Abstract
Background: Infectious by Pseudomonas aeruginosa has spread worldwide and metallo-beta-lactamases (MBL) are being reported with increasing frequency. The aim of this study was to investigate the antibiotic susceptibility and distribution of blaVIM and blaIMP genes in P. aeruginosa isolates from Zanjan Province of Iran. Methods: A total of 70 P. aeruginosa isolates were identified from patients admitted at intensive care units. The antimicrobial susceptibility was tested by disk diffusion (Kirby-Bauer) method and for production of MBL using double-disk synergy test (DDST). After DNA extraction, the presence of blaVIM and blaIMP genes and class 1 integron were detected by PCR. RESULTS: Most of the isolates were resistant to meropenem, cefotaxime and imipenem (IPM). Also, 44/70 (62.85%) IPM resistant isolates were confirmed by DDST. Of the 44 clinical isolates, 41 (93%) isolates showed MIC≥4 µg/ml for IPM. Based on the DDST results, 36 (87.8%) were confirmed to be MBL producers. PCR amplification showed that 23/41 (56%) carried blaVIM and 10/41 (24.3%) possessed blaIMP gene. Also, 31/44 (70.5%) isolates contained class 1 integron gene. Conclusion: Our results highlight that the genes for Verona integron-encoded metallo-β-lactamase, IPM β-lactamases and class 1 integrons were predominantly present among the IPM-resistant P. aeruginosa tested in our province and also the frequency of blaVIM type is higher than blaIMP. This is the first report of P. aeruginosa strains producing blaIMP with high frequency from Zanjan province of Iran.
Key Words: Pseudomonas aeruginosa, Beta-lactamases, PCR
INTRODUCTION
Pseudomonas aeruginosa is a non-fermenting Gram-negative rod of great clinical and epidemiological relevance in hospital-acquired infections. This bacterium is more frequently found in intensive care units and also in patients with cystic fibrosis, cancer, surgical wounds, trauma and severe burns [1]. There is an increase in occurrence of P. aeruginosa strains with resistance to multiple antibiotics worldwide [2].
Several mechanisms are involved in P. aeruginosa resistance to antimicrobial agents, such as chromo-somal expression of resistance encoding genes, β-lactamase production, efflux pumps and decrease in membrane permeability [1]. One of the mechanisms of resistance to carbapenem antibiotics in P. aeruginosa is metallo-β-lactamases (MBL) production that hydro-lyzes all carbapenems. The prevalence of carbapenem resistance mediated by acquired MBL including imipenem (IPM) and Verona integron-encoded metallo-β-lactamase (VIM), are increasing from different parts of the world [3-6].
MBL genes are normally encoded in class 1 integrons along with other resistance determinants, such as the aminoglycoside-modifying enzymes. The integrons are frequently located in plasmids or transposons, which contributes to the global spread of this resistance mechanism [7]. Different types of MBL are known in P. aeruginosa, including VIM, IMP, German imipenemase, Sao Paulo metallo-β-lactamase, Seoul imipenemase, New Delhi metallo-β-lactamase and Adelaide imipenemase 1 [8-10]. The most common and widespread acquired MBL are those of the IMP and VIM types, which exhibit a worldwide distribution and for which several allelic variants are known.
Several previous studies from different parts of Iran showed a high frequency of MBL producing P. aeruginosa from different Hospital units [11-13]. The phenotypical and genotypical characterization of these isolates would be helpful for understanding the resistance mechanisms as well as its possible spread. We undertook this study to determine prevalence of MBL producing P. aeruginosa and to detect MBL-encoding genes (blaIMP, and blaVIM) and frequency of class 1 integron gene among clinical P. aeruginosa isolates in order to explore epidemiological approaches for understanding the distribution of resistant P. aeruginosa in hospital settings.
MATRIALS AND METHODS
Bacterial strains. A total of 300 various clinical specimens were obtained from Vali-E-Asr University Hospital in Zanjan during March 2011-January 2012. A number of 70/300 isolates were identified as P. aeruginosa by conventional bacteriological tests. The source of studied isolates was as follows: urine, 7 (10%); wounds, 2 (2.8%); respiratory tract, 54(77.1%); stool, 4(5.7%); sputum, 2(2.8%) and ocular, 1(1.4%). The isolates producing MBL were more prevalent in respiratory tract specimens.
Antibiotic susceptibility testing. Antimicrobial susceptibilities were determined by Kirby-Bauer disk diffusion according to the CLSI recommendation [14]. The antibiotic disks used were as follow: IPM (10 µg), ceftazidime (30 µg) gentamicin (10 µg), piperacillin (100 µg), ciprofloxacin (5 µg) and meropenem (10 µg) (Mast Diagnostic, Merseyside, U.K.). For quality control, P. aeruginosa standard strain (ATCC 27853) was used as a reference strain (MIC = 2.75). MIC for IPM was performed by micro broth dilution method.
Identification of metallo-beta lactamases. IPM-resistant isolates were evaluated for MBL production by double-disk synergy test (DDST) as described previously [11, 15]. DNA template preparation was performed as follows. A few colonies were removed from culture and suspended in 300 μL of sterile distilled water and boiled for 10 min. After centrifugation at 12000 × g for 10 min, the supernatant was used as a source of template for PCR amplification of blaIMP, blaVIM and class 1 integron genes. PCR amplification was performed in a solution containing 200 µM concentrations of dNTP, 10 pM of each primer, 1.5 mM MgCl2, 0.5 U Taq polymerase and 50 ng DNA templates in a final volume of 25 µL. The mentioned genes were amplified under the conditions mentioned in Table 1. Acinetobacter baumannii AC54/97 producing blaIMP gene and P. aeruginosa COL-1 producing blaVIM-2 were used as controls. The amplicon sizes and sequences of primers used in this study have been indicated in Table 2. The PCR products were analyzed by electrophoresis (70V, 30 min) in gels composed of 1.5% (w/v) agarose stained with ethidium bromide (5 μg/100 mL) and the PCR products were visualized under a UV light. For nucleotide sequence confirmation, several PCR products were also sequenced (Bioneer, South Korea). After revision with Chromas Lite software (version 2.01), DNA sequences were aligned with GenBank database and then assessed for P. aeruginosa assignment using BLAST software [16].
Table 1.
PCR programs for amplification of target genes
| Target gene | First denaturation | Cycle: 30 | Final extension | Reference | ||
|---|---|---|---|---|---|---|
| Extension | annealing | Denaturation | ||||
| bla VIM | 95°C 5 min |
72°C 7 min |
72°C 1 min |
58°C 1 min |
95°C 1 min |
[11] |
| bla IMP | 95°C 5 min |
72°C 10 min |
72°C 1 min |
54°C 40 s |
95°C 1 min |
[11 |
| bla IMP-1 | 94°C 5 min |
72°C 7 min |
72°C 45 s |
57°C 40 s |
94°C 1 min |
[11] |
| Int1* | 94°C 5 min |
72°C 7 min |
72°C 2 min |
52°C 1 min |
94°C 1 min |
[18] |
*Class 1 integrons
Table 2.
Primers used for detection of blaIMP, blaVIM, and intI genes and lengths of the PCR products
| Target gene | Primer sequence s ( 5' to 3') | Amplicon size (bp) |
|---|---|---|
| blaVIM | Fw: CCGATGGTGTTTGGTCGCAT Rv: GAATGCGCAGCACCAGGA |
391 |
| bla IMP | Fw: CTACCGCAGCAGAGTCTTTG Rv: AACCAGTTTTGCCTTACCAT |
587 |
| Int1 | Fw: GTTCGGTCAAGGTTCTG Rv: GCCAACTTTCAGCACATG |
923 |
Fw, forward primer; Rv, reverse primer
RESULTS
During the period of study, 300 isolates from different clinical samples were collected, of which 70 isolates of P. aeruginosa were identified by conventional bacteriological tests.
Of the 70 P. aeruginosa clinical isolates included in this study, 44.9% were resistant to piperacillin, 78.9% to ceftazidime, 55.1% to gentamicin, 40.6% to ciprofloxacin, 98.6% to meropenem and 63.8% to IPM. The isolates producing MBL were more resistant to ceftazidime, meropenem, and IPM and less resistant to piperacillin and ciprofloxacin. Table 3 shows the antibiotic resistance pattern of these strains.
Table 3.
Antimicrobial susceptibility testing results of 70 P. aeruginosa clinical isolates
| Antibiotic | Antibacterial class |
Susceptible
(%) |
Intermediate (%) |
Resistant
(%) |
|---|---|---|---|---|
| Imipenam | Carbapenemes | 36.2 | 0 | 63.8 |
| Meropenem | 1.4 | 0 | 98.6 | |
| Piperacillin | Extended-spectrum β-lactams | 50.7 | 4.3 | 44.9 |
| Ciprofloxacin | Fluoroquinolone | 58.0 | 1.4 | 40.6 |
| Gentamicin | Amino glycosides | 42.0 | 2.9 | 55.1 |
| Ceftazidime | Third generation Cephalosporin | 17.5 | 3.5 | 78.9 |
In this study, 44 (63.8%) isolates were found resistant to IPM by disk diffusion test. Of these 44 IPM resistant isolates, 41 (93%) isolates showed MIC≥4 µg/ml for IPM. Based on the DDST results 36 (87.8%) were confirmed to be MBL producers.
Among the 41 IPM-resistant isolates detected, PCR screening for the presence of blaIMP gene revealed that 10 (24.4%) isolates were positive for this gene (Fig. 1). Also, PCR amplification showed that 23 (56%) isolates carried blaVIM gene (Fig. 2). Screening for class I integron gene revealed that 31/41 (75.6%) of IPM-non-susceptible isolates carried class I integron, while only 42.3% (11/26) of IPM-sensitive isolates were positive for class I integrons (Fig. 3).
Fig. 1.
Gel electrophoresis of PCR products following amplification with specific primers for blaIMP gene (587 bp). Lanes: 1, IMP-1 positive control; 2, 4, 5, 6 and 7, clinical isolates for blaIMP gene; 3, negative isolate; 8, negative control; 9, 1 kb DNA Ladder
Fig. 2.
Gel electrophoresis of PCR products following amplification with specific primers for blaVIM gene (391bp). Lanes: 1, 1 kb DNA ladder; 2, blaVIM gene positive control; 3-7, clinical isolates for blaVIM gene; 8, negative control
Fig. 3.
Gel electrophoresis of PCR products following amplification with specific primers for int1 gene (923 bp). Lanes: 1, negative control; 2-10, clinical isolates for int1 gene; 11, int1 positive control; 12, negative isolate; 13, 1 kb DNA Ladder.
The sequencing of the PCR products confirmed that the nucleotide sequences obtained were identical to genes for blaIMP and blaVIM for P. aeruginosa (GenBank accession number: JQ766528, JQ766529and JQ766530).
DISCUSSION
This study illustrates screening for MBL producing P. aeruginosa isolates by DDST and molecular approach. Results showed that 36/41 (87.8%) of isolates were MBL positive, but PCR results confirmed presence of MBL genes only in 33/41 (80%) of isolates. The differences between phenotypic and genotypic detection of MBL producing P. aeruginosa isolates have been reported in previous investigations [11, 17, 18]. In the present study, we found a high frequency of P. aeruginosa strains carrying blaIMP gene that significantly was different (P<0. 05) from other parts of our country [11-13, 19]. In the studies from Ahwaz and Tehran Provinces, the scientists could not find any IMP-type MBL- producing P. aeruginosa strains [12, 20]. Prevalence of VIM-type MBL producing P. aeruginosa strains in the present study was 23 (56%) isolates that also significantly was different (P<0. 05) from other provinces of Iran [11, 12, 20] and it seems that this is the first report of IMP- and VIM- type MBL producing P. aeruginosa strains with a high frequency from Zanjan Province of Iran. It was demonstrated by several previous reports that the genes of both IMP- and VIM-type MBL are often encoded on mobile gene cassettes inserted into class 1 integrons [18]. Most of MBL-producing isolates (70.45%) carried class 1 integron gene, which can easily spread the resistance encoding genes among these isolates. Several studies have also reported different frequencies of MBL positive isolates carrying class 1 integrons [11, 21, 22]. While many underlying mechanisms may account for carbapenem resistance, the possession of MBL genes is of particular concern because they are able to hydrolyze most beta-lactams, including imipenem and meropenem, drugs considered of reserve for the treatment of Gram-negative pathogens especially in P. aeruginosa multidrug-resistant strains [23]. Therefore, the reliable detection of the MBL-producing strains is essential for the optimal treatment of infected patients and to control the nosocomial spread of resistance [7].
In conclusion, our results showed that the prevalence of antibiotic resistance and also both IMP and VIM-type MBL producing P. aeruginosa strains is higher than other parts of our country and hospital managers should emphasize on screening of clinically important isolates for MBL genes and implementation of quality assurance management for infectious control.
ACKNOWLEDGMENTS
We would like to thank all members of Clinical Microbiology Laboratory of Vali-E-Asr Hospital and also the staff of Biotechnology Department of School of Pharmacy, Zanjan University of Medical Sciences (ZUMS) for their cooperation. We are also very grateful to Dr. Shahcheraghi for providing us standard strains for PCR assay. We also acknowledge Research Deputy of ZUMS for the financial support.
References
- 1.Rodrigues AC, Chang MR, Nobrega GD, Rodrigues MS, Carvalho NC, Gomes BG, et al. Metallo-beta-lactamase and genetic diversity of Pseudomonas aeruginosa in intensive care units in Campo Grande, MS, Brazil. Braz J Infect Dis. 2011 May-Jun;15(3):195–9. doi: 10.1016/s1413-8670(11)70174-x. [DOI] [PubMed] [Google Scholar]
- 2.Behera B, Mathur P, Das A, Kapil A, Sharma V. An evaluation of four different phenotypic techniques for detection of metallo-beta-lactamase producing Pseudomonas aeruginosa. Indian J Med Microbiol. 2008 Jul-Sep;26(3):233–7. doi: 10.4103/0255-0857.39587. [DOI] [PubMed] [Google Scholar]
- 3.Chin BS, Han SH, Choi SH, Lee HS, Jeong SJ, Choi HK, et al. The characteristics of metallo-beta-lactamase-producing gram-negative bacilli isolated from sputum and urine: a single center experience in Korea. Yonsei Med J. 2011 Mar;52(2):351–7. doi: 10.3349/ymj.2011.52.2.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Dong F, Xu XW, Song WQ, Lu P, Yu SJ, Yang YH, et al. Characterization of multidrug-resistant and metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from a paediatric clinic in China. Chin Med J (Engl) 2008 Sep;121(17):1611–6. [PubMed] [Google Scholar]
- 5.Juan C, Zamorano L, Mena A, Alberti S, Perez JL, Oliver A. Metallo-beta-lactamase-producing Pseudo-monas putida as a reservoir of multidrug resistance elements that can be transferred to successful Pseudomonas aeruginosa clones. J Antimicrob Chemother. 2010 Mar;65(3):474–8. doi: 10.1093/jac/dkp491. [DOI] [PubMed] [Google Scholar]
- 6.Lepsanovic Z, Libisch B, Tomanovic B, Nonkovici Z, Balogh B, Fuzi M. Characterisation of the first VIM metallo-beta-lactamase-producing Pseudomonas aeruginosa clinical isolate in Serbia. Acta Microbiol Immunol Hung. 2008 Dec;55(4):447–54. doi: 10.1556/AMicr.55.2008.4.9. [DOI] [PubMed] [Google Scholar]
- 7.Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm. Clin Microbiol Rev. 2005 Apr;18(2):306–25. doi: 10.1128/CMR.18.2.306-325.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Valenza G, Joseph B, Elias J, Claus H, Oesterlein A, Engelhardt K, et al. First survey of metallo-beta-lactamases in clinical isolates of Pseudomonas aeruginosa in a German university hospital. Antimicrob Agents Chemother. 2010 Aug;54(8):3493–7. doi: 10.1128/AAC.00080-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009 Dec;53(12):5046–54. doi: 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cornaglia G, Giamarellou H, Rossolini GM. Metallo-beta-lactamases: a last frontier for beta-lactams. Lancet Infect Dis. 2011 May;11(5):381–93. doi: 10.1016/S1473-3099(11)70056-1. [DOI] [PubMed] [Google Scholar]
- 11.Yousefi S, Farajnia S, Nahaei MR, Akhi MT, Ghotaslou R, Soroush MH, et al. Detection of metallo-beta-lactamase-encoding genes among clinical isolates of Pseudomonas aeruginosa in northwest of Iran. Diagn Microbiol Infect Dis. 2010 Nov;68(3):322–5. doi: 10.1016/j.diagmicrobio.2010.06.018. [DOI] [PubMed] [Google Scholar]
- 12.Khosravi AD, Mihani F. Detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn Microbiol Infect Dis. 2008 Jan;60(1):125–8. doi: 10.1016/j.diagmicrobio.2007.08.003. [DOI] [PubMed] [Google Scholar]
- 13.Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol. 2010 Jul;33(3):243–8. [PubMed] [Google Scholar]
- 14.Wikler MA. Performance standards for antimicrobial susceptibility testing: Sixteenth informational supplement: Clinical and Laboratory Standards Institute. 2006;26(3):1–35. [Google Scholar]
- 15.Arakawa Y, Shibata N, Shibayama K, Kurokawa H, Yagi T, Fujiwara H, et al. Convenient test for screening metallo-beta-lactamase-producing gram-negative bacteria by using thiol compounds. J Clin Microbiol. 2000 Jan;38(1):40–3. doi: 10.1128/jcm.38.1.40-43.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990 Oct;215(3):403–10. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 17.Pena A, Donato AM, Alves AF, Leitao R, Cardoso OM. Detection of Pseudomonas aeruginosa producing metallo-beta-lactamase VIM-2 in a central hospital from Portugal. Eur J Clin Microbiol Infect Dis. 2008 Dec;27(12):1269–71. doi: 10.1007/s10096-008-0579-2. [DOI] [PubMed] [Google Scholar]
- 18.Yatsuyanagi J, Saito S, Harata S, Suzuki N, Ito Y, Amano K, et al. Class 1 integron containing metallo-beta-lactamase gene blaVIM-2 in Pseudomonas aeruginosa clinical strains isolated in Japan. Antimicrob Agents Chemother. 2004 Feb;48(2):626–8. doi: 10.1128/AAC.48.2.626-628.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bahar MA, Jamali S, Samadikuchaksaraei A. Imipenem -resistant Pseudomonas aeruginosa strains carry metallo -beta-lactamase gene bla(VIM) in a level I Iranian burn hospital. Burns. 2010 Sep;36(6):826–30. doi: 10.1016/j.burns.2009.10.011. [DOI] [PubMed] [Google Scholar]
- 20.Rezaei YH, Behzadian NG, Peerayeh SN, Mostsfaei M. Prevalence and detection of metallo-β-lactamase (MBL) producing Pseudomonas aeruginosa strains from clinical isolates in Iran. Ann Microbiol. 2007;57:293–6. [Google Scholar]
- 21.Cheng X, Wang P, Wang Y, Zhang H, Tao C, Yang W, et al. Identification and distribution of the clinical isolates of imipenem-resistant Pseudomonas aeruginosa carrying metallo-beta-lactamase and/or class 1 integron genes. J Huazhong Univ Sci Technolog Med Sci. 2008 Jun;28(3):235–8. doi: 10.1007/s11596-008-0301-8. [DOI] [PubMed] [Google Scholar]
- 22.Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo-beta-lactamase-positive Pseudomonas aeruginosa in Malaysia. J Med Microbiol. 2011 Jul;60(Pt 7):988–94. doi: 10.1099/jmm.0.029868-0. [DOI] [PubMed] [Google Scholar]
- 23.Lagatolla C, Tonin EA, Monti-Bragadin C, Dolzani L, Gombac F, Bearzi C, et al. Endemic carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-beta-lactamase determinants in European hospital. Emerg Infect Dis. 2004 Mar;10(3):535–8. doi: 10.3201/eid1003.020799. [DOI] [PMC free article] [PubMed] [Google Scholar]