Heterologous Expression, Purification, and Biochemical Characterization of a Greenbug (Schizaphis graminum) Acetylcholinesterase Encoded by a Paralogous Gene (ace-1)

Abstract

Acetylcholinesterase is a critical enzyme in the regulation of cholinergic neurotransmission in insects. To produce Schizaphis graminum acetylcholinesterase-1 for structure–function analysis, we constructed a recombinant baculovirus to infect Sf 9 cells, which secreted the soluble protein at a final concentration of 4.0 mg/L. The purified enzyme had an apparent M_r of 70 and 130 kDa in the reducing and nonreducing SDS-polyacrylamide gels, respectively, indicating that it formed a dimer via an intermolecular disulfide bond. The fresh enzyme had a specific activity of 245 U/mg, which stabilized at a lower level (115 U/mg) in storage. The Michaelis constant and maximum velocity were 88.3 ± 9.6 μM and 133.2 ± 1.6 U/mg for acetylthiocholine iodide, 113.9 ± 12.5 μM and 106.4 ± 3.0 U/mg for acetyl(β-methyl)thiocholine iodide, 68.9 ± 7.8 μM and 76.7 ± 1.0 U/mg for propionylthiocholine iodide, and 201.1 ± 21.0 μM and 4.4 ± 0.1 U/mg for S-butyrylthiocholine iodide, respectively. The IC₅₀ values (5 min, room temperature) of ethopropazine, BW284C51, carbaryl, eserine, malaoxon, and paraoxon were 102, 1.66, 0.94, 0.20, 0.061, 0.016 μM, respectively. The bimolecular reaction constants (k_i) were (6.50 ± 0.40) × 10⁴ for carbaryl, (1.00 ± 0.16) × 10⁵ for eserine, (4.70 ± 0.13) × 10⁵ for malaoxon, and (9.06 ± 0.23) × 10⁵ M⁻¹ min⁻¹ for paraoxon. The enzyme was also inhibited by one of its products, choline, at concentrations higher than 20 mM, suggesting that choline bound to an anionic site and regulated the enzymatic activity.

INTRODUCTION

Insect acetylcholinesterases (AChEs) terminate cholinergic neurotransmission by hydrolyzing acetylcholine, the neurotransmitter released by cholinergic neurons that subsequently activates postsynaptic cholinergic receptors [1]. Insecticides such as organophosphates (OPs) and carbamates are suicidal inhibitors of AChEs, which phosphorylate and carbamylate, respectively, the serine residue at the enzyme active site. Owing to the low rate of dephosphorylation or decarbamylation, little active AChE is left to prevent the accumulation of acetylcholine and consequent disruption of cholinergic signaling, which can lead to death in susceptible insects. A number of insect AChEs have been studied in detail to understand their catalytic mechanism and specific interactions with substrates or inhibitors [2,3].

Intensive use of OPs and carbamates has resulted in the prevalence of resistant insects with avoidance behaviors, low penetration, enhanced sequestration, metabolic detoxification, and/or insensitive AChEs [4,5]. To test whether target site insensitivity is responsible for resistance, AChEs from susceptible and resistant strains are often characterized and cloned to detect possible nonsynonymous substitutions [6,7]. Once a genotype–phenotype correlation is established, comparison of the wild-type and mutated AChEs can be useful for studying a change in inhibitor binding or hydrolysis and for monitoring the resistant alleles in a field population [8,9].

Based on known sequences, many insect species possess two AChE genes: ace-1 and ace-2 are paralogous and orthologous to the Drosophila gene, respectively [10]. While the single gene (ace-2) in Muscomorpha or true flies (such as D. melanogaster) encodes AChE2 essential for proper neurotransmission, ace-1 appears to be more important in other insects—insecticide-insensitive AChEs are mainly associated with mutations in ace-1 rather than ace-2 [11]. Huchard et al. [12] proposed that the loss of ace-1 was accompanied with the functional takeover by ace-2 in the common ancestor of true flies.

The greenbug Schizaphis graminum is a major pest species infesting sorghum, wheat, and other small grains. One AChE has been isolated from the aphid by affinity chromatography on a procainamide column [13]. Like other invertebrate AChEs, the purified enzyme is inhibited by its substrates at a high concentration (>5 mM). cDNA cloning and sequence comparison indicate that the S. graminum AChE gene (ace-1) is paralogous to D. melanogaster ace-2 [14]. Thus, S. graminum ace-1 represents the first paralogous gene identified in an insect species. In this study, we have expressed the catalytic domain of S. graminum AChE1 (r-SgAChE1 or simply SgAChE1) and characterized its biochemical properties. These results constitute a foundation for future investigations on protein structure, enzyme catalysis, resistance mechanism, and pesticide development.

MATERIALS AND METHODS

Chemicals

Acetylthiocholine iodide (ATC), acetyl(β-methyl)thiocholine iodide (AβMTC), 1,5-bis(4-allyldimethylammoniumphenyl)-pentan-3-one dibromide (BW284C51), propionylthio-choline iodide (PTC), S-butyrylthiocholine iodide (BTC), 5,5-dithiobis(2-nitrobenzoic acid) (DTNB), choline chloride, eserine hemisulfate, ethopropazine hydrochloride, and carbaryl were purchased from Sigma-Aldrich (St. Louis, MO). Paraoxon and malaoxon were kindly provided by Dr. Carey Pope in Department of Physiological Sciences at Oklahoma State University.

Construction of SgAChE1/pMFH₆ and Recombinant Baculovirus

The SgAChE1 cDNA clone [14] was used as a template to amplify a region encoding the catalytic domain in a polymerase chain reaction using primers j242 (5 GTGGAATTCCATCAGACGATCCACT, nucleotides 537–561) and j227 (5 ACCGATAACTCGAGCACGTTAGTT, reverse complement of nucleotides 2224–2247). The thermal cycling conditions were 30 cycles of 95°C for 20 s, 50°C for 40 s, and 68°C for 120 s. After electrophoresis, the 1.71-kb product was recovered from the agarose gel and inserted to pGem-T (Promega, Madison, WI). Plasmid DNA was prepared from transformants and verified by complete sequence analysis. The cDNA fragment, retrieved by EcoRI-XhoI digestion, was inserted into the same sites in pMFH₆ [15] to generate SgAChE1/pMFH₆. In vivo transposition of the expression cassette, selection of bacterial colonies carrying the recombinant bacmid, and isolation of bacmid DNA were performed as previously described [16]. The initial viral stock (V₀) was obtained by transfecting Spodoptera frugiperda Sf9 cells with the bacmid DNA–CellFECTIN mixture, and its titer was improved through serial infection. The V₅ viral stock, containing the highest level of baculovirus (1 ~ 2 × 10⁸ pfu/mL), was stored at −70°C for further experiments.

Expression and Purification of SgAChE1

Sf9 cells (3.0 × 10⁶ cells/mL) in 1000 mL of SFII-900 medium (Invitrogen Life Technologies, Carlsbad, CA) were infected by the viral stock at a multiplicity of infection of 5–10 and grown at 27°C for 80 h with agitation at 100 rpm. After the cells were removed by centrifugation at 5000×g for 10 min, the cell culture supernatant was diluted with two volumes of buffer A (0.1 M sodium phosphate, pH 6.3). Fifty milliliters of dextran sulfate (DS)-sepharose CL-6B [17], equilibrated in buffer A, was gently mixed with the supernatant on ice for 1 h. The suspension was loaded into a column (2.5 cm × 20 cm), washed with 200 mL buffer A, and eluted with 200 mL buffer A containing 1.3 M NaCl, 0.5% PEG-8000, and 0.05% Tween-20. Active fractions were mixed with 10 mL nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, Valencia, CA), stirred overnight on ice, and loaded into a column. After washing with 100 mL, pH 7.4, phosphate-buffered saline containing 0.01% Tween-20 and 30 mM imidazole, bound proteins were eluted with 30 mL, 300 mM imidazole in the same buffer supplemented with 1.3 M NaCl, 0.05% Tween-20, 0.5% PEG-8000, and 0.1% Pluronic F68. The purified enzyme was aliquoted and stored at −20°C in the presence of 50% glycerol.

Measurement of Protein Concentration and SgAChE1 Activity

Protein concentration was determined using Coomassie Plus Protein Assay kit (Pierce, Rockford, IL) and bovine serum albumin (BSA) as a standard. AChE activity was measured at room temperature by the modified Ellman method [18] using ATC and DTNB in a total volume of 100 μL. Absorbance at 405 nm was monitored immediately for 2 min on a VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA). One unit of AChE activity is defined as the amount of enzyme hydrolyzing 1 μmol of ATC in 1 min.

Characterization of Purified SgAChE1

Enzyme stability was examined by measuring residual activity after SgAChE1 had been incubated at various pH or temperature conditions. Apparent molecular mass of SgAChE1 was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by silver staining. Size of native r-SgAChE1 was also determined by gel filtration chromatography on HPLC columns equilibrated in different buffers. N-linked glycosylation was detected by treating SgAChE1 with 1 × glycoproteindenaturing buffer at 100°C for 10 min. After one-tenth volume each of 10 × G7 buffer and 10% Nonidet P-40 were added, the SgAChE1 was incubated with 2.5 μL PNGase F (Sigma) at 37°C for 1 h. The reaction mixture, as well as untreated control, was treated with 1 × SDS sample buffer containing dithiothretol for 5 min at 95°C. After SDS-PAGE and electrotransfer, the protein was detected by immunoblot analysis using an anti-(His)₅ monoclonal antibody (Qiagen).

Kinetics of Substrate Hydrolysis

The purified SgAChE1 (76.1 μg/mL) was diluted 1:300 (for ATC and AβMTC), 1:225 (for PTC), and 1:120 (for BTC), and aliquots of the diluted enzyme (20 μL) were separately reacted with the substrates (80 μL) at various concentrations. Substrate hydrolysis was monitored at room temperature for 2 min as described earlier. The velocity data (mOD/min) were converted to specific AChE activity (μmol/min/mg protein) as follows: (mOD/min × 5 × enzyme dilution factor)/(1.36 × 10⁴ M⁻¹ cm⁻¹ × 0.30 cm × [E_t]), where [E_t] = 0.0761 mg/mL. The Michaelis constant (K_M) and maximum velocity (V_max) for each substrate were determined by fitting the specific AChE activity (ν) and substrate concentration ([S]) data to ν = V_max[S]/(K_M + [S]) using Prism 3.0 (GraphPad Software, La Jolla, CA).

Determination of IC₅₀’s and Inhibitory Kinetic Constants (K_d, k₂, and k_i)

The purified SgAChE1 (76.1 μg/mL) was diluted 1:100, and aliquots of the diluted enzyme (10 μL) were separately incubated with an equal volume of BW284C51, carbaryl, eserine, ethopropazine, malaoxon, or paraoxon at various concentrations for 5.0 min at room temperature. The residual enzyme activity (percentage of the control) was determined by the microplate reader assay and plotted against −log₁₀[I]. IC₅₀ for each inhibitor was obtained by nonlinear regression analysis of ν and log₁₀[I] data using the sigmoidal dose–response equation (Prism 3.0).

Dissociation equilibrium constant (K_d), unimolecular rate constant (k₂), and bimolecular reaction constant (k_i = k₂/K_d) for SgAChE1 inhibition were determined according to Hart and O’Brien [19]. Aliquots of the diluted enzyme (0.761 ng/μL, 10 μL) were individually added to 80 μL ATC–DTNB premixed with 10 μL carbaryl, eserine, malaoxon, or paraoxon at different concentrations. Absorbance at 405 nm was monitored immediately for 5 min on the microplate reader. k was calculated by fitting the A₄₀₅ nm and t data to one-phase exponential association equation: A = A_∞(1 − e^−kt). Then, 1/k and 1/[I] values were plotted and analyzed by linear regression [20]: 1/k₂ is the intercept on 1/k axis, whereas K_d is calculated from the intercept on 1/[I] axis, i.e. −K_M/K_d(K_M + [S]), where [S] and K_M are for ATC.

RESULTS

To produce SgAChE1 for functional studies, we amplified a cDNA fragment coding for its catalytic domain and inserted the 1.7 kb EcoRI-XhoI fragment into the same sites in pMFH₆. DNA sequence analysis showed that the insert was identical to the template, except for truncated parts encoding the signal peptide (M¹ to G¹⁷), proregion (L¹⁸ to T⁹⁷), and membrane-anchoring region (I⁶⁶¹ to M⁶⁷⁶) [14]. The catalytic domain was correctly fused with the honeybee mellitin signal peptide and carboxyl-terminal affinity tag encoded by the vector [15]. According to our design, r-SgAChE1 should be secreted into the medium as a soluble protein with the following sequence: G¹IPSDDPL…TKTNVLEHHHHHH⁵⁷³, in which the underlined portion is identical to residues S⁹⁸ through V⁶⁵⁹ of S. graminum pre-pro-AChE1.

Using SgAChE1/pMFH₆, we generated a recombinant baculovirus that infected Sf9 cells and expressed the soluble enzyme. Under optimal conditions, SgAChE1 reached 4.0 μg/mL and 0.92 U/mL in the culture medium (Table 1). We applied the supernatant (900 mL) onto a DS-Sepharose column, removed medium components and DNA, and eluted proteins with a high salt buffer. In this capture/enrichment step, 30% of the total protein (323 mg) was eliminated and, due to the loss of SgAChE1, the specific activity of eluted proteins only increased 10%. Now that binding of SgAChE1 to Ni-NTA agarose was no longer interfered by medium components or nucleic acids, the enzyme strongly associated with beads in the presence of 30 mM imidazole while other proteins did not bind. In this step, the specific activity of SgAChE1 increased 85 times from 2.86 U/mg to 245 U/mg and the activity recovery was 85% (Table 1). As demonstrated by 10% SDS-PAGE and silver staining (Figure 1), the enzyme was close to homogeneity after the affinity purification.

TABLE 1.

Purification of r-SgAChE1

		Protein		Enzyme		Activity		Yield		Purification
Step	Volume (mL)	Concentration (mg/mL)	Amount (mg)	Concentration (μg/mL)	Amount (mg)	Specific ($\mathcal{U}$/mL)	Total ($\mathcal{U}$)	Enzyme (%)	Activity (%)	Enzyme (fold)	Activity (fold)
Medium	900	0.359	323	4.0	3.60	0.92	827	100	100	1	1
DS	200	1.135	227	13.5	2.70	3.25	649	75	79	1.11	1.15
Ni-NTA	30	0.076	2.28	76.1	2.28	18.6	557	63	67	92.5	98.4

FIGURE 1.

Separation of r-SgAChE1 samples by 10% SDS-PAGE followed by silver staining and immunoblot detection. The culture supernatant (lane 1) and proteins eluted from dextran sulfate-Sepharose (lane 2) and Ni-NTA agarose (lane 3) columns were denatured and resolved by electrophoresis under reducing condition. Upper panel: silver staining; lower panel: immunoblot analysis using anti-(His)₅ monoclonal antibodies. Sizes and positions of the marker proteins are indicated on the left.

The purified protein migrated as a broad band at around 70 kDa by 6.5% SDS-PAGE in the presence of dithiothreitol (Figure 2A). Under nonreducing conditions, most of SgAChE1 moved to 125–135 kDa position, suggesting the protein was a homodimer linked by an interchain disulfide bond. This is consistent with the calculated molecular mass (64,597 Da) and orphan Cys⁵⁵⁴ on the protein surface (modeling data not shown). The M_r augmentation and band broadening were caused by posttranslational modification: N-glycosidase F treatment increased the mobility and band sharpness of SgAChE1 (Figure 2B). This result agreed with the prediction that SgAChE1 is glycosylated at Asn²⁰⁰, Asn²⁷⁹, Asn⁴⁸⁸, and Asn⁵¹⁸. No change was observed after O-glycosidase treatment (data not shown).

FIGURE 2.

Apparent M_r and N-linked glycosylation of SgAChE1 determined by SDS-PAGE. (A) The purified SgAChE1 (0.76 μg) was treated with SDS sample buffer with (right-hand panel) or without (left-hand panel) dithiothreitol (DTT), separated by 6.5% SDS-PAGE, and visualized by silver staining. (B) The protein (0.5 μg) was treated with buffer (lane 1) or PNGase F (lanes 2), separated by 6.5% SDS-PAGE under reducing condition, and detected by monoclonal antibodies against the hexahistidine tag. Sizes and positions of the molecular weight markers are indicated on the right-hand side.

To determine the association status of native r-SgAChE1, we loaded the purified protein onto an HPLC gel filtration column equilibrated in phosphate buffer. The enzyme eluted as a major peak at around 250 kDa (elution time: 9.03 min) and two minor peaks at 135 kDa (9.92 min) and 90 kDa (10.50 min) (Figure 3). When SgAChE1 was loaded on another column equilibrated in Tris–HCl buffer, it came off the column as a single peak at around 145 kDa (elution volume: 12.40 mL). Together, these results suggested that the recombinant enzyme existed as a dimer, which may further associate to form a tetramer. The association states of SgAChE1 were apparently affected by buffer composition, ionic strength, and/or column matrix.

FIGURE 3.

Association of r-SgAChE1 determined by HPLC gel filtration chromatography. (A) The enzyme (60 μg) was loaded onto a Bio-Silect SEC250-5 column (Bio-Rad, Hercules, CA) equilibrated with 150 mM NaCl, 100 mM sodium phosphate (pH 7.4). The column was calibrated with a mixture of five molecular weight standards: thyroglobulin, bovine γ-globulin, chicken ovalbumin, equine myoglobin, and vitamin B12. Their sizes and elution times were 670 kDa, 7.50 min; 158 kDa, 9.97 min; 44 kDa, 11.28 min; 17 kDa, 12.98 min; 1.35 kDa, 15.13 min, respectively. The activity in the fractions (O—O) was measured and plotted along with absorbance at 214 nm (—) on the chromatograph. (B) The protein was also separated on a Superdex S-200 analytical column (GE Healthcare Life Sci., Piscataway, NJ) equilibrated with 20 mM Tris–HCl, pH 8.0, 0.5 M NaCl, 10% glycerol. The column was calibrated by the same molecular standards whose elution volumes were 9.34, 12.37, 15.00, 16.65, and 19.99 min.

The recombinant enzyme was relatively stable at a slightly acidic condition: more than 90% of the activity remained at pH 4.0–7.5 after 4 h and at pH 4.5–7.0 after 24 h (Figure 4). Unlike SgAChE isolated from the greenbug, which became completely inactive after storage at 4°C for a few days (Zhu et al., 1999), the r-SgAChE1 stabilized at a lower level (115 U/mg) and did not experience further activity loss after 2–3 weeks at 4°C, or after 3 years at −70°C. The protein was heat sensitive: about 1/3 and 1/2 of the hydrolytic activity was lost after 15-min incubation at 30°C and 35°C, respectively. Because 90% of the activity remained at temperatures below 26°C, we conducted kinetic analyses at pH 7.0 and ambient temperature (22–25°C).

FIGURE 4.

Stability of r-SgAChE1 at different pHs and temperatures. The purified enzyme (15.2 ng) was incubated at 4°C with 0.1 M phosphate buffers at various pHs for 1 (●—-●) and 24 (□—□) h prior to the activity measurement. Similarly, r-SgAChE1 (15.2 ng) in pH 7.0, 0.1 M phosphate buffer was incubated at various temperatures (●—●) for 15 min and subjected to the enzyme assay. The residual activities (mean ± SEM, n = 2) were plotted against pH (upper panel) and temperature (lower panel).

To characterize the enzymatic properties of r-SgAChE1, we determined its K_M and V_max against four acylthiocholine substrates: ATC, AβMTC, PTC, and BTC. In the range of substrate concentrations used, the reactions generally followed Michaelis–Menten kinetics (data not shown). The apparent K_M values suggested that SgAChE1 had a higher affinity toward ATC than AβMTC or BTC (Table 2). The rate of ATC hydrolysis was significantly greater than that of PTC or BTC. The ratios of V_max and K_M, representing the overall catalytic efficiency, are in the following order: ATC >PTC > AβMTC ≫ BTC.

TABLE 2.

Kinetic Parameters of r-SgAChE1

Substrate	KM (μM)	Vmax ($\mathcal{U}$/mg Protein)	V max /K M	kcat × 10−3 (min−1)a
ATC	88.3 ± 9.6	133.2 ± 1.6	1.50	8.60 ± 0.11
AβMTC	113.9 ± 12.5	106.4 ± 3.0	0.91	6.88 ± 0.20
PTC	68.9 ± 7.8	76.7 ± 1.0	1.09	4.95 ± 0.07
BTC	201.1 ± 21.0	4.4 ± 0.1	0.02	0.53 ± 0.01

^aTurnover rate (k_cat) was calculated based on the molecular mass (64,597 Da) and maximum velocity (V_max) of r-SgAChE1.

The preferential binding of substrates with different acyl or leaving groups by SgAChE1 was also reflected by its interaction with different inhibitors (Figure 5). The enzyme was efficiently blocked by paraoxon and malaoxon at an IC₅₀ of 16 ± 4 and 61 ± 4 nM, respectively (Table 3). The IC₅₀ for eserine, carbaryl, and BW284C51 was 0.20, 0.94, and 1.66 μM, respectively. In contrast, the IC₅₀ for ethopropazine, a relatively selective inhibitor of butyrylcholinesterase (EC 3.1.1.7), was markedly higher (102 μM).

FIGURE 5.

Effect of inhibitor concentrations on r-SgAChE1 activity. Aliquots of diluted enzymes were separately incubated with the inhibitors at various concentrations for 5 min at room temperature. The residual activities (mean ± SEM, n = 4) were measured and plotted against −log₁₀[I], where [I] is the inhibitor in molar. The concentration-dependent curves were calculated based on nonlinear regression analysis using the sigmoidal dose–response equation.

TABLE 3.

Concentrations for 50% Inhibition of r-SgAChE1

Compound (Mr)	IC50 (μM)
Carbaryl (201.22)	0.940 ± 0.005
Eserine (324.4)	0.199 ± 0.004
BW284C51 (566.4)	1.660 ± 0.002
Ethopropazine (348.9)	102.2 ± 0.001
Paraoxon (275.2)	0.061 ± 0.004
Malaoxon (314.29)	0.016 ± 0.004

To further characterize the inhibition of SgAChE1, we determined the kinetic parameters for carbaryl, eserine, paraoxon, and malaoxon (Figure 6 and Table 4). The dissociation constant (K_d) indicated that paraoxon (3.12 ± 0.34 μM) or malaoxon (3.4 ± 0.1 μM) bound SgAChE1 much stronger than carbaryl (15.6 ± 2.9 μM) or eserine (16.0 ± 0.5 μM) did. Because the noncovalent paraoxon–SgAChE1 complex converted to phosphorylated enzyme at a higher rate (k₂: 2.76 min⁻¹) than the malaoxon–SgAChE1 complex did (k₂: 1.59 min⁻¹), paraoxon (k_i: 9.06 ± 0.23 × 10⁵ M⁻¹ min⁻¹) was more potent than malaoxon (4.70 ± 0.13 × 10⁵ M⁻¹ min⁻¹) as well as the other inhibitors tested. The carbamylation of SgAChE1 by eserine and carbaryl occurred at 99% and 62% the rate of phosphorylation by malaoxon, respectively. Eserine had a k_i of 1.00 ± 0.16 × 10⁵ M⁻¹ min⁻¹, higher than that of carbaryl ((0.65 ± 0.04) × 10⁵).

FIGURE 6.

Determination of K_d and k₂ values of four inhibitors against r-SgAChE1. Aliquots of the diluted enzyme (0.761 ng/μL, 10 μL) were individually added to 80 μL ATC-DTNB premixed with 10 μL carbaryl, eserine, malaoxon, or paraoxon at different concentrations. Absorbance at 405 nm was monitored immediately on the microplate reader at 15-s intervals for 5 min, and the readings were used to derive ks by curve fitting [A = A_∞(1 − e^−kt)]. Then, 1/k (mean ± SEM, n = 4) and 1/[I] values were plotted and analyzed by linear regression as described in the Materials and Methods section.

TABLE 4.

Inhibition Constants of the Compounds

Compound	Kd (×105 M)	ki (×10−5 M−1 min−1)	k2 (min−1)	r 2	P value
Carbaryl	1.56 ± 0.29	0.65 ± 0.04	0.99 ± 0.01	0.990	<0.0001
Eserine	1.60 ± 0.05	1.00 ± 0.16	1.58 ± 0.04	0.999	<0.0001
Malaoxon	0.34 ± 0.01	4.70 ± 0.13	1.59 ± 0.02	0.996	<0.0001
Paraoxon	0.31 ± 0.03	9.06 ± 0.23	2.76 ± 0.25	0.998	<0.0001

Similar to AChE isolated from S. graminum [13], the enzymatic activity of r-SgAChE1 was inhibited in the presence of ATC concentrations above 10 mM (Figure 7A). While substrate inhibition has been commonly observed in insect AChEs, we tested whether acetate or choline (products of acetylcholine hydrolysis) could cause a similar decrease. The hydrolytic activity was not much influenced by acetate in the range from 1 μM to 100 mM (data not shown). In contrast, r-SgAChE1 was significantly affected by choline (Figure 7B): the activity gradually increased from 100% at 0.1 mM to around 120% at 10–20 mM, but then decreased to 40% at 200 mM.

FIGURE 7.

Effect of ATC (A) and choline (B) on the hydrolytic activity of r-SgAChE1. (A) The purified enzyme (76.1 ng/μL) was 1:200 diluted with 100 mM sodium phosphate, pH 7.0, and 20 μL aliquots were incubated with 80 μL, 60 μM DTNB containing different amounts of ATC. The rates of absorbance change were measured and plotted against final concentrations of ATC. (B) Aliquots of the diluted enzyme (0.761 ng/μL, 10 μL) were separately incubated with choline chloride at various concentrations for 10 min at room temperature for 10 min. The enzyme activities (%) were measured and plotted against choline concentrations. Each point represents the mean ± SEM (n = 4).

DISCUSSION

As genome and cDNA sequences are available for several important disease vectors and agricultural pests, recombinant expression of insect genes or cDNAs becomes increasingly useful for structural and functional characterization of their protein products. In this study, we produced SgAChE1 catalytic domain in a soluble, secreted form separated from a vast majority of cellular proteins. Although the protein level was fairly low (4.0 mg/L), cation exchange and nickel affinity chromatography efficiently removed 99.3% of the total protein and yielded 2.28 mg highly purified SgAChE1 from 900 mL culture medium (Table 1). It would take 1.1 kg of greenbugs to isolate the same amount (557 U) of SgAChE, whose specific activity (119 U/mg) was 50% lower than that of fresh r-SgAChE1 (245 U/mg) [13]. It is widely known that insect AChEs are less active than mammalian ones. The highest specific activity reported so far is from D. melanogaster (1350 U/mg), lower than the human erythrocyte AChE (5850 U/mg) [21].

Baculovirus-insect cell expression systems have been used to generate AChEs from various insects, including D. melanogaster [22], Aedes aegypti [23], Musca domestica [24], Lucilia cuprina [25], and Leptinotarsa decemlineata [2]. In most cases, the crude enzymes were directly used to study the effect of mutations on their kinetic properties. The recombinant Drosophila AChE was the only one that had been purified to homogeneity for crystal structure elucidation [26]. No other structure of insect AChEs has been reported, probably due to the low expression levels and/or technical difficulties in purifying and crystallizing these enzymes. The system we used took advantage of the efficient honeybee signal peptide and strong affinity binding of SgAChE1 to Ni-NTA agarose. Even though the expression level was rather low, it holds promise to provide a sufficient amount of highly purified enzymes for crystallization studies.

In comparison to SgAChE purified from the greenbug [13], the catalytic domain (i.e., r-SgAChE1) had higher V_maxs (i.e., maximum velocity) against the same series of substrates (1.7-fold for ATC, 1.6-fold for AβMTC, 2.0-fold for PTC, and 1.9-fold for BTC). While the increase in specific activity accounted for a large part, we also observed higher K_Ms (1.53-fold for ATC, 1.88-fold for AβMTC, 2.20-fold for PTC, and 6.02-fold for BTC). The K_M increases revealed a possible decrease in enzyme–substrate association (k₁/k₋₁) and/or an increase in deacylation (k₂) of acyl–enzyme complexes. In addition, possible contamination of SgAChE2 in the SgAChE preparation could also affect the apparent K_M values.

Because K_M values of an enzyme, to a certain extent, reflected its binding affinity to different substrates, this may explain why a close mimic of the endogenous substrate, ATC, had a lower K_M (88.3 ± 9.6 μM) than AβMTC (113.9 ± 12.5 μM) or BTC (201.1 ± 21.0 μM) (Table 2). However, it is unclear why PTC had the lowest K_M toward r-SgAChE1 (68.9 ± 7.8 μM) and SgAChE (31.3 ± 3.7 μM). The purified r-SgAChE1, with its membrane-anchoring region removed, may be difficult to self-associate, and proper association is needed for allosteric regulation of AChEs. For instance, Drosophila AChE activity was stimulated and suppressed by ATC at low and high concentrations, respectively [27].

IC₅₀ values indicated that r-SgAChE1 was inhibited by the selected compounds in the following order: paraoxon (16 nM) > malaoxon (61 nM) > eserine (0.20 μM) > carbaryl (0.94 μM) > BW284C51 (1.66 μM) ≫ ethopropazine (102 μM). Gao and Zhu [13] previously reported that BW284C51 was a more effective inhibitor than eserine (0.14 vs. 0.48 μM, respectively) against SgAChE. Different composition or associations of the SgAChE preparation may have contributed to this relative difference in inhibitory potency. Our rank order of IC₅₀s is supported by k_i values (Table 4): paraoxon (0.906 ± 0.023 μM⁻¹ min⁻¹) > malaoxon (0.470 ± 0.013 μM⁻¹ min⁻¹) > eserine (0.100 ± 0.016 μM⁻¹ min⁻¹) > carbaryl (0.065 ± 0.004 μM⁻¹ min⁻¹) > BW284C51 > ethopropazine. (Note that limited by their K_d and solubility, we were not able to accurately determine the kinetic constants of BW284C51 and ethopropazine.)

It is frequently observed that insect AChE activity decreases at high substrate concentrations. While this decrease has not been reported to be significant until ATC reaches about 20 mM [13], we wondered whether the apparent reduction in activity could be caused by the reduced concentration of DTNB in the assay: color developed even in the absence of enzyme, suggesting that spontaneous hydrolysis of ATC at high concentrations produced a significant amount of thiocholine that consumes the chromogenic reagent. On the other hand, since product inhibition is a common mechanism of enzyme activity regulation, we tested the effect of choline or acetate on r-SgAChE1 and found that high concentrations of choline do indeed impact the enzymatic activity. The relative contributions of acetylcholine and choline to the activity decrease remains unclear. Neither is it clear which anionic site (i.e., active center or peripheral) choline binds to affect the enzyme structure and function.

In summary, we used the baculovirus–insect cell system to express the catalytic domain of S. graminum AChE1, a paralog of D. melanogaster AChE. The recombinant protein was purified to near homogeneity by a simple method. Biochemical characterization and kinetic analysis revealed features similar to those of native SgAChE isolated from the greenbug. Some qualitative differences were also observed between the recombinant and natural proteins. For the first time, we showed that choline, a product of acetylcholine hydrolysis, may play a role in the regulation of SgAChE1.