Rapid Detection of Isoniazid, Rifampin, and Ofloxacin Resistance in Mycobacterium tuberculosis Clinical Isolates Using High-Resolution Melting Analysis

Abstract

A high-resolution melting analysis (HRMA) assay was developed to detect isoniazid, rifampin, and ofloxacin resistance in Mycobacterium tuberculosis by targeting resistance-associated mutations in the katG, mabA-inhA promoter, rpoB, and gyrA genes. A set of 28 (17 drug-resistant and 11 fully susceptible) clinical M. tuberculosis isolates was selected for development and evaluation of HRMA. PCR amplicons from the katG, mabA-inhA promoter, rpoB, and gyrA genes of all 28 isolates were sequenced. HRMA results matched well with 18 mutations, identified by sequencing, in 17 drug-resistant isolates and the absence of mutations in 11 susceptible isolates. Among 87 additional isolates with known resistance phenotypes, HRMA identified katG and/or mabA-inhA promoter mutations in 66 of 69 (95.7%) isoniazid-resistant isolates, rpoB mutations in 51 of 54 (94.4%) rifampin-resistant isolates, and gyrA mutations in all of 41 (100%) ofloxacin-resistant isolates. All mutations within the HRMA primer target regions were detected as variant HRMA profiles. The corresponding specificities were 97.8%, 100%, and 98.6%, respectively. Most false-positive results were due to synonymous mutations, which did not affect susceptibility. HRMA is a rapid, sensitive method for detection of drug resistance in M. tuberculosis which could be used routinely for screening isolates in countries with a high prevalence of tuberculosis and drug resistance or in individual isolates when drug resistance is suspected.

INTRODUCTION

One-third of the world's population is reportedly infected with Mycobacterium tuberculosis, causing high mortality and morbidity. Eight million to nine million new tuberculosis (TB) cases and about 2 million deaths are reported each year (9, 18, 28). Multidrug-resistant TB (MDR-TB) is defined as resistance of the isolate to at least isoniazid (INH) and rifampin (RIF); extensively drug-resistant TB (XDR-TB) is MDR-TB in which the isolate has additional resistance to any of fluoroquinolones and at least one of three injectable second-line antituberculosis drugs used in TB treatment, namely, capreomycin, kanamycin, and amikacin (14, 21). MDR-TB and XDR-TB are major obstacles to the control of TB worldwide. More than 2.5 million patients were diagnosed with active TB in 116 countries and regions in 2006; of them, 4.8% had MDR-TB (3). About one in six (15%) patients with MDR-TB had previously received treatment for TB for at least 1 month (18), and at least 8.0% had XDR-TB, according to incomplete data collected from 37 countries between 2002 and 2007 (41).

Drug susceptibility testing using molecular techniques can enhance the identification of drug-resistant M. tuberculosis. Several scanning methods are available for detection of drug resistance mutations, including denaturing gradient gel electrophoresis, conformation-sensitive gel electrophoresis, temperature gradient capillary electrophoresis, denaturing high-performance liquid chromatography (dHPLC), and high-density oligonucleotide arrays (15, 20, 22, 30, 31, 33). These methods vary in sensitivity and generally either are labor-intensive or require sophisticated instrument to perform analyses. PCR-based DNA sequencing of drug resistance-related genes is probably the most rapid and specific method for the identification of mutations. However, due to the high cost of sequencing and the expertise required, it is not widely available, especially in the countries that are the most severely threatened by TB, where large numbers of samples need to be tested.

High-resolution melting analysis (HRMA) is a PCR-based method for detection of DNA sequence variation by demonstrating fluorescence changes in the melting of the amplified double-stranded DNA amplicon (35). The length, GC content, and sequence complementarities of the DNA fragments contribute to the melting characteristics of double-stranded DNA (29). This technique has successfully been applied in mutation scanning, single nucleotide polymorphism (SNP) genotyping, and identification of many bacterial species, including screening for RIF and INH resistance in M. tuberculosis (6, 19, 23–25). With its simple and fast work flow, HRMA is easy to perform and can be used for a large number of samples in a short time (35). It is a good candidate tool for mutation scanning (8).

In this study, the usefulness of HRMA for screening for resistance in M. tuberculosis was evaluated by targeting the genes rpoB, gyrA, and katG and the mabA-inhA promoter region, in all of which mutations are associated with drug resistance (26). An HRMA protocol was developed and validated, using clinical M. tuberculosis isolates with known phenotypic susceptibility profiles, for the rapid identification of MDR-TB.

MATERIALS AND METHODS

M. tuberculosis clinical isolates and drug susceptibility testing.

A total of 115 clinical M. tuberculosis isolates isolated from patients attending the Department of Tuberculosis, Beijing Chest Hospital, Capital Medical University, Beijing,China, were tested. They had been identified as M. tuberculosis by either the p-nitro-α-acetyl-amino-β-hydroxypropiophenone (NAP) test or the BD ProbeTec ET (CTB) assay (Becton Dickinson Microbiology Systems, MD). Phenotypic drug susceptibility testing was performed by the absolute concentration method (4, 32). Isolates were chosen to represent a variety of different susceptibility profiles and included 32 fully susceptible isolates; 45 INH- and RIF-resistant isolates (MDR), of which 30 were also fluoroquinolone (ofloxacin [OFLX]) resistant; 21, 6, and 5 isolates monoresistant to INH, RIF, and OFLX, respectively; three INH- and OFLX-resistant isolates; and three RIF- and OFLX-resistant isolates.

DNA extraction.

Stored isolates were subcultured on Lowenstein-Jensen solid medium and incubated at 37°C for 2 to 4 weeks. Genomic DNA was extracted as described previously (39).

HRMA primer design.

We designed four pairs of primers for HRMA, one each to amplify katG, rpoB, gyrA, and the promoter region of mabA-inhA, specifically targeting sites at which mutations associated with drug resistance are found, namely, for katG, the −315 site (INH resistance); for the mabA-inhA promoter, the −8 and −15 sites (INH resistance); for rpoB, the 81-bp RIF resistance determining region (RRDR); and for gyrA, a region including several resistance-associated sites (OFLX resistance) (26). Another four pairs of primers were designed outside each HRMA primer region to amplify extended regions of each gene for sequence analysis (Table 1).

Table 1.

PCR primers designed for and used in this study

Primer use and primera	Primer sequence (5′–3′)	Amplicon size (bp)	Annealing temp (°C)	HRM temp range (°C)	Nucleotide positionsb	GenBank accession no.
HRMA
gyrA-F	GGTGCTCTATGCAATGTTCG	234	63	86–96	2467 to 24861	L27512.1
gyrA-R	GCTTCGGTGTACCTCATCG				2700 to 2682
katG-F	GCGGTCACACTTTCGGTAA	235	64	85–95	2781 to 27991	X68081.1
katG-R	GGTGTTCGTCCATACGACCT				2950 to 2931
rpoB-F	CGCGATCAAGGAGTTCTTC	118	65	84–94	2339 to 2357	L27989.1
rpoB-R	TGACAGACCGCCGGGCCC				2456 to 2439
mabA-inhA-promoter-F	GTCACACCGACAAACGTCAC	190	64	82–92	100 to 119	U66801.1
mabA-inhA-promoter-R	CTCCGGTAACCAGGACTGAA				296 to 271
Sequencing
gyrA-FS	ACAGACACGACGTTGCCGC	672	69.97	NAc	2309 to 2327	L27512.1
gyrA-RS	GCCTTTAACCCGCCCCATGAC		72.09	NA	2980 to 2960
katG-FS	TGCAGATGGGGCTGATCTACG	596	69.44	NA	2646 to 2666	X68081.1
katG-RS	ACCCATGTCTCGGTGGATCAG		68.43	NA	3241 to 3221
rpoB-FS	TGGTCCGCTTGCACGAGGGTCAGA	758	79.19	NA	2098 to 2121	L27989.1
rpoB-RS	CAGGAAGGGAATCATCGCGG		70.87	NA	2855 to 2836
mabA-inhA-promoter-FS	ACATACCTGCTGCGCAAT	400	61.9	NA	7 to 24	U66801.1
mabA-inhA-promoter-RS	TCACATTCGACGCCAAAC		63.45	NA	405 to 388

^aF, forward primer; R, reverse primer; S, sequencing primer.

^bNucleotide position is relative to the transcriptional start site of each gene.

^cNA, not applicable.

Real-time PCR and high-resolution melting analysis.

The PCR mixture was prepared using a Qiagen HotStar Taq system, including 2.0 μl 10× PCR buffer, 1.5 mM MgCl_2, 0.25 mM deoxynucleoside triphosphates, 0.125 μM each primer, 1 U HotStar Taq polymerase, 1.0 μl dimethyl sulfoxide, 0.2 μl LC Green Plus dye (Idaho Technology Inc., Salt Lake City, UT), 100 to 150 ng of DNA template, and water, which was added to give a total volume of 20 μl. PCR amplification was performed on the Rotor-Gene 6000 apparatus (Corbett Research Pty. Ltd., Australia) with an initial denaturation at 95°C for 15 min, followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s and a final elongation at 72°C for 10 min. A nontemplate control containing sterile distilled water was included in the experiment.

For HRMA, a second hold was set at 50°C for 60 s to allow reassociation of DNA. The melt analysis was performed from 78 to 88°C with fluorescence data acquisition at 0.1°C increments with a hold of 2 s at each step. The HRMA curve was analyzed using Rotor-Gene, version 1.7 (Build 65), software (Corbett Life Science). The difference temperature plots were generated by converting the wild-type melting profile to a horizontal line and normalizing the melting profiles of the examined samples against the wild-type profile.

DNA sequencing of katG, rpoB, and gyrA genes and mabA-inhA promoter.

PCR amplicons produced from the katG, rpoB, and gyrA genes and the mabA-inhA promoter using the sequencing primers (Table 1) were purified using an ExoSAP-IT PCR product cleanup kit (USB Corporation, Cleveland, OH) according to the manufacturer's instructions. The purified PCR products were sequenced using forward and reverse primers on an ABI Prism 3100 genetic analyzer (Applied Biosystems, Foster City, CA) using BigDye Terminator chemistry (version 3.1). Sequences were analyzed by the Australia National Genomic Information Service (ANGIS) (http://biomanager.info/).

RESULTS

HRMA optimization.

Seventeen isolates with various drug resistance phenotypes and 11 wild-type (fully sensitive) isolates were selected for the development and initial evaluation of the HRMA assay (Table 2). All four target genes of all 28 isolates were sequenced prior to HRMA, and a total of 18 sequence variants were identified, including katG (n = 3), the mabA-inhA promoter (n = 3), rpoB (n = 6), and gyrA (n = 6), in the 17 drug-resistant isolates only. With one exception, sequence variants demonstrated SNPs known to be associated with resistance to the corresponding antibiotic. The exception was at position 514 in rpoB of a RIF-resistant isolate (isolate 4533), in which a duplication of TTC, which encodes a Phe (phenylalanine) insertion, was identified (Table 2).

Table 2.

Nucleotide mutations identified by sequencing of four antibiotic resistance genes/region in 28 selected M. tuberculosis isolates compared with HRMA profiles and resistance phenotype

Isolate	Mutation(s) at the following genes or region by sequencing (site)				HRMA resulta					Phenotypeb
	katG	mabA-inhA promoter	rpoB	gyrA	katG	mabA-inhA promoter	rpoB	gyrA	Pattern	INH	RIF	OFLX
2066	AGC → ACC (315)	T → G (−8)	CAA → CCA (513)	GAC → AAC (94)	V	V	V	V	A	R	R	R
H8	AGC → AAC (315)	C → T (−15)	CAC → TAC (526)	GAC → GGC (94)	V	V	V	V	A	R	R	R
H4	AGC → ACC (315)	T → C (−8)	TCG → TTG (531)	GAC → GGC (94)	V	V	V	V	A	R	R	R
2049	AGC → ACC (315)		TCG → TTG (531)	GAC → GGC (94), GCC → TCC (74)	V	WT	V	V	C	R	R	R
2058	AGC → ACC (315)		TCG → TTG (531)	GCG → GTG (90)	V	WT	V	V	C	R	R	R
2036	AGC → ACC (315)		TCG → TTG (531)		V	WT	V	WT	D	R	R	S
T47	AGC → GGC (315)				V	WT	WT	WT	F	R	R	S
P20			CAC → CGC (526)	GCG → GTG (90)	WT	WT	V	V	J	S	R	R
2055			CAA → CCA (513)		WT	WT	V	WT	K	S	R	S
2067			CAA → CCA (513)		WT	WT	V	WT	K	R	R	S
C279			GAC → GGC (516)		WT	WT	V	WT	K	S	R	S
4533			TTC → TTCTTC (514Phe insertion)		WT	WT	V	WT	K	S	R	S
4197				GAC → GGC (89)	WT	WT	WT	V	L	S	S	R
2057				GCC → TCC (74)	WT	WT	WT	V	L	S	S	R
2088				GCG → GTG (90)	WT	WT	WT	V	L	S	R	R
H15				GCG → GTG (90)	WT	WT	WT	V	L	S	S	R
2041				GCG → GTG (90)	WT	WT	WT	V	L	S	S	R
				TCG → CCG (91)
Sensitive isolates (n = 11)					WT	WT	WT	WT	WT	S	S	S
No. of sequence variants	3	3	6	6

^aV, variant; WT, wild type.

^bS, susceptible; R, resistant.

HRMA curve profiles were obtained for these 28 isolates. All 44 targets in the 11 fully susceptible isolates, which had no mutations, were correctly identified by HRMA to be wild type. All 17 resistant isolates, which had mutations at one or more sites, demonstrated variant melting curves for one or more genes. Variant melting curves could be differentiated in the normalized graphs (Fig. 1A to D) but were particularly clear in the difference graphs (Fig. 1a to d). One INH-resistant isolate and two RIF-resistant isolates had wild-type HRMA curves for the katG gene and the mabA-inhA promoter (pattern K) and the rpoB gene (patterns F and L), respectively, which were consistent with sequencing results (Table 2). On the basis of the different profile combinations for the four targets, there were seven HRMA patterns identified in 17 selected isolates with various drug resistance profiles and one HRMA profile in 11 fully sensitive isolates (Table 2).

Fig. 1.

Normalized and temperature-shifted difference plots for mutant discrimination by HRMA in katG (A and a, respectively), mabA-inhA promoter (B and b, respectively), rpoB (C and c, respectively), and gyrA (D and d, respectively). Wild-type profiles are shown in black, and variant profiles are shown in color. Numbers in parentheses are numbers of isolates tested.

Sensitivity and specificity of HRMA.

Another 87 isolates produced 13 HRMA patterns, including the 7 HRMA profiles produced by 28 isolates tested in the preliminary evaluation. Most of the 460 individual HRMA results were consistent with their resistance phenotypes. There were seven exceptions (Table 3): two isolates with pattern K (including one identified in the preliminary evaluation), which were wild type by HRMA for both katG and the mabA-inhA promoter but INH resistant; one with pattern M, which was wild type for all HRMA patterns but INH/RIF resistant; two with pattern F (one INH susceptible and one RIF resistant), which had variant katG profiles and wild-type profiles for all other HRMA patterns; one with pattern E, which had a variant gyrA profile but which was OFLX susceptible; and one with pattern L, which had a wild-type profile for rpoB but which was RIF resistant. The isolates which were resistant to all three drugs (INH, RIF, and OFLX) demonstrated three HRMA patterns (in addition to the two identified in the preliminary evaluation) (Table 3).

Table 3.

HRMA patterns, based on profiles of four genes/region associated with antibiotic resistance, in 115 M. tuberculosis clinical isolates

HRMA pattern	No. of isolates		HRMA profilea				Phenotypeb
	Evaluation set	Test set	katG	mabA-inhA promoter	rpoB	gyrA	INH	RIF	OFLX
A	3	4	V	V	V	V	R	R	R
B		1	V	V	V	WT	R	R	S
C	2	19	V	WT	V	V	R	R	R
D	1	7	V	WT	V	WT	R	R	S
E		3	V	WT	WT	V	R	S	R
		1	V	WT	WT	V	R	S	S
F		17	V	WT	WT	WT	R	S	S
		1	V	WT	WT	WT	S	S	S
	1		V	WT	WT	WT	R	R	S
G		2	WT	V	V	V	R	R	R
H		2	WT	V	V	WT	R	R	S
I		3	WT	V	WT	WT	R	S	S
J	1	1	WT	WT	V	V	S	R	R
K	3	3	WT	WT	V	WT	S	R	S
	1	1	WT	WT	V	WT	R	R	S
L	4	1	WT	WT	WT	V	S	S	R
	1		WT	WT	WT	V	S	R	R
M	11	20	WT	WT	WT	WT	S	S	S
		1	WT	WT	WT	WT	R	R	S
Total	28	87

^aV, variant; WT, wild type.

^bINH, isoniazid; RIF, rifampin; OFLX, ofloxacin (fluoroquinolone); S, susceptible; R, resistant.

Two HRMA patterns were identified among the 32 fully susceptible isolates; 31 (including 11 in the preliminary evaluation) had wild-type profiles for all four genes tested (pattern M), as expected, but one had a katG variant (pattern F). Apart from this one false-positive result, HRMA correctly identified all (31 of 32; 96.9%) fully susceptible isolates.

Overall, variant profiles were detected by HRMA for katG and/or the mabA-inhA promoter in 66 of 69 (95.7%) INH-resistant isolates: in rpoB for 51 of 54 (94.4%) RIF-resistant isolates and in gyrA for all of 41 (100%) OFLX-resistant isolates. The sensitivities and specificities of the HRMA are given in Table 4.

Table 4.

Sensitivities and specificities of HRMA in comparison with drug susceptibility testing result between three anti-MTB drugs

Drug	Target	HRMA profile			Drug resistance phenotype			Sensitivitya (%)	Specificityb (%)
		No. of isolates		% variant	No. of isolates		% resistant
		+	−		+	−
Isoniazid	katG	60	55	52.2	69	46	60.0	95.7 (87.5–99.0)	97.8 (87.6–99.9)
	mabA-inhA promoter	15	100	13.0
	Either or both	67	48	58.3
Rifampin	rpoB	51	64	44.3	54	61	47.0	94.4 (84.3–98.7)	100 (94.9–100)
Ofloxacin	gyrA	42	73	36.5	41	74	35.6	100 (92.6–100)	98.6 (92.0–99.9)

^aSensitivity is defined as the (number of drug-resistant isolates with mutations)/(number of drug-resistant isolates with mutations + number of drug-resistant isolates without mutations). Data in parentheses are 95% confidence intervals, which were calculated with the free software available from http://www.measuringusability.com/wald.htm and the adjusted Wald method.

^bSpecificity is defined as the (number of drug-susceptible isolates without mutations)/(number of drug-susceptible isolates without mutations + number of drug-susceptible isolates with mutations). Data in parentheses are 95% confidence intervals.

Sequencing results.

Amplicons from all four targets of all 87 isolates were sequenced, using primers targeting sites upstream and downstream of the HRMA forward and reverse primer sites, respectively (Table 1). All HRMA results that correctly predicted resistant or susceptible phenotypes were confirmed by sequencing; i.e., no sequence mutations were found in amplicons giving wild-type HRMA results, and various sequence mutations were identified in those with variant HRMA results. Sequencing results for HRMA profiles that did not correctly predict phenotypes were as follows: (i) the RIF-resistant isolate with a wild-type HRMA profile in pattern F had no mutations in the rpoB HRMA target region, but a mutation at T480I (ACC → ATC), outside the RRDR of rpoB, was identified; (ii) the INH-susceptible isolate with a variant katG HRMA profile in pattern F had a synonymous mutation in katG, which did not change the amino acid sequence; (iii) the OFLX-susceptible isolate with a gyrA HRMA variant in pattern E had a synonymous mutation in the gyrA gene at position 94 (GAC → AAC); (iv) the INH/RIF-resistant isolate with wild-type HRMA profiles for all four targets (pattern M) had a mutation at Y337C (TAC → TGC) of katG, which was outside the HRMA detection region, but no mutations in rpoB; and (v) no mutations were identified in two INH-resistant isolates with HRMA pattern K (wild-type HRMA profiles for katG and the mabA-inhA promoter) or in a RIF-resistant isolate with pattern L (wild-type HRMA profile for rpoB).

The phenotypes of isolates with HRMA and/or sequencing results inconsistent with the original phenotype were confirmed by retesting. These results suggest that genes other than those targeted in this study contribute to the resistance in these isolates.

Sequencing identified additional mutations outside the HRMA target regions which did not affect the HRMA profile or phenotypic resistance. For example, four OFLX-susceptible isolates with wild-type HRMA profiles had synonymous mutations in gyrA at position 197 (CTG → CTA, three isolates) or 171 (CCC → CCA, one isolate). All 115 clinical isolates tested in this study exhibited a naturally occurring polymorphism (AGC to ACC) at codon 95 in gyrA, which was not associated with phenotypic resistance.

DISCUSSION

INH resistance is associated with gene mutations in one or more of katG, inhA, the mabA-inhA promoter, kasA, oxyR, and ahpC (26). It is reported that 50 to 70% of INH-resistant isolates have katG mutations and that another 15 to 20% have mabA-inhA promoter mutations. RIF resistance is due to missense mutations or, less commonly, small in-frame deletions or insertions in or around the 81-bp RRDR of rpoB in 95% of cases (26, 37); in the other 5%, mutations in other regions of rpoB, such as V146F (1), or other genes, such as Rv2629 (e.g., mutation at A191C) (38), are responsible. Mutations in gyrA, clustered in a short 40-amino-acid region known as the quinolone resistance-determining region (QRDR) (43), are responsible for 42% to 85% of the cases of OFLX resistance in clinical isolates (11, 16, 26, 34, 42).

In this study, all 18 mutations, identified by sequencing of four target genes in 17 INH-, RIF-, and/or OFLX-resistant isolates, produced clearly distinguishable melting curves by HRMA. Among all 115 isolates, INH, RIF, and OFLX resistances were detected by HRMA with specificities of 97.8%, 100%, and 98.6%, respectively, and sensitivities of 95.7%, 94.4%, and 100%, respectively. However, the sensitivity was 100% for mutations within the target regions of the genes studied. These results are consistent with those of the most recent studies, in which sensitivities have ranged from 84.1% to 87% for INH resistance and from 91% to 98.6% for RIF resistance and the specificities have ranged from 98% to 100% (7, 27). Only a few discrepancies between HRMA profiles and drug resistance phenotypes were observed in this study. Of all 83 isolates with single or multiple drug resistances, 5 (6.0%) had wild-type HRMA profiles and no mutations in the relevant HRMA target regions were identified by sequencing, suggesting other resistance mechanisms, which may include mutations in other genes, such as kasA and ahpC for INH resistance, as suggested elsewhere (26).

Duplex melting is now generally monitored using intercalating dyes such as LC Green (as in this study), rather than SYBR green, which is biased against low-temperature-melting species and does not detect heteroduplexes because it is redistributed during melting (13, 40). LC Green is a new type of fluorescent DNA dye which binds to double-stranded but not single-stranded DNA and can detect heteroduplexes during homogeneous melting curve analysis. It has successfully been used in HRMA due to its ability to saturate available binding sites and PCR products at a concentration compatible with PCR products. This means that it does not inhibit amplification or redistribute as the amplicon melts. Its use allows homogeneous genotyping without fluorescently labeled probes and allele-specific or real-time PCR instruments.

HRMA is a simple, closed-tube system, which not only reduces the risk of contamination but also increases sample throughput because there is no requirement for physical separation of DNA molecules (36). HRMA provides a sensitive, homogeneous scanning method using controlled heating at a high rate and high data density. Variants are easily identified because they distort the melting curve shape compared to that for the wild type (10). Only two primers and one PCR per target and a melting instrument are required. Reagent costs for genotyping by amplicon melting are low because only a PCR system and a generic dye are needed. No probes or specialized reagents are required (17).

According to the binary combinations of base groups, SNPs are divided into four classes: class 1 (C/T or G/A), class 2 (C/A or G/T), class 3 (C/G), and class 4 (T/A) (17). Class 1 and 2 SNPs can be easily distinguished due to melting temperature (T_m) differences mostly of 0.8 to 1.4°C. However, T_m differences are usually less than 0.4°C for class 3 and 4 SNPs (17), making it more difficult to differentiate them. In our study, mutations in katG at 315G → C, the mabA-inhA promoter at −15C → G, and rpoB at 526C → G are class 3 SNPs and so are difficult to distinguish from wild type in normalized HRMA graphs (Fig. 1A to C). However, they can easily be distinguished by temperature-shifted difference plots (Fig. 1a to c), which should be used when SNPs are analyzed by HRMA.

The distinct advantage of genotypic drug susceptibility assays over phenotypic assays lies in the reduced turnaround time. The PCR-based methods need only hours to complete rather than days to weeks with phenotypic tests. Molecular techniques based on PCR amplification of genes involved in resistance mechanisms, followed by the detection of key mutations associated with resistance, provide faster results (5). Getting an early drug susceptibility result is clinically critical for patients. It allows the more timely implementation of an appropriate TB treatment regimen and, potentially, better outcomes. It also allows surveillance of antibiotic resistance rates, which are relevant to TB control and recommendations for initial or empirical therapy. The prevalence of primary fluoroquinolone-resistant TB is currently still low worldwide. However, extensive use of fluoroquinolones for treatment of bacterial infections could result in increased rates of primary fluoroquinolone-resistant TB, especially in those countries where there is a high burden of TB (2, 12).

In summary, this is the first description of an HRMA assay for four different drug resistance-related genes in M. tuberculosis. It is a novel, rapid, and sensitive method for screening for gene mutations associated with M. tuberculosis drug resistance and could be used routinely at low cost, which would be suitable for those laboratories in economically less developed countries where the prevalence of TB is high.