of CF. Although a high percentage of CBAVD patients carry mutations in CFTR, approximately one in 29 Caucasian males in the United States carries one CFTR variant but never develops CBAVD (16). The finding of a single CFTR mutation is therefore a poor predictor for involution of the vas. Other genetic or environmental factors must modify penetrance of CBAVD, but these are not yet known.

The best characterized CBAVD specific variant is the polymorphic polythymidine tract (Tn) in CFTR intron 8 (IVS8) for which length is inversely correlated with the degree of exon 9 skipping during mRNA splicing. The number of thymidines varies in this tract between 5 and 9, but extremely short alleles (with 3 or 2 thymidines) have also been described in CBAVD (17, 18). Lower numbers of thymidine residues in the tract predict an increasing proportion of nonfunctional CFTR (i.e. lacking exon 9) (15). Mak et al (19) show that a CBAVD patient with the common F508del mutation and an IVS8-5T variant produced 32% of the normal levels of CFTR in the lung (exon 9 intact; a level of expression sufficient to maintain a normal pulmonary phenotype), but insufficient full-length CFTR (26% in reproductive tissues) to allow proper structural development of the vas. The amount of functional CFTR (with exon 9) in a CF F508del/IVS8-7T carrier male (38%) in the reproductive tract was suggested to be sufficient for normal function and vas development (19). A ‘mild’ CFTR allele that maintains partial ion channel activity, R117H, is associated with the 5T allele in CF and 7T in CBAVD (20). Rave- Harel et al examined epithelial tissues from CBAVD subjects, and showed that levels of normal CFTR transcripts were higher in the nasal epithelium than in epididymal epithelium (21). Therefore it has been suggested that amounts of CFTR protein required for normal function vary between different tissues (22). In general, the vas deferens has been viewed as a tissue among the most sensitive to altered CFTR activity (22).

Genetic modifiers of the CF pulmonary phenotype represent an area of intensive study. Recently, Drumm et al. (23) showed that the tissue growth factor-β1 (TGFB1) codon 10 CC genotype (rs 1982073) is associated with severe lung disease among individuals homozygous for CFTR mutations (23). This allele is linked to elevated TGFB1 gene expression and higher circulating levels of TGFB1 in human subjects (24–26). A second TGFB1 single nucleotide polymorphisms (SNP) in codon 25 (rs 1800471) may also influence TGFβ-1 protein levels (27), and has been implicated as a contributor to CF lung disease progression (27, 28).

In addition to an emerging understanding of TGFB1 as a modifier of CF severity, Darrah et al. (29) found a strong correlation between lung phenotype in CF and polymorphisms in the endothelin receptor type A (EDNRA) gene. In particular, the genotype AA at position -231 from AUG (rs 1801708) in EDNRA and genotype CC in exon eight (rs 5335) were associated with more severe lung disease in CF females (29). With reference to these results, McKone et al. (30) examined 21 tag SNPs in the EDN1 (endothelin-1), EDN3 (endothelin-3), EDNRA, and EDNRB (endothelin receptor type B) genes. The study confirmed a significant association between an EDNRA haplotype including SNP rs 5335 and CF lung disease, but no association with tagSNPs in other candidate genes (30). Interestingly, both TGFβ and endothelin play a role in extracellular matrix formation (31, 32) wound healing (31, 32), lung diseases such as asthma (33, 34) and lung fibrosis (27, 35–37). Moreover, Jain et al. (38) observed a connection between TGFβ and the endothelin-EDNRA system in idiopathic lung fibrosis, and demonstrated that endothelin-1 influences TGFβ-1 production through EDNRA.

Based on these considerations, we hypothesized that TGFB1 and EDNRA polymorphisms might play a role in penetrance of CBAVD. We designed a study to test whether codon 10 or codon 25 TGFB1 polymorphisms, or either of the two EDNRA gene polymorphisms reported to modify CF lung disease, might also contribute as genetic modifiers of CBAVD.

MATERIALS AND METHODS

Samples

We analyzed genomic DNA samples from 80 CBAVD individuals and 51 healthy male control subjects. This included 19 patient samples and 20 (non-CBAVD) controls from Spain (Medical and Molecular Genetics Center-IDIBELL), 31 CBAVD subjects and 31 controls from Turkey (Department of Medical Biology, Hacettepe University), and 30 individuals with CBAVD from Portugal (Department of Genetics, Faculty of Medicine and Laboratory of Cell Biology; Institute Biomedical Sciences Abel Salazar of University of Porto). The study therefore represents one of the largest genetic analyses to date of CBAVD, for which large patient populations are not readily available. Criteria for inclusion as a subject required known CFTR variants. Controls were defined as healthy sperm donors or other unrelated individuals with an intact vas deferens. Over 40 different CFTR polymorphisms of varying ‘severity’ were represented. Because more than 1500 CF disease associated mutations have been described previously, it is very likely that other mutations in certain subjects were present but not detected by the genotyping methods described here. The protocol was approved by the Institutional Review Board of Human Use at the University of Alabama at Birmingham and by local Portuguese, Spanish, and Turkish ethical committees.

Methods

A 453 bp region of the 5’ end of TGFB1 gene (GenBank Accession Number: NT_011109) was amplified using 5’ GAGGACCTCAGCTTTCCCTC 3’ (forward) and 5’ CTCCTTGGCGTAGTAGTCGG 3’ (reverse) primers. This region includes both rs 1982073 and rs 1800471 TGFB1 SNPs. Conditions were as follows: predenaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 5 minutes. A region encompassing 480 bases of the promoter region of EDNRA gene (Ensembl Gene ID: ENSG00000151617), including SNP rs 1801708, was amplified using the primers 5’ GTGGAAGGTCTGGAGCTTTG 3’ and 5’ TTCCCAGCTCTCGTCTTCTC 3’. Conditions were: 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 58°C for 30s and 72°C for 40 s. The final extension step was 72°C for 7 minutes. For detection of the exon 8 SNP of the EDNRA gene (rs 5335), we used primers: 5’ CTGCTGCTGTTACCAGTCCA 3’ and 5’ TGACCAGTTCCCATTGAACA 3’. (95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, with a final extension step of 72°C for 7 minutes).

Platinum^R Blue PCR Supermix (Invitrogen, Carlsbad, CA, USA), Apex^TM RED Taq DNA Polymerase Mastermix (Genesee Scientific, San Diego, CA, USA), or RedTaq^R DNA polymerase with 10× RedTaq^R PCR Reaction Buffer (Sigma-Aldrich, Saint Louis, MI, USA) were used for amplification. Because the EDNRA promoter constitutes a GC rich region, dimethyl sulphoxide (DMSO, 10%) was added to the PCR mixture to increase efficiency of that particular PCR. QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) was used prior to sequence analyses with BigDye Terminator v3.1 Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, CA, USA). The sequencing products were run by standard protocols on an Applied Biosystems 3730 Genetic Analyzer with POP-7 polymer (Genomics Core Facility of the Howell and Elizabeth Heflin Center for Human Genetics, University of Alabama at Birmingham). Sequence analyses and comparisons were conducted using Chromas Lite software (39) and Clustal W Multiple Sequence Alignment software (40).

Statistical Analysis

For each SNP, an assessment was performed assuming both a dominant and non-dominant genetic relationship with the CBAVD phenotype, as the precise relationships between SNP genotype and TGFB1 or EDNRA activity are not known. Differences in the distribution of SNP genotypes were compared using χ² analysis. In addition, a two-sample proportion test to monitor differences in overall allelic frequencies was conducted between groups. Comparisons were performed between all cases and controls collected in the study, and subdivided by ethnicity to evaluate for population specific differences. Only historical controls were available for the Portuguese subjects; therefore these were not included in the statistical analyses. CFTR genotypes and polymorphism data for the Portuguese group are provided in Tables 1 and 4. Due to the selective nature of the candidate genes being explored, no corrections were made for multiple comparisons. All statistical analyses were done using SPSS statistical software package.

Table 1.

Distribution of CFTR mutations among CBAVD samples

Portuguese	CFTR alleles	Spanish	CFTR alleles	Turkish	CFTR alleles
5T	22	F508del	11	5T	20
F508del	14	5T	9	D1152H	14
R334W	5	D443Y a	3	D110H	3
R117H	3	G576A a	3	F508del	2
S1235R	3	R668C a	3	3041-11del7	2
N1303K	2	G542X	2	1767del6	2
P205S	2	R117H	2	2789+5G>A	2
D614G	2	V232D	2	CFTRdele2(ins186)	2
G542X	1	L997F	1	3120+1G>A	1
L206W	1	H609R	1	G1130A	1
V562I	1	N1303H	1	M952I	1
I507del	1	L206W	1	365insT	1
3272-26A>G	1	3272-26A/G	1	E585X	1
2789+5G>A	1	L15P	1	2752-15 C>G	1
G576A a	1	R347H	1	R334Q	1
R668C a	1	2689insG	1	R347H	1
CFTRdele2,3	1	R1070W	1	E831X	1
L1227S	1	I 1027T	1	R1070W	1
E831X	1			3272-26A>G	1
				L997F	1
				I853F	1
				A349V	1
				6T	1

^ain cis

Table 4.

Allelic frequencies of EDNRA and TGFB1 SNPs

EDNRA exon 8 SNP (rs 5335)
C allelic frequency	Ethnicity	Patients	Controls
	Turkish	64.5%	51.6%
	Spanish	50%	42.5%
	Portuguese	33.3%	ND a
EDNRA promoter SNP (rs 1801708)
A allelic frequency	Ethnicity	Patients	Controls
	Turkish	45.2%	30%
	Spanish	18.4%	41.9%
	Portuguese	26.8%	ND a
TGFB1 codon 10 SNP (rs 1982073)
T allelic frequency	Ethnicity	Patients	Controls
	Turkish	54.8%	45.1%
	Spanish	63.2%	45%
	Portuguese b	55%	44.4%
TGFB1 codon 25 SNP (rs 1800471)
G allelic frequency	Ethnicity	Patients	Controls
	Turkish	91.9%	95.2%
	Spanish	100%	92.5%
	Portuguese b	95%	92.5%

^aND = not done

^bControl data from Alves H, Histocompatibility Center, University of Porto, Portugal

RESULTS AND DISCUSSION

This study was designed to pursue modifier genes contributing to the CBAVD phenotype. Eighty CBAVD subjects (Table 1) and 51 controls were investigated for candidate polymorphisms in TGFB1 or EDNRA. Darrah et al. (29) previously described two polymorphisms in EDNRA associated with a more severe lung phenotype among CF subjects. Both the AA genotype of SNP rs 1801708 and the CC allele of rs 5335 were reported to occur more frequently among CF individuals with severe lung symptoms. In a large cohort of CBAVD subjects and controls, we observed a notable increase of the CC allele at SNP rs 5335 in association with CBAVD (Table 2). The CC allele was significantly greater in the largest matched study cohort (i.e. Turkish patients vs. controls 45.2% vs. 19.4%, p<0.05 by χ²-analysis), and between all cases vs. controls (36% vs. 15.7%, p<0.05). The EDNRA promoter SNP (rs 1801708) did not appear to influence the penetrance of CBAVD (p=0.22) (for either Turkish or Spanish cases vs. controls; Table 2). Similarly, studies of the rs 1982073 (TGFB1 codon 10) SNP indicated a trend towards increased T allelic frequency in all CBAVD subjects compared to controls (58% vs. 45%), although neither the subgroup analyses for polymorphism distribution by ethnicity nor genotype frequency indicated a significant association with CBAVD penetrance. With regard to TGFB1 codon 25 SNP (rs 1800471), there was no association with CBAVD for any of the analyses performed (Tables 3 and 4).

Table 2.

EDNRA genotype distributions in CBAVD patients and controls

EDNRA polymorphisms		Patients			Controls
Exon 8 (rs 5335)	Turkish	CC a	14	45.2%	6	19.4%
		CG	12	38.7%	20	64.5%
		GG	5	16.1%	5	16.1%
	Spanish	CC	4	21.1%	2	10%
		CG	11	57.8%	13	65%
		GG	4	21.1%	5	25%
	Total b		50			51
Promoter (rs 1801708)	Turkish	AA	5	16.1%	8	25.8%
		AG	18	58.1%	10	32.3%
		GG	8	25.8%	13	41.9%
	Spanish	AA	0	0%	2	10%
		AG	7	36.8%	8	40%
		GG	12	63.2%	10	50%
	Total		50			51

^ap <0.05 for Turkish population, χ² analysis

^bp < 0.05 for all subjects shown, χ² analysis

Table 3.

TGFB1 genotype distribution in CBAVD patients and controls

TGFB1 polymorphisms		Patients			Controls
Codon 10 (rs 1982073)	Turkish	CC	8	25.8%	13	41.9%
		CT	12	38.7%	8	25.8%
		TT	11	35.5%	10	32.3%
	Spanish	CC	4	21.1%	6	30%
		CT	6	31.6%	10	50%
		TT	9	47.4%	4	20%
	Total		50			51
Codon 25 (rs 1800471)	Turkish	GG	26	83.9%	28	90.3%
		GC	5	16.1%	3	9.7%
		CC	0	0%	0	0%
	Spanish	GG	19	100%	17	85%
		GC	0	0%	3	15%
		CC	0	0%	0	0%
	Total		50			51

Transforming growth factor β is the best described modifier of the CF pulmonary phenotype. With reference to the present study, the human vas deferens, epididymis, and seminal vesicle develop from the Wolffian-ducts, and it is well established that TGFβ and related signaling pathways are crucial during normal Wolffian-duct development and differentiation (41–43). A rat gene expression-array suggested that during Wolffian-duct formation, androgens indirectly modify IGF (insulin-like growth factor) and TGFβ signaling pathways, both of which play an important role during epithelial-mesenchymal interactions and normal development of the vas (43). Although TGFβ and associated signaling pathways have been shown to subserve a crucial role in the normal vas, and clearly contribute to CFTR-related pathology in tissues such as lung, the significance of this pathway in atypical CF-related conditions such as CBAVD has not been studied previously.

In our experiments, we found that TGFB polymorphisms rs 1800471 and 1982073 do not impact the CBAVD clinical phenotype. The result suggests important differences in the pathogenesis attributable to altered CFTR expression in CBAVD versus pulmonary CF. For example, CF lung manifestations including polymorphonuclear cell infiltration and cytokine release are known to exacerbate CF lung injury, and TGFβ (a known inflammatory modulator) might influence the extent of pulmonary inflammation due to chronic infection. Such mechanisms may not be relevant to vas development in utero, and therefore cannot be invoked to account for CBAVD in the setting of CFTR deficiency.

On the other hand, results from this initial survey indicate that at least one known genetic modifier of CF lung disease (EDNRA) does appear to associate with CBAVD. Endothelin receptor type A or a close homologue have been implicated previously as important during normal formation of the mammalian nervous system, the anorectum, and cranio-facial structures such as the mandible (44–47). Our results point to EDNRA as playing a significant role during development of the vas deferens, and indicate that the gene product may contribute to loss of the vas in the setting of CFTR insufficiency. Having said this, CBAVD is likely a multifactorial disease, and a number of other modifying factors almost certainly influence disease penetrance. Further studies of larger patient cohorts, as well as genome-wide association analyses will be necessary to determine the major effectors that influence penetrance of CBAVD.