Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Mar 1.
Published in final edited form as: J Hepatol. 2010 Jan 6;52(3):425–431. doi: 10.1016/j.jhep.2009.12.010

Iron uptake from plasma transferrin by a transferrin receptor 2 mutant mouse model of haemochromatosis

Anita CG Chua 1,2, Roheeth D Delima 1,2, Evan H Morgan 3, Carly E Herbison 1,2, Janina EE Tirnitz-Parker 1,2, Ross M Graham 1,2, Robert E Fleming 4, Robert S Britton 5, Bruce R Bacon 5, John K Olynyk 1,2, Debbie Trinder 1,2,*
PMCID: PMC2880807  NIHMSID: NIHMS167439  PMID: 20133002

Abstract

Background & Aims

Hereditary haemochromatosis type 3 is caused by mutations in transferrin receptor (TFR) 2. TFR2 has been shown to mediate iron transport in vitro and regulate iron homeostasis. The aim of this study was to determine the role of Tfr2 in iron transport in vivo using a Tfr2 mutant mouse.

Methods

Tfr2 mutant and wild-type mice were injected intravenously with 59Fe-transferrin and tissue 59Fe uptake was measured. Tfr1, Tfr2 and ferroportin expression was measured by real-time PCR and Western blot. Cellular localisation of ferroportin was determined by immunohistochemistry.

Results

Transferrin-bound iron uptake by the liver and spleen in Tfr2 mutant mice was reduced by 20% and 65%, respectively, whilst duodenal and renal uptake was unchanged compared with iron-loaded wild-type mice. In Tfr2 mutant mice, liver Tfr2 protein was absent, whilst ferroportin protein was increased in non-parenchymal cells and there was a low level of expression in hepatocytes. Tfr1 expression was unchanged compared with iron-loaded wild-type mice. Splenic Tfr2 protein expression was absent whilst Tfr1 and ferroportin protein expression was increased in Tfr2 mutant mice compared with iron-loaded wild-type mice.

Conclusions

A small reduction in hepatic transferrin-bound iron uptake in Tfr2 mutant mice suggests that Tfr2 plays a minor role in liver iron transport and its primary role is to regulate iron metabolism. Increased ferroportin expression due to decreased hepcidin mRNA levels is likely to be responsible for impaired splenic iron uptake in Tfr2 mutant mice.

Keywords: Transferrin receptor 2, Iron transport, Haemochromatosis, Iron overload, Liver

Introduction

Iron is an essential trace metal required for cellular growth and metabolism. Iron is normally transported in the plasma bound to transferrin and binds to transferrin receptors (TFR) expressed at the cell surface. There are two types of TFRs; TFR1 is ubiquitously expressed whilst TFR2 is highly expressed in hepatocytes and to a lesser extent in erythrocytes and duodenum [1]. The main function of TFR1 is to deliver transferrin-bound iron to cells via receptor-mediated endocytosis [2]. TFR2 has a lower binding affinity for diferric transferrin than TFR1 [3,4]. When TFR2 is over-expressed in Chinese Hamster Ovary cells, it mediates the endocytosis and recycling of transferrin [2] and uptake of transferrin-bound iron [1, 2]. Whether this is the case in the liver, erythrocytes and duodenum, where TFR2 is expressed is yet to be determined. Recent evidence suggests that TFR2, like TFR1, also binds to HFE. Conversely, HFE does not compete with transferrrin for TFR2 binding and binds TFR2 at a site that is distinct from the site of HFE-TFR1 interaction [5]. HFE has also been shown to increase the affinity of TFR2 for transferrin and increase transferrin-bound iron uptake in vitro [6].

TFR1, but not TFR2, is inversely regulated by intracellular iron levels by a post-transcriptional mechanism involving iron responsive elements (IRE). Instead, TFR2 is regulated by extracellular diferric transferrin levels by a post-translational mechanism. Diferric transferrin binds to TFR2 and increases its stability by redirecting TFR2 from a degradative pathway to a recycling pathway inside the cell, thereby increasing the half-life of the protein [7]. The regulation of TFR2 by transferrin saturation controls the expression of the iron regulatory peptide, hepcidin, by an unknown mechanism. The interaction of HFE and TFR2 regulates hepcidin expression [8] which may involve haemojuvelin/bone morphogenetic protein (HJV/BMP) signalling in hepatocytes [9]. Hepcidin is highly expressed by hepatocytes and is secreted into the circulation to regulate systemic body iron levels. It binds to the iron export protein, ferroportin (FPN), which is highly expressed in macrophages and enterocytes and is also expressed in hepatocytes. Upon binding, hepcidin induces the internalisation and degradation of FPN resulting in decreased iron release [10].

Mutations in TFR2 results in the iron overload disorder, hereditary haemochromatosis (HH) type 3. A Tfr2 mutant mouse model of HH type 3 has been generated with a Y245X mutation in the Tfr2 gene which is orthologous to the Y250X mutation identified in humans [11]. These mice have similar characteristics of the iron overload observed in subjects with HH type 3 [11,12]. The Y245X mutation in Tfr2 results in decreased hepcidin mRNA expression leading to increased iron absorption and the rapid deposition of the absorbed iron in the liver resulting in hepatic iron overload [12]. Iron overload that results from liver specific deletion of the Tfr2 gene is comparable to the complete Tfr2 knockout mice [13], indicating the central role of the liver in the regulation of iron metabolism.

In the present study, the role of Tfr2 in transferrin-bound iron uptake in vivo was investigated using a Tfr2 mutant mouse model of HH type 3. We provide evidence that TFR2 has a minor role in iron transport and hepatic iron loading in vivo. In the spleen, a decrease in iron uptake in Tfr2 mutant mice is likely to be due to increased Fpn-mediated iron export as a result of a down-regulation of hepcidin expression.

Materials and methods

Animals

Tfr2(Y245X) mutant mice were generated on a C57Bl/6x129/SVJ hybrid strain background as described previously [11]. The mice were backcrossed for 5 generations onto an AKR background and homozygous mutant and wild-type mice were derived from Tfr2 (Y245X) heterozygous mice (Animal Resource Centre, Australia). Female Tfr2 mutant and wild-type mice were fed either a control diet (70 mg iron/kg) or an iron-supplemented diet (20 g carbonyl iron/kg; Specialty Feeds, Australia) for 3 weeks from 7–10 weeks of age. All mice were studied between 10–14 weeks of age. This study was approved by The University of Western Australia Animal Ethics Committee.

Non-haem Iron Measurements

Liver and spleen non-haem iron levels were measured using the method of Kaldor [14].

Plasma Iron Clearance

Tfr2 mutant and wild-type mice were injected with 150 µg of 59Fe-125I-transferrin and 150 µg 131I-albumin intravenously into the ventral tail vein. Blood samples were collected at 2, 30, 60, and 90 minutes after injection and blood, liver, spleen, kidney and duodenum were collected 120 minutes after injection and counted for radioactivity. Tissue uptake of transferrin-bound iron and the rate of plasma iron turnover were determined as described previously [15].

Western blot analysis

Tfr1, Tfr2, Fpn and actin protein expression were determined in liver and spleen tissue from Tfr2 mutant and non-iron and iron-loaded wild-type mice as described previously [16,17]. Tfr1, Tfr2 and Fpn protein expression were normalised to actin expression and expressed relative to non-iron-loaded wild-type mice.

RNA expression

Total RNA was isolated from liver and spleen tissue and reverse transcribed as described previously [16, 17]. Tfr1, Tfr2, Fpn, Hamp1 and β-actin mRNA transcripts were measured by real-time polymerase chain reaction (PCR) in a Rotorgene (Corbett Research, Australia) using primers listed in Table 1 and quantified using standard curves generated from serial dilutions of known copy number of plasmids containing cDNA of the gene of interest. Tfr1, Tfr2, Fpn and Hamp1 mRNA expression were normalised against β-actin mRNA expression.

Table1.

Primers for real-time PCR

Gene sequence (5’ - 3’) Genbank
number
Tfr2 Fwd:TTCCTACATCATCTCGCTTAT NM 015799
Rev:TGGCGACACATACTGGGGACAG
Tfr1 Fwd:TTCCTACATCATCTCGCTTAT NM 011638
Rev:CATAGTGTTCATCTCGCCAGA
Fpn Fwd:TTGCAGGAGTCATTGCTGCTA NM 016917
Rev:TGGAGTTCTGCACACCATT
Hamp1 Fwd:TTGCGATACCAATGCAGAAGA NM 032541
Rev:GATGTGGCTCTAGGCTATGTTTTG
β-actin Fwd:CTGGCACCACACCTTCTA NM 007393
Rev:GGGCACAGTGTGGGTGAC
Open in a new tab

Tfr1, transferrin receptor 2; Tfr1, transferrin receptor 2; Fpn, ferroportin; Hamp1, hepcidin1

Immunohistochemistry

Frozen liver tissue was fixed with methanol/acetone (1:1), permeabilised with 0.02% Tween® 20 in PBS and blocked with 5% goat serum in PBS. Tissue sections were incubated with primary antibodies, rabbit anti-Fpn (Alpha Diagnostic, USA) and/or rat anti-F4/80, a macrophage marker (kind gift from Professor Ruth Ganss, Western Australian Institute for Medical Research) at 1:150 overnight at 4°C in REAL™ antibody diluent (DAKO, Denmark). Proteins were detected with secondary antibodies, goat anti-rabbit Alexa Fluor® 488 and/or goat anti-rat Alexa Fluor® 594 (Invitrogen Australia) at 1:200 in antibody diluent for 1 hour in the dark. Sections were washed in PBS and mounted with ProLong Gold® antifade reagent with DAPI (Invitrogen) to counterstain the nuclei.

Statistics

Results are expressed as mean ± SEM where n = 4–8 mice per group. Differences between group means were analysed using ANOVA with Tukey’s multiple comparison tests (GraphPad PRISM, USA) and were statistically significant for p < 0.05.

Results

Non-haem Iron

Non-haem iron levels in the livers of Tfr2 mutant, non-iron-loaded and iron-loaded wild-type mice were measured to confirm the iron status of the mice. Liver non-haem iron concentration in Tfr2 mutant and iron-loaded wild-type mice was similar and 5-fold greater than non-iron-loaded wild-type mice (Fig. 1A). Similarly, plasma iron and transferrin saturation levels were increased in Tfr2 mutant and iron-loaded wild-type mice compared to non-iron-loaded mice as shown previously [11,12]. In the spleen, non-haem iron concentration in Tfr2 mutant mice was reduced by 70% and 80% compared with non-iron-loaded and iron-loaded wild-type mice, respectively (Fig. 1B). Liver and spleen ferritin protein expression correlated with non-haem iron concentrations (data not shown).

Figure 1. Non-haem iron concentrations in the liver (A) and spleen (B) of Tfr2 mutant (Tfr2 mut), non-iron-loaded (WT) and iron-loaded (WT + Fe) wild-type mice.

Figure 1

Open in a new tab

Results are expressed as mean ± SEM, n = 6–8. Significant difference between mouse groups: * p <0.0001, Tfr2 mut vs WT, +p <0.0001, Tfr2 mut vs WT + Fe and WT; #p <0.002 WT + Fe vs WT.

Transferrin-bound Iron Uptake

Liver uptake of transferrin-bound iron by Tfr2 mutant mice was not significantly different from iron uptake by non-iron-loaded wild-type mice and was reduced by 20% compared with iron-loaded wild-type mice (Fig. 2A). When Tfr2 mutant mice were fed an iron-supplemented diet, liver iron uptake was increased (17.7 ± 1.0 µmol iron/g tissue; p <0.001) but was not significantly different to iron uptake by iron-loaded wild-type mice. Uptake of transferrin-bound iron by the spleen in Tfr2 mutant mice was reduced by 50% and 65% compared with non-iron-loaded and iron-loaded wild-type mice, respectively (Fig. 2B). There was, however, no difference in transferrin-bound iron uptake by the duodenum and kidneys in Tfr2 mutant mice compared with both non-iron-loaded and iron-loaded wild-type mice (Fig. 2C, D; p > 0.05). Plasma iron turnover, which was calculated from the rate of 59Fe clearance from the plasma over 2 hours, was not significantly different between Tfr2 mutant mice, iron-loaded and non-iron-loaded wild-type mice (Fig. 2E; p > 0.1).

Figure 2. Plasma transferrin-bound iron uptake by the liver (A), spleen (B), duodenum (C) and kidneys (D) and plasma iron turnover (E) in Tfr2 mutant (Tfr2 mut), non-iron-loaded (WT) and iron-loaded (WT + Fe) wild-type mice.

Figure 2

Open in a new tab

Results are expressed as mean ± SEM, n = 5–6. Significant difference between mouse groups: *p <0.05, Tfr2 mut vs WT + Fe; +p <0.05, Tfr2 mut vs WT+Fe and WT; #p <0.01 WT + Fe vs WT.

Expression of iron metabolism genes

Liver Tfr2 mRNA expression was low and protein expression was absent in Tfr2 mutant mice. In contrast, Tfr2 was highly expressed in wild-type mice and Tfr2 protein expression increased with iron-loading. Tfr2 protein expression in the spleen was not detected in all groups of mice (Table 2, Fig. 3A, B). Liver Tfr1 mRNA and protein expression in Tfr2 mutant mice was similar to iron-loaded wild-type mice and was decreased significantly compared with non-iron-loaded wild-type mice. Splenic Tfr1 mRNA and protein expression in Tfr2 mutant mice was increased significantly compared with non-iron-loaded mice and both were greater than iron-loaded wild-type mice. (Table 2, Fig. 4A, B).

Table 2.

mRNA expression of iron genes

Tissue Gene WT Tfr2 mutant Iron loaded WT
Liver Tfr2 1.62 ± 0.25 0.30 ± 0.04*# 1.49 ± 0.15
Tfr1 0.0098 ± 0.0020 0.0043 ± 0.0006* 0.0058 ± 0.0005*
Fpn 0.25 ± 0.02 (7) 0.31 ± 0.04 0.29 ± 0.05
Hamp1 7.29 ± 1.42 (4) 2.93 ± 0.75 *# 11.98 ± 1.19*
Spleen Tfr2 0.0010 ± 0.0003 0.00010 ± 0.00002*# 0.0010 ± 0.0001
Tfr1 0.018 ± 0.002 0.037 ± 0.003*# 0.012 ± 0.001*
Fpn 0.10 ±0.02 0.08 ± 0.02 0.11 ± 0.01
Open in a new tab

Results are expressed as mean ± SEM, where n=4–8 for the gene interest relative to β-actin.

*

p < 0.05 versus wild-type mice and

#

p < 0.05 versus iron loaded wild-type mice. Tfr2, transferrin receptor 2; Tfr1, transferrin receptor 1, Fpn, ferroportin; Hamp1, hepcidin1

Figure 3. Tfr2 protein expression in the liver (A) and spleen (B) in Tfr2 mutant (Tfr2 mut), non-iron-loaded (WT) and iron-loaded wild-type mice (WT + Fe).

Figure 3

Open in a new tab

Results are expressed as mean ± SEM, n = 5–6. Representative blots of hepatic (A) and splenic (B) Tfr2 protein expression from 3 independent experiments are shown. Significant difference between mouse groups: +p <0.001, Tfr2 mut vs WT + Fe and WT; #p <0.05 WT + Fe vs WT.

Figure 4. Tfr1 protein expression in the liver (A) and spleen (B) in Tfr2 mutant (Tfr2 mut), non-iron-loaded (WT) and iron-loaded wild-type mice (WT + Fe).

Figure 4

Open in a new tab

Results are expressed as mean ± SEM, n = 4–6. Representative blots of hepatic and splenic Tfr1 protein expression from 3 independent experiments are shown. Significant difference between mouse groups: *p <0.001, Tfr2 mut vs WT; +p <0.025, Tfr2 mut vs WT + Fe and WT; #p <0.025 WT + Fe vs WT.

Liver Hamp1 mRNA expression was markedly reduced in Tfr2 mutant mice compared with wild-type mice and was increased significantly in wild-type mice with iron-loading (Table 2). Fpn mRNA expression was similar in all types of mice in both the liver and spleen (Table 2). In the liver, Fpn protein was significantly increased in Tfr2 mutant mice compared with wild-type mice with increased expression in non-parenchymal macrophages and low levels of expression in hepatocytes mainly in the periportal regions (Fig. 5A, 6B, D–F). In wild-type mice, Fpn protein was detected in non-parenchymal macrophages and expression was increased with iron-loading; however, not to the same extent seen in Tfr2 mutant mice (Fig. 5A, 6A, C). In the spleen, Fpn protein was increased in Tfr2 mutant mice compared with wild-type mice. Iron-loading of wild-type mice resulted in significantly reduced Fpn levels (Fig. 5B).

Figure 5. Fpn protein expression in the liver (A) and spleen (B) in Tfr2 mutant (Tfr2 mut), non-iron-loaded (WT) and iron-loaded wild-type mice (WT + Fe).

Figure 5

Open in a new tab

Results are expressed as mean ± SEM, n = 4–7. Representative blots of hepatic and splenic Fpn protein expression from 3 independent experiments are shown. Significant difference between mouse groups: +p <0.001, Tfr2 mut vs WT + Fe and WT; #p <0.001 WT + Fe vs WT.

Figure 6. Cellular localisation of hepatic Fpn expression. Frozen liver sections from wild-type (WT), Tfr2 mutant (Tfr2 mut) and iron-loaded wild-type mice (WT + Fe) were immunofluorescently stained with an antibody against Fpn (green) and DAPI (blue) for nuclear quantitation (A–C).

Figure 6

Open in a new tab

Double staining of Tfr2 mut liver for F4/80 (red, D) and Fpn (green, E) demonstrated that the majority of cells that strongly express Fpn were F4/80-positive macrophages (Mac), while hepatocytes (Hep) only express the Fpn antigen at lower levels (F).

Discussion

TFR2 has an important role in iron homeostasis since mutations in TFR2 result in HH type 3 causing iron overload [18]. In addition to its role in iron regulation, TFR2 has been shown to transport transferrin-bound iron in vitro [1,2]. In the present study, the role of TFR2 in transferrin-bound iron uptake in vivo was investigated using Tfr2 mutant mice. Here, we demonstrate that the absence of Tfr2 did not have a substantial impact on transferrin-bound iron uptake by the liver, spleen, duodenum and kidney indicating that the primary role of TFR2 is to regulate cellular iron metabolism with a minor role in iron transport.

As indicated by liver non-haem iron levels, iron-loaded mice achieved elevated hepatic iron stores to the same degree as the Tfr2 mutant mice. In the liver, hepatocytes acquire iron from plasma transferrin by receptor-mediated endocytosis via TFRs. Liver Tfr1 mRNA and protein expression in Tfr2 mutant and iron-loaded wild-type mice was similar and decreased compared to non-iron-loaded wild-type mice. Liver Tfr2 mRNA was similar and Tfr2 protein expression was up-regulated in iron-loaded wild-type mice compared with non-iron-loaded wild-type mice and the protein was absent in Tfr2 mutant mice. The Y245X mutation introduces a stop codon in the Tfr2 gene and stops the expression of the protein [11]. These results are consistent with the post-transcriptional regulation of Tfr1 by iron via the IRE-iron regulatory protein (IRP) mechanism [19] and post-translational regulation of Tfr2 by diferric transferrin [20,21] which is increased in iron overload. Iron-loading increased transferrin-bound iron uptake by the liver in wild-type mice. Since liver Tfr1 expression is relatively low and down-regulated by iron-loading, it is unlikely to contribute to hepatic iron loading in both iron-loaded wild-type and Tfr2 mutant mice. Hence, the increase in liver iron uptake in iron-loaded wild-type mice may be attributable at least in part by an increase in Tfr2 protein levels. Despite high Tfr2 protein expression in the liver, the loss of functional Tfr2 in the mutant mice had little impact on transferrin-bound iron uptake. Iron uptake from plasma transferrin by the liver in Tfr2 mutant mice was decreased by approximately 20% compared to uptake by iron-loaded wild-type mice. In contrast, Tfr2 mutant mouse liver takes up over 10-fold more iron from the portal circulation compared with wild-type mice with approximately 90% of the absorbed iron deposited in the liver [12]. As plasma transferrin in Tfr2 mutant mice is almost completely saturated, iron absorbed by the duodenum will most likely be in the form of non-transferrin-bound iron and the rapid deposition of iron in the liver suggests that this pathway contributes to liver iron-loading in TFR2-related haemochromatosis. These results highlight that Tfr2 plays a small role in liver iron transport and suggest the presence of another route of transferrin-bound iron uptake that is independent of Tfr1 and Tfr2. The observation that liver uptake of transferrin-bound iron by Tfr2 mutant mice fed an iron-supplemented diet was increased rather than attenuated by the loss of functional Tfr2 corroborates this concept. Furthermore, this is supported by our previous findings in hepatocytes where up-regulation of Tfr2 protein expression was not accompanied by an increase in transferrin-bound iron uptake [17]. This raises the possibility that iron may be released from tissues in the form of non-transferrin bound iron, particularly in the iron-loaded mice, which is rapidly cleared from the plasma by the liver and contributes to iron-loading by a Tfr-independent pathway.

We and others have shown that hepcidin mRNA expression is down-regulated in Tfr2 mutant mice and up-regulated in iron-loaded wild-type mice [12,22,23]. In the current work, liver Fpn protein expression in Tfr2 mutant mice was increased compared with wild-type mice in agreement with the intracellular targeting of Fpn for degradation by hepcidin [10]. In Tfr2 mutant mice, Fpn was expressed mainly in liver macrophages with low expression detected in hepatocytes. Given the role of Fpn in iron export, this suggests that iron export by liver macrophages, and to a lesser degree by hepatocytes, may be increased in Tfr2 mutant mice. Transferrin-bound iron is taken up mainly by hepatocytes. Hence, the reduction in liver iron uptake by Tfr2 mutant mice compared to iron-loaded wild-type mice is likely to be due to a loss of Tfr2 which is highly expressed in hepatocytes and to a lesser degree due to an increase in Fpn-mediated iron export by hepatocytes and liver macrophages, since hepatic Fpn expression is relatively low [24]. Despite increased hepcidin expression [12], liver Fpn protein expression was increased in non-parenchymal macrophages in iron-loaded wild-type compared with non-iron-loaded wild-type mice suggesting there is also iron regulation of Fpn in liver macrophages. Fpn gene contains an IRE in its 5’-untranslated region that is involved in iron-dependent post-transcriptional gene regulation [24,25]; this process may contribute to the up-regulation of Fpn protein expression in macrophages of the iron-loaded wild-type mice.

Splenic non-haem iron levels in Tfr2 mutant mice were decreased compared with non-iron-loaded wild-type mice consistent with previous reports [11,13] whilst levels in iron-loaded wild-type mice were increased. Similarly, iron uptake by Tfr2 mutant mice was decreased compared with wild-type mice. These results suggest that the spleen was relatively iron-deficient in Tfr2 mutant mice due to reduced net splenic transport of transferrin-bound iron resulting from two processes involving the uptake and release of iron by the spleen. Tfr2 protein was not expressed in the spleens from both Tfr2 mutant and wild-type mice. Splenic Tfr1 expression was up-regulated in Tfr2 mutant mice and down-regulated in iron-loaded wild-type mice compared with non-iron-loaded wild-type mice. This is as expected due to the iron-dependent regulation of Tfr1 by the IRE-IRP system. Tfr1 is expressed at relatively low levels in the spleen and an increase in Tfr1 expression in Tfr2 mutant mice is likely to have only a small effect on splenic iron uptake. Fpn is highly expressed by reticulo-endothelial macrophages in the spleen [24] and Fpn protein expression was up-regulated in Tfr2 mutant mice, reflecting the hepcidin-deficient state of Tfr2 mutant mice. Furthermore, the overall trends in Fpn protein expression were consistent with iron deposition in the spleen suggesting that the reduction in splenic iron accumulation by Tfr2 mutant mice is most likely to be due to more iron being exported by the highly expressed Fpn than imported by the relatively low levels of Tfr1 in the spleen.

Tfr2 is expressed at relatively low levels in the duodenum [26] and there was no difference in transferrin-bound iron uptake by the duodenum. Tfr2 is not expressed in the kidneys [1] and consistent with this, there was no change in transferrin-bound iron uptake observed between Tfr2 mutant and wild-type mice. These results suggest that Tfr2 has a minor a role, if any, in transferrin-bound iron transport by the duodenum and kidneys. The clearance of plasma transferrin-bound iron reflects the iron requirements of the bone marrow for erythropoiesis. Expression of Tfr2 by erythropoietic cells is contentious [27,28]. However, the lack of change in plasma iron turnover in Tfr2 mutant mice suggests that Tfr2 does not mediate iron uptake by the erythroid cells in the bone marrow which may be due to the absence of Tfr2 expression by normal erythroid cells [28].

The hepatic peptide, hepcidin is regulated by iron levels and hepcidin levels increase when iron is present in excess. Patients and mouse models with TFR2- and HFE-related HH develop hepcidin deficiency despite high tissue iron stores [12,23,29–31] demonstrating the crucial role of both TFR2 and HFE in the iron regulation of hepcidin. Furthermore, iron overload in patients with TFR2-related HH has been shown to be more severe than HFE-related HH [32,33] indicating that the loss of functional TFR2 may be more detrimental than the loss of functional HFE. It has been postulated that TFR2 and HFE act as iron sensors to signal to hepatocytes the degree of transferrin saturation in the plasma modulating hepcidin synthesis accordingly. A current model of iron-dependent regulation of hepcidin proposes that at high plasma transferrin saturation, diferric transferrin binds to both TFR1 and TFR2 in hepatocytes. HFE is displaced from TFR1 and binds to TFR2 which is stabilised by the increased diferric transferrin levels. The HFE-TFR2 complex signals to hepcidin directly or associates with HJV and promotes BMP signalling which leads to increased hepcidin synthesis [8,9,34].

In conclusion, iron uptake from plasma transferrin in mice lacking functional Tfr2 protein was decreased by only a small amount in the liver and was unchanged in the duodenum and kidney compared to wild-type mice with equivalent iron overload, indicating that Tfr2 has a lesser role in iron transport and a greater role in the regulation of iron metabolism to balance the demands of iron utilization with iron absorption, recycling, and storage in the liver. Furthermore, impaired splenic iron deposition in Tfr2 mutant mice is likely to be a result of increased Fpn-mediated iron export as a direct consequence of down-regulation of liver hepcidin production.

Acknowledgements

The authors who have taken part in this study declared that they do not have anything to declare regarding funding from industry or conflict of interest with respect to this manuscript. The authors thank Carla Smith for technical assistance. This study was supported by grants from the National Health and Medical Research Council (NHMRC), Australia (404021) to DT, EHM and JKO, and grants from US Public Health Services to BRB (NIH DK041816) and REF (NIH DK063016). JKO is a recipient of a NHMRC Practitioner Fellowship (513761) and DT a Gastroenterological Society of Australia Senior Research Fellowship.

Abbreviations

TFR

transferrin receptor 1

IRE

iron regulatory element

HJV

haemojuvelin

BMP

bone morphogenetic protein

FPN

ferroportin

HH

hereditary haemochromatosis

Hamp

hepcidin

IRP

iron regulatory protein.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Kawabata H, Yang R, Hirama T, Vuong PT, Kawano S, Gombart AF, et al. Molecular cloning of transferrin receptor 2. A new member of the transferrin receptor-like family. J Biol Chem. 1999;274:20826–20832. doi: 10.1074/jbc.274.30.20826. [DOI] [PubMed] [Google Scholar]
  • 2.Graham RM, Reutens GM, Herbison CE, Delima RD, Chua AC, Olynyk JK, et al. Transferrin receptor 2 mediates uptake of transferrin-bound and non-transferrin-bound iron. J Hepatol. 2008;48:327–334. doi: 10.1016/j.jhep.2007.10.009. [DOI] [PubMed] [Google Scholar]
  • 3.Kawabata H, Germain RS, Vuong PT, Nakamaki T, Said JW, Koeffler HP. Transferrin receptor 2-alpha supports cell growth both in iron-chelated cultured cells and in vivo. J Biol Chem. 2000;275:16618–16625. doi: 10.1074/jbc.M908846199. [DOI] [PubMed] [Google Scholar]
  • 4.West AP, Jr, Bennett MJ, Sellers VM, Andrews NC, Enns CA, Bjorkman PJ. Comparison of the interactions of transferrin receptor and transferrin receptor 2 with transferrin and the hereditary hemochromatosis protein HFE. J Biol Chem. 2000;275:38135–38138. doi: 10.1074/jbc.C000664200. [DOI] [PubMed] [Google Scholar]
  • 5.Chen J, Chloupkova M, Gao J, Chapman-Arvedson TL, Enns CA. HFE modulates transferrin receptor 2 levels in hepatoma cells via interactions that differ from transferrin receptor 1-HFE interactions. J Biol Chem. 2007;282:36862–36870. doi: 10.1074/jbc.M706720200. [DOI] [PubMed] [Google Scholar]
  • 6.Waheed A, Britton RS, Grubb JH, Sly WS, Fleming RE. HFE association with transferrin receptor 2 increases cellular uptake of transferrin-bound iron. Arch Biochem Biophys. 2008;474:193–197. doi: 10.1016/j.abb.2008.02.041. [DOI] [PubMed] [Google Scholar]
  • 7.Johnson MB, Chen J, Murchison N, Green FA, Enns CA. Transferrin receptor 2: evidence for ligand-induced stabilization and redirection to a recycling pathway. Mol Biol Cell. 2007;18:743–754. doi: 10.1091/mbc.E06-09-0798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gao J, Chen J, Kramer M, Tsukamoto H, Zhang A-S, Enns CA. Interaction of the Hereditary Hemochromatosis Protein HFE with transferrin receptor 2 is required for transferrin-induced hepcidin expression. Cell Metabolism. 2009;9:217–227. doi: 10.1016/j.cmet.2009.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lin L, Valore EV, Nemeth E, Goodnough JB, Gabayan V, Ganz T. Iron transferrin regulates hepcidin synthesis in primary hepatocyte culture through hemojuvelin and BMP2/4. Blood. 2007;110:2182–2189. doi: 10.1182/blood-2007-04-087593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Ward DM, et al. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science. 2004;306:2090–2093. doi: 10.1126/science.1104742. [DOI] [PubMed] [Google Scholar]
  • 11.Fleming RE, Ahmann JR, Migas MC, Waheed A, Koeffler HP, Kawabata H, et al. Targeted mutagenesis of the murine transferrin receptor-2 gene produces hemochromatosis. Proc Natl Acad Sci USA. 2002;99:10653–10658. doi: 10.1073/pnas.162360699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Drake SF, Morgan EH, Herbison CE, Delima R, Graham RM, Chua AC, et al. Iron absorption and hepatic iron uptake are increased in a transferrin receptor 2 (Y245X) mutant mouse model of hemochromatosis type 3. Am J Physiol Gastrointest Liver Physiol. 2007;292:G323–G328. doi: 10.1152/ajpgi.00278.2006. [DOI] [PubMed] [Google Scholar]
  • 13.Wallace DF, Summerville L, Subramaniam VN. Targeted disruption of the hepatic transferrin receptor 2 gene in mice leads to iron overload. Gastroenterology. 2007;132:301–310. doi: 10.1053/j.gastro.2006.11.028. [DOI] [PubMed] [Google Scholar]
  • 14.Kaldor I. Studies on intermediary iron metabolism. V. The measurement of non-haemoglobin tissue iron. Aust J Exp Biol Med Sci. 1954;32:795–799. doi: 10.1038/icb.1954.82. [DOI] [PubMed] [Google Scholar]
  • 15.Trinder D, Olynyk JK, Sly WS, Morgan EH. Iron uptake from plasma transferrin by the duodenum is impaired in the Hfe knockout mouse. Proc Natl Acad Sci U S A. 2002;99:5622–5626. doi: 10.1073/pnas.082112299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chua AC, Drake SF, Herbison CE, Olynyk JK, Leedman PJ, Trinder D. Limited iron export by hepatocytes contributes to hepatic iron-loading in the Hfe knockout mouse. J Hepatol. 2006;44:176–182. doi: 10.1016/j.jhep.2005.08.012. [DOI] [PubMed] [Google Scholar]
  • 17.Chua AC, Herbison CE, Drake SF, Graham RM, Olynyk JK, Trinder D. The role of Hfe in transferrin-bound iron uptake by hepatocytes. Hepatology. 2008;47:1737–1744. doi: 10.1002/hep.22180. [DOI] [PubMed] [Google Scholar]
  • 18.Camaschella C, Roetto A, Cali A, De Gobbi M, Garozzo G, Carella M, et al. The gene TFR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet. 2000;25:14–15. doi: 10.1038/75534. [DOI] [PubMed] [Google Scholar]
  • 19.Casey JL, Hentze MW, Koeller DM, Caughman SW, Rouault TA, Klausner RD, et al. Iron-responsive elements: regulatory RNA sequences that control mRNA levels and translation. Science. 1988;240:924–928. doi: 10.1126/science.2452485. [DOI] [PubMed] [Google Scholar]
  • 20.Johnson MB, Enns CA. Diferric transferrin regulates transferrin receptor 2 protein stability. Blood. 2004;104:4287–4293. doi: 10.1182/blood-2004-06-2477. [DOI] [PubMed] [Google Scholar]
  • 21.Robb A, Wessling-Resnick M. Regulation of transferrin receptor 2 protein levels by transferrin. Blood. 2004;104:4294–4299. doi: 10.1182/blood-2004-06-2481. [DOI] [PubMed] [Google Scholar]
  • 22.Pigeon C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, et al. A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem. 2001;276:7811–7819. doi: 10.1074/jbc.M008923200. [DOI] [PubMed] [Google Scholar]
  • 23.Kawabata H, Fleming RE, Gui D, Moon SY, Saitoh T, O'Kelly J, et al. Expression of hepcidin is down-regulated in TfR2 mutant mice manifesting a phenotype of hereditary hemochromatosis. Blood. 2005;105:376–381. doi: 10.1182/blood-2004-04-1416. [DOI] [PubMed] [Google Scholar]
  • 24.Abboud S, Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem. 2000;275:19906–19912. doi: 10.1074/jbc.M000713200. [DOI] [PubMed] [Google Scholar]
  • 25.Lymboussaki A, Pignatti E, Montosi G, Garuti C, Haile DJ, Pietrangelo A. The role of the iron responsive element in the control of ferroportin1/IREG1/MTP1 gene expression. J Hepatol. 2003;39:710–715. doi: 10.1016/s0168-8278(03)00408-2. [DOI] [PubMed] [Google Scholar]
  • 26.Griffiths WJ, Cox TM. Co-localization of the mammalian hemochromatosis gene product (HFE) and a newly identified transferrin receptor (TfR2) in intestinal tissue and cells. J Histochem Cytochem. 2003;51:613–624. doi: 10.1177/002215540305100507. [DOI] [PubMed] [Google Scholar]
  • 27.Kawabata H, Nakamaki T, Ikonomi P, Smith RD, Germain RS, Koeffler HP. Expression of transferrin receptor 2 in normal and neoplastic hematopoietic cells. Blood. 2001;98:2714–2719. doi: 10.1182/blood.v98.9.2714. [DOI] [PubMed] [Google Scholar]
  • 28.Calzolari A, Deaglio S, Sposi NM, Petrucci E, Morsilli O, Gabbianelli M, et al. Transferrin receptor 2 protein is not expressed in normal erythroid cells. Biochem J. 2004;381:629–634. doi: 10.1042/BJ20040230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nemeth E, Roetto A, Garozzo G, Ganz T, Camaschella C. Hepcidin is decreased in TFR2 hemochromatosis. Blood. 2005;105:1803–1806. doi: 10.1182/blood-2004-08-3042. [DOI] [PubMed] [Google Scholar]
  • 30.Bridle KR, Frazer DM, Wilkins SJ, Dixon JL, Purdie DM, Crawford DH, et al. Disrupted hepcidin regulation in HFE-associated haemochromatosis and the liver as a regulator of body iron homoeostasis. Lancet. 2003;361:669–673. doi: 10.1016/S0140-6736(03)12602-5. [DOI] [PubMed] [Google Scholar]
  • 31.Ahmad KA, Ahmann JR, Migas MC, Waheed A, Britton RS, Bacon BR, et al. Decreased liver hepcidin expression in the Hfe knockout mouse. Blood Cells Mol Dis. 2002;29:361–366. doi: 10.1006/bcmd.2002.0575. [DOI] [PubMed] [Google Scholar]
  • 32.Majore S, Milano F, Binni F, Stuppia L, Cerrone A, Tafuri A, et al. Homozygous p.M172K mutation of the TFR2 gene in an Italian family with type 3 hereditary hemochromatosis and early onset iron overload. Haematologica. 2006;91 ECR33. [PubMed] [Google Scholar]
  • 33.Biasiotto G, Camaschella C, Forni GL, Polotti A, Zecchina G, Arosio P. New TFR2 mutations in young Italian patients with hemochromatosis. Haematologica. 2008;93:309–310. doi: 10.3324/haematol.11942. [DOI] [PubMed] [Google Scholar]
  • 34.Nemeth E. Iron regulation and erythropoiesis. Curr Opin Hematol. 2008;15:169–175. doi: 10.1097/MOH.0b013e3282f73335. [DOI] [PubMed] [Google Scholar]

RESOURCES