Frequent transcriptional inactivation of Kallikrein 10 gene by CpG island hypermethylation in non‐small cell lung cancer

Youwei Zhang; Haizhu Song; Yufeng Miao; Rui Wang; Longbang Chen

doi:10.1111/j.1349-7006.2009.01486.x

. 2011 Jan 25;101(4):934–940. doi: 10.1111/j.1349-7006.2009.01486.x

Frequent transcriptional inactivation of Kallikrein 10 gene by CpG island hypermethylation in non‐small cell lung cancer

Youwei Zhang ¹, Haizhu Song ¹, Yufeng Miao ¹, Rui Wang ¹, Longbang Chen ^✉

PMCID: PMC11158746 PMID: 20180809

Abstract

The role of Kallikrein 10 gene (KLK10) in non‐small cell lung cancer (NSCLC) remains largely unknown. We determined the frequency and functional significance of KLK10 hypermethylation in NSCLC. The mRNA expression and methylation status of KLK10 in 78 pairs NSCLC specimens was explored. The biological effects of KLK10 were analyzed by transfection. The results showed that, KLK10 was significantly downregulated in NSCLC (57.7%, 45/78) as compared to non‐cancer samples (P = 0.010). CpG island hypermethylation of KLK10 was detected in 46.2% (36/78) NSCLC tissues and was closely correlated with loss of transcript (P < 0.001). KLK10 methylation was associated with advanced stage (P = 0.013) and lymph metastasis (P = 0.015). Furthermore, demethylation treatment restored the expression of KLK10 in two lung adencarcinoma cell lines (A549, SPC‐A1). Forced expression of KLK10 in A549 and SPC‐A1 remarkably suppressed cells proliferation, migration in vitro and oncogenicity in vivo. Additionally, methylated KLK10 was detected in 38.7% (30/78) of plasma samples from cancer patients but rare in cancer‐free controls (P < 0.001). In conclusion, KLK10 acts as a functional tumor suppressor gene in NSCLC, epigenetic inactivation of KLK10 is a common event contributing to NSCLC pathogenesis and may be used as a potential biomarker.

(Cancer Sci 2010; 101: 934–940)

Lung cancer is the leading cause of cancer‐related deaths in the world.⁽ ¹ ⁾ Non‐small cell lung cancer (NSCLC) comprises the majority of lung cancer and has an increasing incidence and mortality in the last two decades in China. It has been widely accepted that lung carcinogenesis is a multi‐step process and the inactivation of multiple tumor suppressor genes (TSGs) plays significant roles in tumor initiation and progression.⁽ ² ⁾ Besides genetic alterations, evidence has emerged that epigenetic changes, especially the DNA methylation of 5′‐CpG islands can lead to the inactivation of TSGs in human malignant tumors including NSCLC.⁽ ³ ⁾ Since the frequency and timing of these epigenetic changes, aberrant methylation events provide one of the most promising markers for molecular detection. In NSCLC, epigenetic silencing of TSGs has been reported frequently, including APC, CDH13, DAPK, MGMT, MLH1, p14^ARF, p16^INK4A, RARβ and RASSF1A in various percentages.⁽ ⁴ , ⁵ ⁾ It is important to identify new TSGs that are silenced by tumor‐specific methylation in NSCLC, which could serve as valuable biomarkers and also provide clues to the molecular pathogenesis of the tumor.

Kallikrein 10 gene (KLK10), also known as normal epithelial cell specific gene 1 (NES1), is a member of the human tissue kallikrein (hKs) family of secreted serine proteases, encoded by a family of 15 genes clustered in tandem on chromosome 19q13.3‐4.⁽ ⁶ ⁾ KLK10 was first identified by subtractive hybridization between normal and radiation‐transformed mammary epithelial cell lines and further studies showed it downregulated in breast cancers.⁽ ⁷ ⁾ It has been suggested that KLK10 may function as a tumor suppressor gene since it negatively regulated tumor growth both in vitro and in vivo.⁽ ⁸ ⁾ The sequence analysis revealed that KLK10 gene promoter was not CpG rich while exon 3 was found to be CpG rich and satisfied the formal criteria for CpG islands.⁽ ⁹ ⁾ Subsequently, exon 3 methylation as a basis for tumor‐specific loss of KLK10 expression has been found in breast, ovarian, prostate, gastric and hepatocellular cancers,⁽ ⁹ , ¹⁰ , ¹¹ , ¹² ⁾ and KLK10 hepermethylation may be a useful prognostic indicator of disease progression.⁽ ¹³ ⁾ As for NSCLC, the role of KLK10 has not been fully elucidated, although Planque et al. ⁽ ¹⁴ ⁾ reported that KLK10 was slightly higher expression in non‐tumoral tissue compared to paired NSCLC tissue.

In the present study, we first determined the expression level and methylation status of KLK10 in 78 pairs of NSCLC and corresponding non‐cancer tissues. Secondly, we explored the functional significance of methylation‐induced silencing of KLK10 gene in NSCLC cell lines. The potential use of detecting methylated KLK10 in plasma DNA as a biomarker for NSCLC was further evaluated.

Materials and Methods

Study population. A total of 78 paired primary NSCLC specimens and their adjacent normal tissues, 25 no‐cancer lung tissues from patients with benign pulmonary diseases were obtained in Departments of Cardiothoracic Surgery, Jinling Hospital from November 2007 to June 2008. All specimens were immediately snapped frozen in liquid nitrogen and stored at −80°C until use. Meanwhile, plasma samples were collected from the same cancer patients and 50 controls of benign pulmonary diseases or healthy donors. The age of the patients ranged from 35 to 80, with a median 59 and the average 60.3, and the numbers of them in stage I, II, III, IV were 22, 33, 19, 1 (brain metastases), respectively. None received preoperative chemotherapy or radiation therapy. All diagnoses were based on pathological and/or cytological evidence. Histological classification was conducted according to the 1999 “Histological typing of lung and pleural tumors: third edition” of the WHO, and tumor stage was determined according to the 2003 TNM staging guideline suggested by the American Joint Committee on Cancer (AJCC) and the Union Internationale Contre le Cancer (UICC). Ethical approval was obtained from the hospital and fully informed consent from all patients prior to sample collection.

Cell lines and drug treatment. Two lung adencarcinoma cell lines (A549, SPC‐A1) were obtained from Shanghai Institute of Cell Biology, Chinese Academy of Sciences. Cells were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) at 5% CO₂, 37°C, and 95% humidity. For treatment with 5‐aza‐2′‐deoxycytidine (5‐Aza‐dC, Sigma, St. Louis, MO, USA), cells were seeded at a density of 5 × 10⁵ cells per T25 flask, cultured overnight and then treated with 10 μm 5‐Aza‐dC for 3 days. Cell culture medium was changed every 24 h. Subsequently, cells were harvested and DNA and RNA extracted for further analysis.

Reverse transcription, polymerase chain reaction (RT–PCR) and Quantitative real‐time PCR. Total RNA was extracted using Trizol reagent (Invitrogen). Reverse transcription reaction was performed using 2 μg of total RNA with a first strand cDNA kit (Takara, Shiga, Japan), according to the manufacturer’s instructions. Polymerase chain reaction was run in a 25 μL volume containing 2 μL of cDNA template, 10× Buffer, 0.15 mm dNTP, 0.1 mm each primer and 0.5U of Ex Taq Hot Start Version (Takara). The primer sequences⁽ ⁷ ⁾ are shown in Table 1. The final products were identified in 2% agarose gel and stained with ethidium bromide. Quantitative real‐time PCR was performed in ABI 7300 Thermocycler (Applied Biosystems, Foster City, CA, USA), using the SYBR Premix Ex Taq kit (Takara). Data analysis was done using the 2^−ΔΔCT method for relative quantification,⁽ ¹⁵ ⁾ and all samples were normalized to GAPDH, which was used as an endogenous control.

Table 1.

List of primer sequences

Primer	Sequence (5′–3′)	Product size	TM
KLK10 (ORF)	f: GATCTCGAGATGGAGGTACATGAAGAGCA	1008 bp	55°C
KLK10 (ORF)	r: GGATCTAGAAATAACGTATACGCCCTCCT	1008 bp	55°C
KLK10 (M)	f: TTCGAAGTTTATGGCGTTTC	137 bp	60°C
KLK10 (M)	r: TTATTTCCGCAATACGCGAC	137 bp	60°C
KLK10 (U)	f: TTGTAGAGGTGGTGTTGTTT	128 bp	60°C
KLK10 (U)	r: CACACAATAAAACAAAAAACCA	128 bp	60°C
KLK10 (RT‐PCR)	f: CTCGAGTAGGGGATGATCACCT	759 bp	55°C
KLK10 (RT‐PCR)	r: GCTTCAGTACAGGCAGAGAA	759 bp	55°C
KLK10 (qPCR)	f: ACTGCGGAAACAAGCCACT	115 bp	60°C
KLK10 (qPCR)	r: CCCTGGTGGTACTTGGGAT	115 bp	60°C
GAPDH	f: CAATGACCCCTTCATTGACC	135 bp	55°C
GAPDH	r: TGGAAGATGGTGATGGGATT	135 bp	55°C

Open in a new tab

ORF, open‐reading frame; M, methylated; U, unmethylated; f, forward; r, reverse.

Bisulphite treatment of DNA, methylation‐specific polymerase chain reaction (MSP). Genomic DNA from tissue, cell and plasma was extracted using QIAamp DNA Mini Kit and QIAamp Blood Mini Kit (Qiagen, Hilden, Germany), respectively. After spectrophotometric quantization, 1 μg of Genomic DNA was bisulphite‐treated with EZ‐DNA methylation Gold Kit (Zymo Research, Orange, CA, USA), and final resuspended in 10 μL of TE buffer. For the plasma DNA, all of the 50 μL eluted DNA from the extraction step was bisulphite‐treated. PCR mixture system performed refers to above. Primers of methylated and unmethylated KLK10⁽ ⁸ ⁾ are listed in Table 1. Lymphocyte DNA, original or methylated in vitro by excessive CpG (SssI) methylase (New England Biolabs, Beverly, MA, USA) following the manufacturer’s directions, was used as unmethylation and methylation positive control. Water blank was used as a negative control.

Construction of pEGFP‐KLK10 recombinant vector and transfection. The 1.0 kb KLK10 open‐reading frame (ORF) was cloned into the pEGFP‐C1 vector (Invitrogen) to generate the pEGFP‐KLK10 recombinant vector. RT‐PCR was carried out using normal human testis RNA (BD Biosciences, Palo Alto, CA, USA) as template. After incubation with XhoI and XbaI, the PCR product was inserted into the enzyme‐digest site of pEGFP‐C1 vector. Then the recombinant vector was transfected into A549 and SPC‐A1 cell lines through Lipofectamine 2000 (Invitrogen). G418 (600 μg/mL, Sigma) was used to screen the stably transfected cells.

Western blotting. Cell lysates were made with standard methods, then 20 μg of protein samples were separated by 5% SDS‐PAGE, and transferred to polyvinylidene fluoride (PVDF). After blocked with a buffer containing 5% low fat milk and 0.1% Tween‐20 in Tris‐buffered saline (TBST), the membrane was incubated with the primary antibody (mouse anti‐human‐KLK10 monoclonal antibody; BD Biosciences, Palo Alto, CA, USA) and second antibody (bovine anti‐mouse IgG; Santa Cruz, CA, USA). Finally, results were photographed with ECL substrate.

Colony formation assay. One thousand cells were seeded into six‐well plates with 2 mL culture medium. After cultured in RPMI 1640 media supplement with 10% FBS at 37°C and 5% CO₂ for 2 weeks, cells were washed twice with PBS, stained with Giemsa, and colonies containing >50 cells were counted. The cloning efficiency (%) = (the number of clones/the number of seed cells) × 100%.

In vivo tumorigenicity. Forty male BALB/c nude mice aged 6–8 weeks were purchased from the Animal Laboratory Unit of Jinling Hospital. The mice were maintained under standard conditions and cared for according to the institutional guidelines for animal care. A549 and SPC‐A1 cells stably transfected with pEGFP‐KLK10 recombinant vector or the empty vector were harvested and counted, then 2 × 10⁶ viable cells were injected subcutaneously into the dorsal flank of nude mice (ten per group). The time interval of tumor occurrence and the dimension of the tumor were recorded every 3 days until the end of week 4. The animal study protocol was approved by the Animal Experimentation Ethics Committee of the Jinling Hospital.

Wound‐healing assay. Culture cells were grown to confluent monolayer in six‐well plates using RPMI 1640 containing 10% FBS. Then the medium was replaced with FBS‐free media, and the monolayer cells were wounded with 200 μL tip. At the indicated times (0, 24, and 48 h) after scraping, the cells were washed twice in PBS, and the migration of cells into the wound zone was observed at ×100 magnification. The uncovered area was analyzed using Image‐pro Plus 5.0 software (Media Cybernetics, Silver Spring, MD, USA).

Statistical analysis. The results were expressed as mean ± SD or percentage where appropriate. Experimental differences were tested by SPSS 12.0 (SPSS Inc., Chicago, IL, USA) using the 2‐tailed t‐test or Chi‐square. P < 0.05 was taken as statistical significance.

Results

Gene silencing and methylation status of KLK10 in NSCLC specimens. We first determined KLK10 expression in 78 pairs of NSCLC tissues by RT‐PCR (Fig. 1A) and quantitative real‐time PCR (Fig. 1B). The results showed that, 45 cases (57.7%) was detected a marked downregulation of KLK10 in NSCLC specimens, compared to adjacent normal tissues and benign control lung lesions (P = 0.010).

To investigate the role of CpG island methylation in silencing of KLK10 in NSCLC, the methylation status of KLK10 exon 3 was analyzed by MSP. We found 46.2% (36/78) of NSCLC specimens had KLK10 hypermethylation, which was significantly higher than that of adjacent normal tissues (6.4%, 5/78) (P < 0.001) (Fig. 2A). Notably, aberrant methylation of KLK10 was not detected in lung lesions from 25 benign controls. Furthermore, of the 36 methylated NSCLC tissue samples, 31 cases showed loss or downregulation of KLK10 expression, in contrast, 28 of the 42 unmethylated NSCLC specimens showed upregulation or no difference of KLK10 expression versus matched normal lung tissue. Thus, the transcriptional inactivation of KLK10 gene in NSCLC was significantly correlated with the methylation status of KLK10 exon 3 (P < 0.001).

Methylation status of KLK10 gene in matched tumor tissues and plasma samples of NSCLC patients. (A) Typical agarose gel electrophoresis of MSP results in tissue samples. T, NSCLC tumor; N, adjacent normal lung tissues (patients 32, 34, 38–40). KLK10 showed an aberrant methylation in tumor tissues of #32, #34, #38, #39 and normal tissue of #32. (B) Typical agarose gel electrophoresis of MSP results in plasma samples. KLK10 methylation status in plasma samples was in accordance with corresponding tumor tissues (patients 32, 34, 38–40). The benign control, B1 was a 68‐year‐old man diagnosed to have tuberculosis and showed KLK10 unmethylation in plasma. Lymphocyte DNA, original or methylated *in vitro* by excessive CpG (SssI) methylase, was used as unmethylation and methylation positive control. Water blank was used as a negative control.

Restoration of KLK10 expression by 5‐Aza‐dC treatment in NSCLC cell lines. As shown in Figure 3, KLK10 was silenced in two human lung adencarcinoma cell lines (A549 and SPC‐A1), and KLK10 methylation was detected in the two cell lines with silenced expression. To confirm that CpG methylation is indeed responsible for the silencing of KLK10, we treated these heavily methylated and silenced cell lines with 5‐Aza‐dC, a methyltransferase inhibitor. KLK10 expression was markedly induced after the treatment in the two cell lines (Fig. 3). These results demonstrate that CpG methylation directly contributes to the silencing of KLK10 in NSCLC cells.

Restoration of KLK10 expression by 5‐Aza‐dC treatment in NSCLC cell lines. KLK10 was hypermethylated and silenced in two human lung adencarcinoma cell lines (A549 and SPC‐A1). After treatment with 10 μm of 5‐Aza‐dC, a methyltransferase inhibitor for 72 h, KLK10 expression was markedly induced in the two cell lines.

Clinicopathological correlation of KLK10 hypermethylation in NSCLC specimens. Next, we analyzed the correlation between the methylation status of KLK10 gene and clinicopathological features of NSCLC patients. As shown in Table 2, KLK10 methylation was preferentially observed in advanced pathological stage of NSCLC (22 of 58, 37.9% in I/II stage and 14 of 20, 64% in III/IV stage; P = 0.013). Moreover, KLK10 methylation was significantly more frequent in NSCLC patients with lymph node metastasis (61.8%, 21/34) than no lymph node metastasis (34.1%, 15/44; P = 0.015). However, there were no correlation with patient gender, age, histological type and smoking condition. Although methylation of KLK10 was more frequent in poor/undifferentiated (63.2%, 12/19) than that in well/moderately differentiation (40.7%, 24/59), no statistical significance was found (P = 0.087).

Table 2.

Association between the KLK10 hypermethylation in NSCLC specimens and clinicopathological features

Patients	Cases	KLK10 methylation		P‐value
Patients	Cases	Methylated	Unmethylated	P‐value
Sex
Male	58	25	33	0.357
Female	20	11	9	0.357
Age
<60	22	9	13	0.560
≥60	56	27	29	0.560
Histological type
Adenocarcinoma	30	14	16	0.603
Squamous cell carcinoma	36	18	18
Others	12	4	8
Cellular differentiation
Well/moderately	59	24	35	0.087
Poor/undifferentiated	19	12	7	0.087
Stage
I/II	58	22	36	0.013*
III/IV	20	14	6	0.013*
Lymph metastasis
Negative	44	15	29	0.015*
Positive	34	21	13	0.015*
Smoking
Yes	49	20	29	0.219
No	29	16	13	0.219

Open in a new tab

Chi‐square test, *P < 0.05.

KLK10 inhibits NSCLC cell lines proliferation in vitro and in vivo. To confirm the tumor suppressor role of KLK10, we examined the effect of KLK10 transfection on cell proliferation in vitro. KLK10 expression vector was transfected into A549 and SPC‐A1 cell line with complete methylation and silencing of KLK10. Forced expression of KLK10 in transfected A549 (pEGFP‐KLK10‐A549) and SPC‐A1 (pEGFP‐KLK10‐SPC‐A1) cells was confirmed by fluorescence and western blotting (Fig. 4). Cells proliferative viability was assayed by plate‐colony formation. As shown in Figure 5, a significant decrease in colony number and volume was observed in both transfected A549 and SPC‐A1 cells, as compared to the wild and mock transfected cells.

Exogenous expression of KLK10 in A549 and SPC‐A1 cells by transfection of recombinant vector. (A) Fluorescence photos of A549 and SPC‐A1 cells transfected with KLK10 gene (magnification ×200). The 1.0 kb KLK10 open‐reading frame was cloned into the pEGFP‐C1 vector to generate the pEGFP‐KLK10 recombinant vector. KLK10 was stable expression in transfected pEGFP‐KLK10‐A549 and pEGFP‐KLK10‐SPC‐A1 cells. (B) Protein expression of KLK10 gene in A549 and SPC‐A1 cells was examined by western blotting. Mouse anti‐human‐KLK10 monoclonal antibody diluted at 1:500. Lane 1–6 was as follows: A549, pEGFP‐A549, pEGFP‐KLK10‐A549, SPC‐A1, pEGFP‐SPC‐A1, pEGFP‐KLK10‐SPC‐A1.

Inhibition of colony formation in A549 (A) and SPC‐A1 (C) cells transfected with KLK10 gene. 1 × 10³ cells seeded into six‐well plates cultured in RPMI 1640 for 2 weeks, colonies were stained with Giemsa, counted and photographed. A significant decrease in colony number and volume was observed in transfected pEGFP‐KLK10‐A549 (B, P = 0.008) and pEGFP‐KLK10‐SPC‐A1 (D, P = 0.003) cells, compared with wild cells and empty‐vector transfected cells.

In light of the anti‐proliferative effects of KLK10 in vitro, we tested whether KLK10 would alter the growth of NSCLC cells in vivo. The tumorigenicity of A549 or SPC‐A1 cells was examined in 10 mice inoculated with either the empty vector or KLK10 expression vector. The tumor growth curves and representative examples are shown in Figure 6. The mean tumor volume was significantly smaller in KLK10‐transfected nude mice as compared to the nude mice transfected with empty vector (P < 0.001).

KLK10 inhibits growth of tumors derived from A549 and SPC‐A1 *in vivo*. 2 × 10⁶ cells transfected with pEGFP‐KLK10 recombinant vector or the empty vector were injected into nude mice (ten per group). (A) Representative picture of nude mice at week 4 injected with pEGFP‐KLK10‐A549 cells and pEGFP‐A549 cells. (C) Representative picture of nude mice at week 4 injected with pEGFP‐KLK10‐SPC‐A1 cells and pEGFP‐SPC‐A1 cells. The tumor volume of nude mice in each group was indicated as mean tumor volume ± SD(mm³). Tumor mean volume of pEGFP‐KLK10‐A549 mice (B, P < 0.001) and pEGFP‐KLK10‐SPC‐A1 (D, P < 0.001) were significantly smaller than empty‐vector mice group, respectively.

KLK10 inhibits NSCLC cell lines migration in vitro. Since KLK10 hypermethylation was seen preferentially in the cases of stage III/IV or harboring lymphatic metastasis, we supposed methylation‐mediated KLK10 expression would affect the invasion and metastasis of NSCLC cells. Cells motility was evaluated by wound‐healing assay in vitro. As shown in Figure 7, a significant decrease in cells migration was observed in both transfected A549 and SPC‐A1 cells, compared with the wild and mock transfected cells.

KLK10 inhibits cell migration in wound‐healing assay. Monolayer of wild, mock and transfected A549 (A) and SPC‐A1 (C) cells were scraped with micropipette tips and cultured in FBS‐free media. The representative picture showed repair of lesion by cell migration was photographed 48 h later (magnification ×100). The uncovered area of transfected pEGFP‐KLK10‐A549 cells (B, P < 0.001) and pEGFP‐KLK10‐SPC‐A1 (D, P < 0.001) cells were significantly greater than the wild cells and empty‐vector transfected cells, respectively.

Methylation of KLK10 in plasma samples of NSCLC patients. To further investigate whether KLK10 methylation could be used as a biomarker for NSCLC, plasma samples from NSCLC patients and non‐cancer controls were tested for methylated KLK10 DNA. A total of 30 of 78 (38.5%) plasma samples from cancer patients had KLK10 methylation whereas only 4% (2/50) was detected in the plasma of cancer‐free subjects, the difference was statistically significant (P < 0.001) (Fig. 2B). Furthermore, 29 cases showed methylated alteration both in tumor tissues and plasma samples (Fig. 2), with a sensitivity of 80.6% (29/36) and a specificity of 97.6% (41/42), there was good concordance between KLK10 methylation status in plasma samples and corresponding tumor tissues (P < 0.001) (Table 3).

Table 3.

KLK10 methylation in NSCLC plasmas was in concordance with corresponding tumor tissues

NSCLC tissues	KLK10 methylation in plasma		P‐value
NSCLC tissues	Methylation	Unmethylation	P‐value
Methylation	29	7	0.000
Unmethylation	1	41	0.000

Open in a new tab

Discussion

The kallikrein gene family has been under intensive study due to its implications in carcinogenesis and the application of many members as biomarkers for the diagnosis and monitoring of certain cancers.⁽ ¹⁶ , ¹⁷ , ¹⁸ ⁾ Proteins in this family are aberrantly expressed in many cancer types and their expression level has been associated with a number of tumor‐related processes, including cell growth regulation, angiogenesis, invasion, and metastasis.⁽ ⁶ , ¹⁹ ⁾ KLK10 encodes for a secreted serine protease (hK10) with predicted trypsin‐like enzymatic activity and is widely expressed in a variety of normal epithelial cells, such as salivary gland, breast, ovary, testis, prostate, and small intestine.⁽ ⁷ , ²⁰ ⁾ However, the physiological function of KLK10 is still not clear. Accumulating studies have shown that the expression of KLK10 is regulated by steroid hormones, such as estrogens, androgens and progestins, which imply KLK10 plays an important role in the initiation and progression of endocrine‐related tumors.⁽ ²¹ ⁾ Further experimental evidence suggests that KLK10 may function as a tumor suppressor gene.⁽ ⁸ , ²² ⁾ Downregulation of KLK10 was reported in gastric cancer,⁽ ¹¹ ⁾ hepatocellular carcinoma (HCC)⁽ ¹² ⁾ and acute lymphoblastic leukemia (ALL)⁽ ²³ ⁾ as well as in breast, prostate, testicular⁽ ²⁴ ⁾ and ovarian cancer, and its low expression is regulated by DNA methylation. However, KLK10 was found to be upregulated in colon cancer,⁽ ²⁵ ⁾ ovarian cancer,⁽ ²⁶ ⁾ uterine papillary serous carcinoma (UPSC),⁽ ²⁷ ⁾ pancreatic ductal adenocarcinoma (PDAC),⁽ ²⁸ ⁾ and oral squamous cell carcinoma (OSCC),⁽ ²⁹ ⁾ which suggested that KLK10 was with distinct expression patterns and various physiological functions in tumorigenesis.

To our data, KLK10 was mostly (57.7%, 45/78) downregulated in NSCLC, as compared to adjacent normal tissues and benign control lung lesions, which implied the tumor suppressor role of KLK10 in NSCLC. Furthermore, KLK10 gene showed a higher methylation frequency in NSCLC tissue samples while was rare in non‐cancer lung tissues, and exon 3 methylation of KLK10 was specifically associated with low or absent of KLK10 mRNA expression. We also confirmed that KLK10 expression was restored in two lung adenocarcinoma cell lines (A549 and SPC‐A1) after the DNA methyltransferase inhibitor 5‐aza‐dC treatment. These results indicated that hypermethylation of the exon 3 region might be critical for the silencing of KLK10 in NSCLC. In addition, we found KLK10 methylation was associated with tumor stages, lymph metastasis of NSCLC patients, which suggested the involvement of KLK10 in the development of NSCLC and KLK10 methylation might be a potential biomarker for early detection, staging and prognosis of NSCLC.

For the functional role of KLK10 in NSCLC cells remains unclear, we further evaluated it by examining the inhibitory effect of KLK10 expression on two lung adencarcinoma cell lines. The results showed that, forced expression of KLK10 in A549 and SPC‐A1 cells with hypermethylated KLK10 remarkably inhibit their clone formation in vitro and oncogenicity in vivo. Furthermore, inhibition of A549 and SPC‐A1 cells migration was confirmed by wound‐healing assay. Consistent with these findings, Goyal et al. ⁽ ⁸ ⁾ demonstrated that restoration of KLK10 expression in breast cancer cell line MDA‐MB‐231 by transfection suppressed its anchorage‐independent growth and tumor formation in nude mice. Similar tumor‐suppressive property of KLK10 was also observed in gastric cancer cell lines.⁽ ²¹ ⁾ Thus, we could conclude that, KLK10 acts as a functional tumor suppressor gene in NSCLC and epigenetic inactivation of KLK10 by CpG island methylation may be an important event contributing to lung carcinogenesis and tumor progression, although the detailed mechanism underlying remains largely unknown. Recently, Pampalakis et al. ⁽ ³⁰ ⁾ reported that, another member of kallikrein gene family, KLK6 was an epigenetically regulated tumor suppressor in human breast cancer, and KLK6 played a protective role against tumor progression that is likely mediated by inhibition of epithelial‐to‐mesenchymal transition, which may give us clues for the future research.

Many studies have shown that silencing of the TSGs by DNA hypermethylation at CpG islands tend to be an early event in the multi‐step pathway of carcinogenesis.⁽ ³¹ ⁾ Based on the frequency of tumor‐specific hypermethylation of KLK10 in NSCLC specimens, we suspected that it could be used as a valuable marker for early diagnosis. The detection of KLK10 methylated status in plasma samples of NSCLC patients was further implemented. Whilst we have previously known that double‐strand DNA fragments frequently appear in considerable quantities in the serum or plasma of cancer patients, which maybe arise from lysis of tumor cells.⁽ ³² , ³³ ⁾ We found KLK10 was hypermethylated in 30 plasma samples out of 78 NSCLC patients, whereas only 2 detected in 50 cancer‐free controls. The sensitivity, as well as the specificity was satisfactory compared with aforementioned frequently methylated loci identified in plasma/serum,⁽ ⁵ , ³⁴ , ³⁵ ⁾ suggesting plasma KLK10 methylation detecting is a promising diagnostic marker for NSCLC. It is of note that concordance of KLK10 methylation status in tumor tissues and corresponding plasma samples is fine, which further implies its possible application value. Molecular markers have become an alternative approach for tumor scan, and the way in the future is to identify a panel of multiple loci with more sensitivity and specificity.⁽ ¹⁷ ⁾ KLK10 methylation would provide a candidate constituting the methylation‐based panal for NSCLC diagnosis and prognosis.

In conclusion, we found that KLK10 is hypermethylated in NSCLC. Although widely expressed in non‐cancer samples, KLK10 is silenced by methylation in NSCLC samples. Meanwhile, we demonstrated that KLK10 acts as a functional tumor suppressor gene in NSCLC cell lines. The high detection rate of methylated KLK10 in plasma DNA further indicates its potential diagnostic and prognosis values in NSCLC.

Acknowledgments

Our study would not have been possible without the participation of the patients and healthy donors. The valuable help from Departments of Cardiothoracic Surgery of Jinling Hospital is great granted.

References

1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics 2009. CA Cancer J Clin 2009; 59: 225–49. [DOI] [PubMed] [Google Scholar]
2. Minna JD, Roth JA, Gazdar AF. Focus on lung cancer. Cancer Cell 2002; 1: 49–52. [DOI] [PubMed] [Google Scholar]
3. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000; 16: 168–74. [DOI] [PubMed] [Google Scholar]
4. Yanagawa N, Tamura G, Oizumi H, Takahashi N, Shimazaki Y, Motoyama T. Promoter hypermethylation of tumor suppressor and tumor‐related genes in non‐small cell lung cancers. Cancer Sci 2003; 94: 589–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Anglim PP, Alonzo TA, Laird‐Offringa IA. DNA methylation‐based biomarkers for early detection of non‐small cell lung cancer: an update. Mol Cancer 2008; 7: 81. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Sotiropoulou G, Pampalakis G, Diamandis EP. Functional roles of human kallikrein‐related peptidases. J Biol Chem 2009; 284: 32989–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Liu XL, Wazer DE, Watanabe K, Band V. Identification of a novel serine protease‐like gene, the expression of which is down‐regulated during breast cancer progression. Cancer Res 1996; 56: 3371–9. [PubMed] [Google Scholar]
8. Goyal J, Smith KM, Cowan JM, Wazer DE, Lee SW, Band V. The role for NES1 serine protease as a novel tumor suppressor. Cancer Res 1998; 58: 4782–6. [PubMed] [Google Scholar]
9. Li B, Goyal J, Dhar S et al. CpG methylation as a basis for breast tumor‐specific loss of NES1/kallikrein 10 expression. Cancer Res 2001; 61: 8014–21. [PubMed] [Google Scholar]
10. Sidiropoulos M, Pampalakis G, Sotiropoulou G, Katsaros D, Diamandis EP. Downregulation of human kallikrein 10 (KLK10/NES1) by CpG island hypermethylation in breast, ovarian and prostate cancers. Tumour Biol 2005; 26: 324–36. [DOI] [PubMed] [Google Scholar]
11. Huang W, Zhong J, Wu LY et al. Downregulation and CpG island hypermethylation of NES1/hK10 gene in the pathogenesis of human gastric cancer. Cancer Lett 2007; 251: 78–85. [DOI] [PubMed] [Google Scholar]
12. Lu CY, Hsieh SY, Lu YJ et al. Aberrant DNA methylation profile and frequent methylation of KLK10 and OXGR1 genes in hepatocellular carcinoma. Genes Chromosomes Cancer 2009; 48: 1057–68. [DOI] [PubMed] [Google Scholar]
13. Kioulafa M, Kaklamanis L, Stathopoulos E, Mavroudis D, Georgoulias V, Lianidou ES. Kallikrein 10 (KLK10) methylation as a novel prognostic biomarker in early breast cancer. Ann Oncol 2009; 20: 1020–5. [DOI] [PubMed] [Google Scholar]
14. Planque C, Aïnciburu M, Heuzé‐Vourc’h N, Régina S, de Monte M, Courty Y. Expression of the human kallikrein genes 10 (KLK10) and 11 (KLK11) in cancerous and non‐cancerous lung tissues. Biol Chem 2006; 387: 783–8. [DOI] [PubMed] [Google Scholar]
15. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2‐ΔΔCT Method. Methods 2001; 25: 402–8. [DOI] [PubMed] [Google Scholar]
16. Diamandis EP, Yousef GM, Luo LY, Magklara A, Obiezu CV. The new human kallikrein gene family: implications in carcinogenesis. Trends Endocrinol Metab 2000; 11: 54–60. [DOI] [PubMed] [Google Scholar]
17. Planque C, Li L, Zheng Y et al. A multiparametric serum kallikrein panel for diagnosis of non‐small cell lung carcinoma. Clin Cancer Res 2008; 14: 1355–62. [DOI] [PubMed] [Google Scholar]
18. Talieri M, Li L, Zheng Y et al. The use of kallikrein‐related peptidases as adjuvant prognostic markers in colorectal cancer. Br J Cancer 2009; 100: 1659–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Borgono CA, Diamandis EP. The emerging roles of human tissue kallikreins in cancer. Nat Rev Cancer 2004; 4: 876–90. [DOI] [PubMed] [Google Scholar]
20. Petraki CD, Karavana VN, Luo LY, Diamandis EP. Human kallikrein 10 expression in normal tissues by immunohistochemistry. J Histochem Cytochem 2002; 50: 1247–61. [DOI] [PubMed] [Google Scholar]
21. Luo LY, Grass L, Diamandis EP. Steroid hormone regulation of the human kallikrein 10 (KLK10) gene in cancer cell lines and functional characterization of the KLK10 gene promoter. Clin Chim Acta 2003; 337: 115–26. [DOI] [PubMed] [Google Scholar]
22. Huang W, Tian XL, Wu YL et al. Suppression of gastric cancer growth by baculovirus vectormediated transfer of normal epithelial cell specific‐1 gene. World J Gastroenterol 2008; 14: 5810–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Roman‐Gomez J, Jimenez‐Velasco A, Agirre X et al. The normal epithelial cell‐specific 1 (NES1) gene,a candidate tumor suppressor gene on chromosome 19q13.3‐4, is downregulated by hypermethylation in acute lymphoblastic leukemia. Leukemia 2004; 18: 362–5. [DOI] [PubMed] [Google Scholar]
24. Luo LY, Rajpert‐De Meyts ER, Jung K, Diamandis EP. Expression of the normal epithelial cell‐specific 1 (NES1; KLK10) candidate tumour suppressor gene in normal and malignant testicular tissue. Br J Cancer 2001; 85: 220–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Feng B, Xu WB, Zheng MH et al. Clinical significance of human kallikrein 10 gene expression in colorectal cancer and gastric cancer. J Gastroenterol Hepatol 2006; 21: 1596–603. [DOI] [PubMed] [Google Scholar]
26. Shvartsman HS, Lu KH, Lee J et al. Overexpression of kallikrein 10 in epithelial ovarian carcinomas. Gynecol Oncol 2003; 90: 44–50. [DOI] [PubMed] [Google Scholar]
27. Santin AD, Diamandis EP, Bellone S et al. Overexpression of kallikrein 10 (hK10) in uterine serous papillary carcinomas. Am J Obstet Gynecol 2006; 194: 1296–302. [DOI] [PubMed] [Google Scholar]
28. Rückert F, Hennig M, Petraki CD et al. Co‐expression of KLK6 and KLK10 as prognostic factors for survival in pancreatic ductal adenocarcinoma. Br J Cancer 2008; 99: 1484–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Pettus JR, Johnson JJ, Shi Z et al. Multiple kallikrein (KLK 5, 7, 8, and 10) expression in squamous cell carcinoma of the oral cavity. Histol Histopathol 2009; 24: 197–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Pampalakis G, Prosnikli E, Agalioti T, Vlahou A, Zoumpourlis V, Sotiropoulou G. A tumor‐protective role for human kallikrein‐related peptidase 6 in breast cancer mediated by inhibition of epithelial‐to‐mesenchymal transition. Cancer Res 2009; 69: 3779–87. [DOI] [PubMed] [Google Scholar]
31. Belinsky SA. Silencing of genes by promoter hypermethylation: key event in rodent and human lung cancer. Carcinogenesis 2005; 26: 1481–7. [DOI] [PubMed] [Google Scholar]
32. Jahr S, Hentze H, Englisch S et al. DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res 2001; 61: 1659–65. [PubMed] [Google Scholar]
33. Cheng C, Omura‐Minamisawa M, Kang Y, Hara T, Koike I, Inoue T. Quantification of circulating cell‐free DNA in the plasma of cancer patients during radiation therapy. Cancer Sci 2009; 100: 303–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Hsu HS, Chen TP, Hung CH et al. Characterization of a multiple epigenetic marker panel for lung cancer detection and risk assessment in plasma. Cancer 2007; 110: 2019–26. [DOI] [PubMed] [Google Scholar]
35. Wang Y, Yu Z, Wang T et al. Identification of epigenetic aberrant promoter methylation of RASSF1A in serum DNA and its clinicopathological significance in lung cancer. Lung Cancer 2007; 56: 289–94. [DOI] [PubMed] [Google Scholar]

[b1] 1. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics 2009. CA Cancer J Clin 2009; 59: 225–49. [DOI] [PubMed] [Google Scholar]

[b2] 2. Minna JD, Roth JA, Gazdar AF. Focus on lung cancer. Cancer Cell 2002; 1: 49–52. [DOI] [PubMed] [Google Scholar]

[b3] 3. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet 2000; 16: 168–74. [DOI] [PubMed] [Google Scholar]

[b4] 4. Yanagawa N, Tamura G, Oizumi H, Takahashi N, Shimazaki Y, Motoyama T. Promoter hypermethylation of tumor suppressor and tumor‐related genes in non‐small cell lung cancers. Cancer Sci 2003; 94: 589–92. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b5] 5. Anglim PP, Alonzo TA, Laird‐Offringa IA. DNA methylation‐based biomarkers for early detection of non‐small cell lung cancer: an update. Mol Cancer 2008; 7: 81. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b6] 6. Sotiropoulou G, Pampalakis G, Diamandis EP. Functional roles of human kallikrein‐related peptidases. J Biol Chem 2009; 284: 32989–94. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b7] 7. Liu XL, Wazer DE, Watanabe K, Band V. Identification of a novel serine protease‐like gene, the expression of which is down‐regulated during breast cancer progression. Cancer Res 1996; 56: 3371–9. [PubMed] [Google Scholar]

[b8] 8. Goyal J, Smith KM, Cowan JM, Wazer DE, Lee SW, Band V. The role for NES1 serine protease as a novel tumor suppressor. Cancer Res 1998; 58: 4782–6. [PubMed] [Google Scholar]

[b9] 9. Li B, Goyal J, Dhar S et al. CpG methylation as a basis for breast tumor‐specific loss of NES1/kallikrein 10 expression. Cancer Res 2001; 61: 8014–21. [PubMed] [Google Scholar]

[b10] 10. Sidiropoulos M, Pampalakis G, Sotiropoulou G, Katsaros D, Diamandis EP. Downregulation of human kallikrein 10 (KLK10/NES1) by CpG island hypermethylation in breast, ovarian and prostate cancers. Tumour Biol 2005; 26: 324–36. [DOI] [PubMed] [Google Scholar]

[b11] 11. Huang W, Zhong J, Wu LY et al. Downregulation and CpG island hypermethylation of NES1/hK10 gene in the pathogenesis of human gastric cancer. Cancer Lett 2007; 251: 78–85. [DOI] [PubMed] [Google Scholar]

[b12] 12. Lu CY, Hsieh SY, Lu YJ et al. Aberrant DNA methylation profile and frequent methylation of KLK10 and OXGR1 genes in hepatocellular carcinoma. Genes Chromosomes Cancer 2009; 48: 1057–68. [DOI] [PubMed] [Google Scholar]

[b13] 13. Kioulafa M, Kaklamanis L, Stathopoulos E, Mavroudis D, Georgoulias V, Lianidou ES. Kallikrein 10 (KLK10) methylation as a novel prognostic biomarker in early breast cancer. Ann Oncol 2009; 20: 1020–5. [DOI] [PubMed] [Google Scholar]

[b14] 14. Planque C, Aïnciburu M, Heuzé‐Vourc’h N, Régina S, de Monte M, Courty Y. Expression of the human kallikrein genes 10 (KLK10) and 11 (KLK11) in cancerous and non‐cancerous lung tissues. Biol Chem 2006; 387: 783–8. [DOI] [PubMed] [Google Scholar]

[b15] 15. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2‐ΔΔCT Method. Methods 2001; 25: 402–8. [DOI] [PubMed] [Google Scholar]

[b16] 16. Diamandis EP, Yousef GM, Luo LY, Magklara A, Obiezu CV. The new human kallikrein gene family: implications in carcinogenesis. Trends Endocrinol Metab 2000; 11: 54–60. [DOI] [PubMed] [Google Scholar]

[b17] 17. Planque C, Li L, Zheng Y et al. A multiparametric serum kallikrein panel for diagnosis of non‐small cell lung carcinoma. Clin Cancer Res 2008; 14: 1355–62. [DOI] [PubMed] [Google Scholar]

[b18] 18. Talieri M, Li L, Zheng Y et al. The use of kallikrein‐related peptidases as adjuvant prognostic markers in colorectal cancer. Br J Cancer 2009; 100: 1659–65. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b19] 19. Borgono CA, Diamandis EP. The emerging roles of human tissue kallikreins in cancer. Nat Rev Cancer 2004; 4: 876–90. [DOI] [PubMed] [Google Scholar]

[b20] 20. Petraki CD, Karavana VN, Luo LY, Diamandis EP. Human kallikrein 10 expression in normal tissues by immunohistochemistry. J Histochem Cytochem 2002; 50: 1247–61. [DOI] [PubMed] [Google Scholar]

[b21] 21. Luo LY, Grass L, Diamandis EP. Steroid hormone regulation of the human kallikrein 10 (KLK10) gene in cancer cell lines and functional characterization of the KLK10 gene promoter. Clin Chim Acta 2003; 337: 115–26. [DOI] [PubMed] [Google Scholar]

[b22] 22. Huang W, Tian XL, Wu YL et al. Suppression of gastric cancer growth by baculovirus vectormediated transfer of normal epithelial cell specific‐1 gene. World J Gastroenterol 2008; 14: 5810–5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b23] 23. Roman‐Gomez J, Jimenez‐Velasco A, Agirre X et al. The normal epithelial cell‐specific 1 (NES1) gene,a candidate tumor suppressor gene on chromosome 19q13.3‐4, is downregulated by hypermethylation in acute lymphoblastic leukemia. Leukemia 2004; 18: 362–5. [DOI] [PubMed] [Google Scholar]

[b24] 24. Luo LY, Rajpert‐De Meyts ER, Jung K, Diamandis EP. Expression of the normal epithelial cell‐specific 1 (NES1; KLK10) candidate tumour suppressor gene in normal and malignant testicular tissue. Br J Cancer 2001; 85: 220–4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b25] 25. Feng B, Xu WB, Zheng MH et al. Clinical significance of human kallikrein 10 gene expression in colorectal cancer and gastric cancer. J Gastroenterol Hepatol 2006; 21: 1596–603. [DOI] [PubMed] [Google Scholar]

[b26] 26. Shvartsman HS, Lu KH, Lee J et al. Overexpression of kallikrein 10 in epithelial ovarian carcinomas. Gynecol Oncol 2003; 90: 44–50. [DOI] [PubMed] [Google Scholar]

[b27] 27. Santin AD, Diamandis EP, Bellone S et al. Overexpression of kallikrein 10 (hK10) in uterine serous papillary carcinomas. Am J Obstet Gynecol 2006; 194: 1296–302. [DOI] [PubMed] [Google Scholar]

[b28] 28. Rückert F, Hennig M, Petraki CD et al. Co‐expression of KLK6 and KLK10 as prognostic factors for survival in pancreatic ductal adenocarcinoma. Br J Cancer 2008; 99: 1484–92. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b29] 29. Pettus JR, Johnson JJ, Shi Z et al. Multiple kallikrein (KLK 5, 7, 8, and 10) expression in squamous cell carcinoma of the oral cavity. Histol Histopathol 2009; 24: 197–207. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b30] 30. Pampalakis G, Prosnikli E, Agalioti T, Vlahou A, Zoumpourlis V, Sotiropoulou G. A tumor‐protective role for human kallikrein‐related peptidase 6 in breast cancer mediated by inhibition of epithelial‐to‐mesenchymal transition. Cancer Res 2009; 69: 3779–87. [DOI] [PubMed] [Google Scholar]

[b31] 31. Belinsky SA. Silencing of genes by promoter hypermethylation: key event in rodent and human lung cancer. Carcinogenesis 2005; 26: 1481–7. [DOI] [PubMed] [Google Scholar]

[b32] 32. Jahr S, Hentze H, Englisch S et al. DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res 2001; 61: 1659–65. [PubMed] [Google Scholar]

[b33] 33. Cheng C, Omura‐Minamisawa M, Kang Y, Hara T, Koike I, Inoue T. Quantification of circulating cell‐free DNA in the plasma of cancer patients during radiation therapy. Cancer Sci 2009; 100: 303–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b34] 34. Hsu HS, Chen TP, Hung CH et al. Characterization of a multiple epigenetic marker panel for lung cancer detection and risk assessment in plasma. Cancer 2007; 110: 2019–26. [DOI] [PubMed] [Google Scholar]

[b35] 35. Wang Y, Yu Z, Wang T et al. Identification of epigenetic aberrant promoter methylation of RASSF1A in serum DNA and its clinicopathological significance in lung cancer. Lung Cancer 2007; 56: 289–94. [DOI] [PubMed] [Google Scholar]

PERMALINK

Frequent transcriptional inactivation of Kallikrein 10 gene by CpG island hypermethylation in non‐small cell lung cancer

Youwei Zhang

Haizhu Song

Yufeng Miao

Rui Wang

Longbang Chen

Abstract