Abstract
Endometriosis, a leading cause of pelvic pain and infertility, is characterized by ectopic growth of endometrial-like tissue and affects approximately 176 million women worldwide. The pathophysiology involves inflammatory and angiogenic mediators as well as estrogen-mediated signaling and novel, improved therapeutics targeting these pathways are necessary. The aim of this study was to investigate mechanisms leading to the establishment and progression of endometriosis as well as the effect of local treatment with Lipoxin A4 (LXA4), an anti-inflammatory and pro-resolving lipid mediator that we have recently characterized as an estrogen receptor agonist. LXA4 treatment significantly reduced endometriotic lesion size and downregulated the pro-inflammatory cytokines IL-1β and IL-6, as well as the angiogenic factor VEGF. LXA4 also inhibited COX-2 expression in both endometriotic lesions and peritoneal fluid cells, resulting in attenuated peritoneal fluid Prostaglandin E2 (PGE2) levels. Besides its anti-inflammatory effects, LXA4 differentially regulated the expression and activity of the matrix remodeling enzyme matrix metalloproteinase (MMP)-9 as well as modulating transforming growth factor (TGF)-β isoform expression within endometriotic lesions and in peritoneal fluid cells. We also report for first time that LXA4 attenuated aromatase expression, estrogen signaling and estrogen-regulated genes implicated in cellular proliferation in a mouse model of disease. These effects were observed both when LXA4 was administered prior to disease induction and during established disease. Collectively, our findings highlight potential targets for the treatment of endometriosis and suggest a pleotropic effect of LXA4 on disease progression, by attenuating pro-inflammatory and angiogenic mediators, matrix remodeling enzymes, estrogen metabolism and signaling, as well as downstream proliferative pathways.
Introduction
Endometriosis is a gynecological disorder, defined as the presence of endometrial-like tissue outside the uterine cavity, primarily on the pelvic peritoneum, ovaries, pouch of Douglas and rectovaginal septum. Endometriosis affects approximately 10% of women of reproductive age and is associated with local inflammation, the main clinical features being chronic pelvic pain, pain during intercourse and infertility [1]. The pathophysiology of this estrogen-dependent disease is enigmatic, with a poor correlation between the observed severity of the disease and the reported symptoms [2], [3]. The medical treatment of endometriosis includes progestagens, gonadotropin-releasing hormone agonists and oral contraceptives. However, the use of these therapeutics is limited due to the high cost, adverse side effects and recurrence of the disease after discontinuation of therapy [4], [5]. Thus, there is an unmet need for new drugs which inhibit the progression of endometriosis and alleviate pain and infertility, without affecting ovulation.
The progression of endometriosis is characterized by marked alternations in estrogen metabolism and pro-inflammatory mediator levels and activity [6], [7]. In the peritoneal cavity activated macrophages are the major source of IL-1β, IL-6, IL-8 and TNF-α and altered expression of these proinflammatory cytokines has been described in the peritoneal fluid of women with endometriosis. The disease is not only characterized by the presence of inflammatory lesions, but also by abnormal proliferation and growth of ectopic endometrial tissue [8], [9]. In endometrial implants, vascular endothelial growth factor (VEGF) and transforming growth factor-beta (TGF-β) induce neo-vascularization [2], [6], [10]. Moreover, IL-1β and TNF-α have been shown to increase the expression of MMPs in endometriotic implants, promoting matrix remodeling [11].
Lipoxins are endogenous eicosanoids, generally produced via a transcellular biosynthetic pathway, which exhibit both anti-inflammatory and pro-resolving properties [12]. LXA4 mediates anti-inflammatory activities through multiple receptors in vivo, the best characterized being lipoxin A4 receptor (ALX)/formyl peptide receptor 2 (FPR2) [13]. LXA4 binds with high affinity to ALX/FPR2, expressed by myeloid and non-myeloid cells [14], [15]. Other more recently characterized receptors are GPR32 [16] and the arylhydrocarbon receptor [17], the later study having used murine hepatoma cells. We have recently demonstrated that this lipid mediator is estrogenic in vitro and in vivo, binding to and signaling via ERα in endometrial epithelial cells [18], where it can counteract some 17β-estradiol (E2)-mediated responses. Lipoxins are known to be potent chemo-attractants for peripheral blood monocytes and induce non-phlogistic phagocytosis of apoptotic neutrophils by macrophages [19]. Macrophage recruitment would thus lead to the resolution of inflammation which is important for the restoration of tissue homeostasis [20]. However, macrophages, being a major source of prostaglandin E2 (PGE2), may also promote endometriosis [21]. Besides being implicated in symptomatic inflammation and pain, PGE2 plays a key role in the pathology by inducing E2 production in endometriotic cells.
Recent data have suggested a protective role of LXA4 in the development and progression of experimental endometriosis in mice [22], [23]. However, the mechanisms by which LXA4 mediates this action remain poorly understood. The aim of the present study was to better understand the mechanisms underlying this effect and to establish whether LXA4 is protective for established endometriosis, focusing on inflammatory and angiogenic mediators as well as genes involved in estrogen production and in downstream signaling.
Materials and Methods
Animals
All experimental procedures were approved by Canton de Vaud veterinary authorizations (protocol numbers 1884.2 and 2655.0). All surgery was performed under anesthesia and all efforts made to minimize suffering. Seven week old wild-type female C57BL/6J mice were purchased from Elevage Janvier, France, randomly housed ten per cage for one week prior to surgery and fed on mouse diet and water ad libitum. The animal house temperature was maintained at 26°C with light/dark cycles of 12 h under controlled humidified conditions. Age-matched mice were synchronized prior to all experiments, by keeping them in mixed cages for at least 1 week prior to surgery (Lee-Boot Effect). Mice were then caged 5 per cage, randomly assigned to each experimental group and underwent surgery at 8 weeks of age. Cycle stage was checked by microscopic examination of vaginal swabs at day 2, day 10 and day 21 and at day 21 the majority of mice were in estrus stage.
Surgical induction of endometriosis and in vivo treatment
The surgical method to induce endometriosis was modified from Vernon and Wilson [24] and Cumming and Metcalf [25]. Mice were randomly divided into three groups; sham, vehicle-treated with endometriosis (‘Veh’) and LXA4-treated with endometriosis (‘LXA4’). Briefly, mice were anesthetized using Xylazine (10 mg/kg, Rompun, Bayer Healthcare, Germany) and Ketamine (100 mg/kg, Ketavet, Phamacia&Upjohn GmbH, Germany) and their weight was recorded. Uterine tissue from one donor mouse was transplanted into two recipient mice. Mice underwent laparotomy by a midventral incision. Uterine horns were excised from age-matched syngeneic donor mice and kept in 37°C pre-warmed DMEM-F12 (Invitrogen, Switzerland) medium supplemented with penicillin (100 U/mL, Sigma) and streptomycin (100 µg/mL, Sigma) in petri dishes, opened longitudinally and six uniform, full thickness 2-mm punches were made using a dermal biopsy punch (Stiefel, Germany). Six endometrial biopsies were sutured to the peritoneal wall of recipient mice, three on each side. Sham mice were operated on identically except that silk sutures alone were placed on the peritoneal wall in the same positions as other groups. The abdominal incision was closed by a continuous suture and the skin with individual knots. Mice were kept warm and maintained under observation until full recovery.
LXA4 (Calbiochem, USA) was administered once daily by intraperitoneal (IP) injection at 5 µg/kg, a concentration demonstrated to be effective in preliminary experiments, in 200 µl sterile phosphate buffered saline (PBS, Laboratrium Dr. Bichsel AG, Switzerland). Sham and Veh groups received 200 µl EtOH/PBS IP in an identical manner. To assess the effect of LXA4 on de novo endometriosis, 5 µg/kg was administered once daily by IP injection 1 day prior (D−1) to surgery with treatment given daily thereafter until day 20. To assess the effect of LXA4 on established endometriosis treatment was commenced 6 days after disease induction (D+6) and performed in an identical manner. Mice were monitored daily and no adverse effects were observed based on food consumption, body weight, grooming behavior, or physical activity.
Evaluation of endometriotic lesions and sample collection
Mice were weighed and sacrificed by cervical dislocation under anaesthesia on the morning of day 21. 1 ml of sterile PBS was injected IP, the abdominal cavity was gently massaged and the peritoneal fluid was collected by centrifugation. Peritoneal lavage supernatants were transferred to sterile eppendorfs and stored at −80°C for ELISAs, while cell pellets were stored at −80°C for subsequent qRT-PCR analysis. Ectopic endometrial lesions were measured using calipers in two perpendicular diameters and the volume was calculated (V = 4/3πr2R, where r and R are two perpendicular radii and r<R). Lesions were flash frozen in liquid Nitrogen for qRT-PCR and stored at −80°C or fixed in 10% neutral buffered formalin for 24 h and embedded in paraffin for immunohistochemistry.
RNA isolation and qRT-PCR
Total RNA from individual endometriotic lesions and peritoneal fluid cells (PFCs) were extracted with TRIzol reagent (Invitrogen, USA) as per the manufacturer's instructions. 5–10 mg endometriotic lesion tissue and pelleted PFCs were homogenized using a polytron (VWR International AG, Switzerland) in 600 and 800 µl of TRIzol respectively, followed by chloroform/isopropanol extraction. RNA concentration and purity were checked using a Nanodrop ND2000 spectrophotometer (Thermo Scientific, USA). RNA samples with 260/280 nm absorbance ratio of ∼2 (∼1.8 for cDNA) were subjected to expression analyses. DNase (Promega, USA) treatment was followed by reverse transcription (RT), performed using the iScriptTM cDNA Synthesis kit (Bio-rad Laboratories, USA) according to the manufacturer's instructions. Quantitative PCR was performed using a Rotor-Gene 6000 (Corbett Research, Australia) instrument and SYBR Green technology (SensiMixTM SYBR kit, Quantace). Intron spanning and exon-specific primers were designed manually and synthesized by Microsynth (Switzerland). Primers were initially validated by executing standard curves (primer with single melting curve peak and amplification efficiency >80% were considered) and by confirming product size on an agarose gel with ethidium bromide staining. Primer sequences are listed in Table 1. The ΔΔCt method [26] was used to calculate relative changes in mRNA expression. Data were normalized with GAPDH as housekeeping gene and 100% assigned to the vehicle-treated experimental group.
Table 1.
| Gene Symbol | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) |
| m CCND-1 | CACCAATCTCCTCAACGACC | CTCACAGACCTCCAGCATCC |
| m COX-2 | CAGGTCATTGGTGGAGAGGTG | TGCTCATCACCCCACTCAGG |
| m CYP19a1 | CATTATCAGCAAGTCCTCAAGC | GAGGGTCAACACATCCACG |
| m ERα | GATGAAAGGCGGCATACGG | CAGGGCTATTCTTCTTAGTGTGC |
| m FPR2 | GTGTGCTGGGCAATGGAC | CTGAGCCCAGACTGGATGC |
| m GAPDH | GTCGGTGTGAACGGATTTG | AAGATGGTGATGGGCTTCC |
| m GREB-1 | GCACCACTTTGTTTTCAGCC | GTTGTCGGTGTGAAGGTTGG |
| m HIF-1α | TCACCAGACAGAGCAGGAAA | GTCACCTGGTTGCTGCAATA |
| m IL-1β | GGGCCTCAAAGGAAAGAATC | CTCTGCTTGTGAGGTGCTGA |
| m IL-6 | AGAAGGGCCTGGAATGAAAC | AAGACCCTGCTGGAACAAGA |
| m MMP-2 | CCAAGGTGGAAATCAGAGACA | CGAAGGGC ATACAAAAGCAAC |
| m MMP-3 | CCTGGAACAGTCTTGGCTC | CCTTGGCTGAGTGGTAGAGTC |
| m MMP-9 | GCCCTGGAACTCACACGACA | TTGGAAACTCACACGCCAGAAG |
| m MRP4 | CCTGTTCCAACTGTGTATCTGTC | GCACCATCTCACCATCTTTG |
| m c-Myc | GCAGACAGCCACGACGATG | CTCGCTCTGCTGTTGCTGG |
| m TGF-β1 | GAACCAAGGAGACGGAATACAG | CCATGAGGAGCAGGAAGG |
| m TGF-β2 | CCTGCTAATGTTGTTGCCC | CAATGTAAAGAGGGCGAAGG |
| m TGF-β3 | CGCAACCTGGAGGAGAACTG | CGTGCTATGGGTTGTGTCTG |
| m VEGF | AGTCCCATGAAGTGATCAAGTTCA | ATCCGCATGATCTGCATGG |
Cytokine and PGE2 quantification
Peritoneal lavage supernatants were thawed on ice and centrifuged at 12000rpm for 5′ at 4°C. The Biorad protein quantification kit (Bio-Rad Laboratories, USA) was used to normalize protein content. Samples containing 50 µg of total protein were assayed. VEGF and IL-1β cytokine levels were measured by ELISA according to the manufacturer's instructions (R&D Systems, USA).
Peritoneal fluid samples were diluted using water and methanol. The mixture was acidified with 2N HCl to pH 3.5 and applied to a C18 cartridge (Sep-Pak Classic, Waters®, IT) which was preactivated with methanol and water. The columns were washed with water and hexane, eluted by adding methyl-formate (1∶1 methanol and formic acid) and evaporated under a nitrogen stream. The residue was reconstituted in EIA Buffer and PGE2 quantification was performed using a monoclonal EIA kit (Cayman Chemical company, USA). Briefly, standards and samples containing 250 μg total protein were incubated overnight at 4°C in a plate pre-coated with goat anti-mouse IgG, with PGE2 Tracer (PGE2-Acetylcholineesterase conjugate) and mouse anti-PGE2 monoclonal antibody. The plate was subsequently washed, Ellman's reagent (5,5′-dithio-bis-(2-nitrobenzoic acid) and acetylcholine added and the absorbance was read at 405 nm.
Histology and immunohistochemistry
Formalin fixed and paraffin embedded tissues were cut into 5 µm sections and mounted on SuperFrost Ultras Plus glass slides (Thermo Scientific, Germany). For gross examination sections were stained with hematoxylin (Merck Chemicals, Switzerland) and eosin (HE staining) following standard protocols and mounted using permanent mounting medium (Eukitt, Sigma-Aldrich, Switzerland). For immunohistochemical staining, sections were deparaffinized (55°C for 20′) and rehydrated by serial bathing in xylene and EtOH solutions, washed in PBS for 5′ and antigen retrieval performed using Tris-EDTA pH 9 solution. Slides were incubated in 3% H2O2 solution for 10′ to block endogenous peroxidases, washed, incubated at RT in blocking buffer (PBS-4% BSA-0.05% Tween 20) for 30′ followed by washing. Diluted primary antibody (in PBS-1% BSA) was applied to the slides for 90′. The following antibodies were used: rabbit anti-mouse COX-2 (Cayman Chemical company, USA) and anti-mouse ERα (Serotec, USA). For COX-2 immunohistochemistry, inflamed joint sections from mice with induced arthritis were used to optimize the staining and for ERα, eutopic uterus sections were used as a positive control. Negative control sections were incubated alongside with the respective isotype control antibodies in dilution buffer, to control for specificity. After washing, horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology, USA) was added for 20′ with the diaminobenzidine (DAB), Dako kit, Denmark) substrate. Counterstaining was performed with hematoxylin, followed by dehydration steps and mounting. Slides were analyzed with a Nikon Eclipse E800 microscope and digital DXM1200 camera using ACT-1 software.
Zymography
Gelatinolytic activities of MMP-2 and MMP-9 were assessed using zymography. Briefly, 20 µl of peritoneal fluid sample, whose protein content had been normalized as detailed above, was mixed with non reducing loading buffer, loaded and electrophoresed through 8% SDS polyacrylamide gels containing 0.1% gelatin. Gels were then washed with renaturation buffer (2.5% Triton X-100) for 40′ followed by incubation in zymogram incubation buffer (50 mM Tris pH 7.8, 0.15 M NaCl, 10 mM CaCl2, 0.02%) for 20 h at 37°C. Subsequently, staining with 0.25% Coomassie G250, 30% methanol, 10% acetic acid for 30′ and destaining with 30% methanol, 10% acetic acid was performed until white bands appeared over blue background. Gels were scanned and white bands were quantified using Gel Analyzer software. The relative enzymatic activity was calculated as a percentage, samples from Veh-treated mice being assigned 100%.
Data analysis & statistics
At least 3 independent experiments were performed for each set of data with 10–15 mice per experimental group depending on the requirements of the experiments. When repeated experiments yielded similar results, the results of one representative experiment are shown. Results are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-tests for comparisons between 2 groups (analysis of endometriotic lesions, comparing Veh and LXA4) and one way analysis of variance (ANOVA) along with Tukey's multiple comparison tests to check the level of significance among multiple treatment groups (analysis of PFCs and PF, comparing sham, Veh and LXA4). Graph pad Prism version 6 (San Diego, CA, USA) was used; p<0.05 was considered statistically significant.
Results
Treatment with LXA4 reduces the growth of surgically induced endometriotic lesions
Wild-type female C57BL/6J mice underwent surgery at 8 weeks of age and developed endometriotic lesions within a few days, which increased in size over time. We analyzed lesion size and gene expression profiles at days 3 and 21 after surgery. As most consistent results were observed at day 21, data from this time point are shown. Three weeks after surgery we examined the presence and growth of endometriotic lesions in the peritoneal cavity of sham-operated control mice, vehicle-treated mice with endometriosis (‘Veh’) and LXA4-treated mice with endometriosis (‘LXA4’). Veh mice developed cyst-like lesions implanted on the peritoneal wall surrounded by adhesions to adjacent organs, validating our in vivo experimental model. No such structures were observed in sham-operated mice. A significant reduction in lesion volume was observed in LXA4 compared to Veh mice (Figure 1). Macroscopic histological examination of the lesions from Veh mice confirmed the presence of endometriotic glands surrounded by stroma. Treatment with LXA4 resulted in a more rudimentary architecture with less developed glands surrounded by little stroma (Figure 1).
Figure 1. Treatment with LXA4 decreases endometriotic lesion growth.
A. Representative pictures of a mouse with endometriotic lesions treated with vehicle (Veh, left panel) or LXA4 (right panel) for 21 days. Six uterine biopsies were implanted on the peritoneal wall, 3 on each side, in a minimum of 20 mice which were randomly divided into two groups: Veh- and LXA4-treated. Implanted tissues grew into enlarged cyst-like lesions by 21 days after endometriosis induction in the Veh group, while LXA4 treatment significantly reduced lesion size. B. Graphical representation of endometriotic lesions volume, in mm3 ± SEM (**p<0.01). C. Morphology of formalin-fixed, paraffin-embedded lesion sections stained with HE. Upper panels a. and b. Vehicle-treated mouse with endometriosis. Lower panels c. and d. LXA4-treated mouse with endometriosis. Images are representative of ten biological replicates.
LXA4 attenuates pro-inflammatory and pro-angiogenic mediators in endometriotic lesions and PFCs
We next investigated the mechanisms by which LXA4 treatment controlled the development of endometriotic lesions and the resulting inflammatory response. Genes involved in the initiation of inflammatory pathways were analysed by qPCR. At day 21, we observed significantly reduced IL-1β and IL-6 mRNA expression in endometriotic lesions and PFCs from LXA4-treated (Figure 2A, 2B, 2H, 2I) compared to Veh mice. In the absence of endometriosis i.e in sham mice, we didn't observe any noticeable effect of LXA4 on the main inflammatory mediators in initial experiments (data not shown), and therefore to conserve mice, this group was not included in subsequent experiments. LXA4 signals via ALX/FPR2, a G protein-coupled receptor, in many cell types including epithelial cells as well as innate immune cells such as macrophages and neutrophils. This receptor was significantly attenuated by LXA4 treatment in both lesions and peritoneal fluid cells (Figure 2C, 2J).
Figure 2. LXA4 significantly attenuates the expression of pro-inflammatory cytokines, angiogenic mediators, COX-2 and the PGE2 transporter MRP4.
A. IL-1β, B. IL-6, C. FPR2, D. HIF-1α, E. COX-2, F. VEGF and G. MRP4 mRNA expression in endometriotic lesions was analyzed by qPCR. H. IL-1β, I. IL-6, J. FPR2, K. HIF-1α, L. COX-2, M. VEGF and N. MRP4 mRNA expression was similarly quantified in PFCs. Ten mice were used per group (Sham, Veh-, LXA4-treatment) and samples analyzed for each individual mouse. Mice were sacrificed 21 days after endometriosis induction and Veh- or LXA4-treatment. Endometriotic lesions and PFCs were collected for RNA isolation and qPCR. Data were normalized to GAPDH and are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001 compared to Veh; ζζζ p<0.001 compared to Sham).
Under hypoxic and inflammatory conditions the Hypoxia-inducible factor-1α (HIF-1α) complex binds to hypoxia responsive elements leading to the transcriptional activation of many target genes including the pro-angiogenic mediator VEGF [27], [28]. Upon LXA4 treatment, we observed inhibition of HIF-1α expression (Figure 2D, 2K) and its target gene VEGF (Figure 2F, 2M) in both endometriotic lesions and PFCs, respectively. The activation of VEGF is also regulated by E2 and in turn induces cyclooxygenase-2 (COX-2) expression. LXA4 treatment resulted in a significant reduction in COX-2 expression in endometriotic lesions (Figure 2E) and PFCs (Figure 2L). Interestingly, LXA4 also downregulated the expression of the multidrug resistance protein 4 (MRP4/ABCC4), which transports PGE2 into the extracellular space [29], in endometriotic lesions (Figure 2G) and PFCs (Figure 2N).
We observed consistently elevated transcript levels of pro-inflammatory cytokines (IL-1β, IL-6) as well as ALX/FPR2, HIF-1α, COX-2, VEGF and MRP4 in PFCs of Veh- mice to compared to sham-operated mice (Figure 2H-2N), further confirming the implication of these mediators in the pathogenesis of disease.
LXA4 reduces peritoneal fluid pro-inflammatory cytokine and PGE2 levels, as well as COX-2 expression in lesions and peritoneal fluid cells
To confirm the qPCR data and further investigate the role of inflammation and angiogenesis in the development of endometriosis in our experimental model, IL-1β and VEGF contents in the peritoneal fluid were measured at the protein level by ELISA and found to be higher in veh-treated mice compared to sham (Figure 3A, 3B). Indeed, LXA4 treatment resulted in a significant reduction in the levels of these cytokines (Figure 3A, 3B). Moreover, PGE2 was significantly higher in Veh-treated mice compared to sham and reduced in the peritoneal fluid of LXA4 compared to Veh-treated mice (Figure 3C). We therefore performed immunohistochemical staining for COX-2 on endometriotric lesions. Intense COX-2 staining was mainly observed in the cytoplasm of stromal cells and macrophages, the latter cell type was also confirmed as F4/80 positive by immunohistochemical analysis (data not shown). LXA4 treatment attenuated the expression of COX-2 protein in endometriotic lesions in comparison to Veh-treated mice (Figure 3D).
Figure 3. LXA4 reduces peritoneal fluid cytokine and PGE2 levels as well as the expression of COX-2 in endometriotic lesions.
Peritoneal fluid from mice was collected at sacrifice (Sham, Veh-, LXA4; 3–5 mice/group) and ELISAs performed to quantify A. IL-1β, B. VEGF and C. PGE2 levels. Results are expressed as pg mediator/ml for 50 μg of total peritoneal fluid protein and presented as mean ± SEM (*p<0.05, ***p<0.001 compared to Veh; ζ<0.05 compared to Sham). D. Immunohistochemical staining for COX-2 was performed on transverse paraffin-embedded sections of lesions from Veh- and LXA4-treated mice. Representative stainings are shown with the negative control in the inset.
LXA4 modulates the expression of matrix remodelling mediators in endometriotic lesions and PFCs
Matrix metalloproteinases (MMPs) are involved in extracellular matrix degradation. In physiological conditions, macrophages are recruited to the peritoneal cavity to phagocytose the retrograded menstrual tissue [30], [31]. MMPs, and in particular MMP-9, facilitate the degradation of type IV collagen-containing basement membrane of extracellular matrix that separates the epithelial and stromal compartment. In our in vivo model, we analyzed MMP expression at day 21 in endometriotic lesions and PFCs. Treatment with LXA4 downregulated MMP-2 (Figure 4A) and MMP-3 (Figure 4B) but upregulated MMP-9 (Figure 4C) mRNA expression in endometriotic lesions. The expression of MMP-2 (Figure 4G) and MMP-9 (Figure 4H) was, however, similarly downregulated in PFCs by LXA4 treatment. Because of this differential expression, we further analysed MMP-2 and MMP-9 at the functional level. Enzymatic assay of peritoneal fluid samples confirmed increased MMP-9 activity (Figure 5A, 5B) under these conditions, whereas MMP-2 activity remained unchanged (Figure 5C, 5D).
Figure 4. LXA4 significantly inhibits the expression of matrix remodeling genes.
A. MMP-2, B. MMP-3, C. MMP-9, D. TGF-β1, E. TGF-β2, F. TGF-β3, G. MMP-2, H. MMP-9, I. TGF-β1, J. TGF-β2 gene expression in lesions and PFCs. Ten mice were used per group (Sham, Veh-, LXA4-treatment) and sacrificed 21 days after endometriosis induction. Lesions and PFCs were collected for qPCR analyses. Data were normalized to GAPDH and presented as mean ± SEM (***p<0.001 compared to Veh; ζζ p<0.01, ζζζ p<0.001 compared to Sham).
Figure 5. Gelatin zymography analysis of MMP-2 and MMP-9 activity.
A. Representative gel showing gelatinolytic activities of A. MMP-9, and C. MMP-2 in peritoneal fluid of Veh- and LXA4-treated mice (3–4 mice/group). Bar graphs represent the densitometric quantification of B. MMP-9 and D. MMP-2 activity, respectively. Unpaired t-tests were performed for comparison with the corresponding Veh-treatment group (**p<0.01).
Transforming growth factor beta (TGF-β) is a pleiotropic factor which is implicated in cell proliferation, differentiation, apoptosis, as well as in immune regulation. TGF-β1 and 3 are expressed in epithelial and stromal cells, while TGF-β2 is mainly expressed in the stroma [32]. In endometriotic lesions and PFCs, LXA4 treatment reduced TGF-β1 (Figure 4D, 4I) and TGF-β2 (Figure 4E, 4J) expression. However, TGF-β3 (Figure 4F) expression was augmented upon LXA4 in endometriotic lesions only, while it was not detected in PFCs.
LXA4 inhibits estrogen regulated genes in endometriotic lesions and PFCs
Estrogen production occurs from C19 steroids by the enzymatic activity of aromatase (CYP19a1) and is involved in the establishment and maintenance of endometriotic lesions [2], [33]. Interestingly, LXA4 downregulated CYP19a1 (Figure 6A) in endometriotic lesions. Aromatase mRNA expression was undetectable in PFCs and it was also not possible to detect estrogens in the corresponding peritoneal fluid using a sensitive LC MS/MS-based method (data not shown). Lesions do not provide sufficient material for such analyses. Estrogen receptor alpha (ERα) expression was likewise attenuated by LXA4 in lesions and PFCs (Figure 6B, 6F). Immunohistochemical analyses of ERα in lesions yielded similar results at the protein level (Figure 6I). Furthermore, LXA4 augmented PR expression in lesions (p<0.001, data not shown), while PR was undetectable in PFCs. Of note, as assessed by performing vaginal smears, cycling was not impacted in LXA4-treated mice (data not shown).
Figure 6. Mediators implicated in estrogen production and cellular proliferation in endometriotic lesions and PFCs are inhibited by LXA4 treatment.
mRNA was extracted from endometriotic lesions and PFCs and subjected to qPCR analysis to assess transcript levels of A. CYP19a1, B. ERα, C. GREB1, D. CCND1, E. c-Myc and F. ERα, G. CCND1, H. c-Myc, respectively. Results were normalized to GAPDH. Ten mice were used per group (Sham, Veh-, LXA4-treatment) and sacrificed 21 days after surgical induction of endometriosis. Data are presented as mean ± SEM. (***p<0.001 compared to Veh; ζζζ p<0.001 compared to Sham). I. Immunohistochemical staining for ERα was performed on transverse sections of endometriotic lesions from Veh- (left panel) and LXA4-treated (right panel) mice. The negative control is shown in the inset.
Cellular proliferation is a key factor underlying endometriosis development and progression [34]. Estrogens could promote endometrial tissue proliferation by activating specific genes involved in the cell cycle. An important gene in this respect is cyclin D1 (CCND1), involved in the regulation of G/S transition during the cell cycle [35]. c-Myc, a transcription factor, regulates a wide array of genes implicated in cell growth, proliferation and loss of differentiation [36], [37]. Notably, LXA4 attenuated mRNA expression of both CCND1 (Figure 6D and 6G) and c-Myc (Figure 6E and 6H) in endometriotic lesions and PFCs, respectively. In addition, the expression of the gene regulated by estrogen in breast cancer 1 (GREB1), involved in cell proliferation [38], was reduced in endometriotic lesions in LXA4-treated mice (Figure 6C). As would be expected for an epithelial molecule [38]–[40], GREB1 mRNA was undetectable in PFCs. These data provide further insight into the mechanisms leading to decreased lesion size that we observed upon LXA4 treatment.
LXA4 treatment also results in reduced progression of established endometriotic lesions
Patients attending Gynecology clinics because of pain and/or fertility problems already have some degree of endometriosis. To reflect this scenario and to determine whether our findings were therapeutically relevant, we investigated the effect of once-daily LXA4 treatment on established lesions. LXA4 treatment was thus commenced either the day prior to surgery (D−1) or on postoperative day 6 (D+6), a time-point when lesions on the peritoneal wall are already well developed. Interestingly, LXA4 reduced endometriotic lesion volume in established disease, i.e. when given from D+6 (Figure 7A). We then selected representative genes for the different pathways that we had observed to be implicated in the pathogenesis of endometriosis in our in vivo model, namely inflammation, angiogenesis, PGE2 production and transport, matrix remodeling and estrogen signaling. As observed when LXA4 was administered on D−1, IL-1β, COX-2, VEGF, MRP4, TGF-β1, TGF-β2, CYP19a1, ERα, GREB1 and c-Myc expression were significantly attenuated whereas MMP-9 and TGF-β3 were upregulated in endometriotic lesions in established endometriosis (Figure 7Ba-l). Gene expression profiling of PFCs yielded similar results (data not shown). IL-1β and VEGF protein levels in the peritoneal fluid were also significantly reduced by LXA4 treatment in both de novo and established disease (Fig. 7Ca, b).
Figure 7. LXA4 reduces the progression of established endometriosis by similar mechanisms.
Peritoneal endometriosis was surgically induced in mice divided into 3 groups (n = 7/group): Veh or LXA4 (5 μg/kg/mouse once daily) was administered from the day prior to surgery D(−1), or started at postoperative day 6 D(+6). Treatment was continued until day 21 after surgery, when the mice were sacrificed. A. Endometriotic lesion volume expressed as mean mm3 ± SEM (**p<0.01). B. a. IL-1β, b. COX-2, c. VEGF, d. MRP4, e. MMP-9, f. TGF-β1, g. TGF-β2, h. TGF-β3, i. CYP19a1, j. ERα, k. GREB1 and l. c-Myc mRNA expression was quantified in endometriotic lesions by qPCR and normalized to GAPDH. C. a. IL-1β and b. VEGF protein concentrations in the peritoneal fluid were measured by ELISA and expressed as pg/ml. All data are presented as mean ± SEM. Unpaired t-tests were performed for comparisons with the corresponding Veh-treated group (*p<0.05 **p<0.01, ***p<0.001, ιp<0.05, ι ιp<0.01, ι ι ιp<0.001).
Discussion
In the present study we examined the effect of LXA4 on the IL-1β-COX-2-PGE2-VEGF axis as well as on ERα and E2-regulated genes implicated in an experimental endometriosis model. It has been reported that the proliferation of ectopic endometrial tissue is influenced by various cytokines, lipid mediators and growth factors present in the peritoneal fluid. The ectopic endometrium itself may also produce pleiotropic factors promoting its survival and growth [2], [7]. The mechanisms by which endometrial tissues attach, proliferate, avoid immune surveillance and derive a local vasculature at ectopic sites are not well understood. We thus investigated various mediators in the peritoneal fluid, as well as in PFCs and endometriotic lesions in a mouse model of disease.
Lipoxins are endogenous eicosanoids produced during inflammatory events by platelet-leukocyte and leukocyte-epithelial interactions. Their anti-inflammatory and pro-resolving properties have been well described [41]. Using a surgically induced endometriosis model [25], [42], we first showed that treatment with LXA4 reduced the volume of endometriotic lesions in part by attenuating pro-inflammatory (IL-1β and IL-6) and pro-angiogenic (VEGF) mediators in endometriotic lesions and PFCs. Our results confirm and extend previous reports describing the inhibitory effect of LXA4 and a stable analogue on the development of endometriotic lesions [22], [23], [43], using a different murine experimental model where endometrial tissue fragments were injected into the peritoneum.
Inflammatory, hypoxic and metabolic conditions lead to HIF activation and the induction of VEGF expression [44], a feature of endometriosis pathology [45], [46]. We observed this pathway to be activated in endometriosis and LXA4 attenuated the expression of HIF-1α mRNA in endometriotic lesions and PFCs. Among the angiogenic factors, VEGF-A is the most studied and patients with endometriosis have increased VEGF levels in their peritoneal fluid compared to the peritoneal fluid and eutopic endometrium of healthy women [46], [47]. VEGF is thus involved in the pathogenesis of endometriosis and the inhibition of VEGF and/or its receptor may be a potential therapeutic target for the treatment of endometriosis as investigated in various animal models [45], [48]–[50]. In line with these findings, we observed that LXA4 significantly downregulated VEGF-A mRNA levels in endometriotic lesions and PFCs, as well as VEGF-A protein in the peritoneal fluid. These data suggest that LXA4's anti-angiogenic capacity results in decreased lesion size, corroborating previously published data [22], [23].
COX-2, the rate limiting enzyme in PGE2 biosynthesis, is increased in ectopic and eutopic endometrial tissues of endometriosis patients compared to healthy controls by cytokines such as IL-1β [51], [52]. PGE2 in turn strongly induces CYP19a1 (Aromatase), thus creating a positive feedback mechanism that maintains elevated local estradiol levels [2], [53], [54]. We observed elevated COX-2 expression in the lesions and PFCs of Veh-treated compared to sham mice. COX-2 expression in PFCs and endometriotic lesions was down-regulated upon LXA4 treatment. This was confirmed by immunohistochemical analyses, revealing markedly more intense COX-2 staining in endometriotic stromal cells and macrophages within lesions of Veh-treated compared to LXA4-treated mice. Furthermore, as compared to Veh-treated mice, LXA4 decreased CYP19a1 expression in endometriotic lesions, this coincided with decreased expression of E2-regulated molecules involved in cellular proliferation. We have recently demonstrated that the PGE2 transporter MRP4, a potential biomarker, is upregulated in peritoneal endometriosis in women, and that its expression is attenuated by LXA4 in vitro, signaling via ERα [55]. Here, we confirm those findings in vivo. The expression of MRP4, which functions to actively transport PGE2 and other molecules into the extracellular environment [29], was reduced in endometriotic lesions and PFCs, consistent with the decreased PGE2 peritoneal fluid levels. These findings support the hypothesis that LXA4 controls endometriotic lesion growth by inhibiting PGE2 production and it's efflux into the extracellular space where it could bind its receptors and initiate signaling pathways, resulting, in turn, in blunted estrogen production and proliferative mediator expression. It is tempting to speculate that the attenuated CYP19a1 expression we observed is due to decreased local PGE2 levels, this novel observation warrants further study to determine whether LXA4 downregulates CYP19a1 expression via this mechanism or via direct transcriptional repression.
Estrogen production and signaling are considered central to the pathogenesis of endometriosis [2], [7], [25]. Accordingly, in our surgically induced model using mice with intact uteri and ovaries, we observed increased CYP19a1, ERα and COX-2 expression in the endometriotic lesions of Veh-treated mice as well as increased PGE2 peritoneal fluid levels compared to sham mice, which were reduced in LXA4-treated animals. As ERα is dynamically regulated, we studied estrogen signaling by assessing the impact of LXA4 on the downstream effectors c-Myc, CCND1 and GREB1, key regulators of cell cycle progression and cellular proliferation, whose dysregulated expression and activation has been implicated in the pathogenesis of human cancers [36], [37], [40], [56], and in endometriotic cell proliferation [57]–[59]. GREB1, which we have shown is upregulated in peritoneal endometriosis [39], was also identified in genome wide association studies as containg a risk locus [60].
c-Myc is additionally considered a key player in alternative macrophage polarization [61]. We and others have reported that these molecules were overexpressed in peritoneal lesions and eutopic endometrium of endometriosis patients in comparison to control subjects [39],[62],[63]. In PFCs, CCND1 and c-Myc expression was higher in Veh-treated mice compared to control sham mice, suggesting a role in disease development. Interestingly, LXA4 treatment attenuated the expression of c-Myc, CCND1 and GREB1 in endometriotic lesions and that of c-Myc and CCND1 in PFCs. ERα was also reduced in both compartments. This data is in line with with our recent characterization of LXA4 as an estrogen receptor ligand, which can inhibit endogenous E2-mediated signaling under certain circumstances in a manner similar to the weak estrogen Estriol [64], [65], with which it shares structural similarity [18]. Hence, these results indicate that LXA4 exerts a local anti-proliferative effect, possibly via ERα, a receptor essential for endometriosis development in mice [66]. ALX/FPR2 to which LXA4 binds with high affinity and whose expression is upregulated under inflammatory conditions in in vitro experimental models [67] as well as in tissue biopsies from patients with inflammatory diseases [68], was also increased in lesions after surgical induction of endometriosis as assessed by a previous gene array analysis [69]. This receptor was significantly attenuated by LXA4 treatment in both lesions and peritoneal fluid cells, indicating either a reduction in receptor expression on cells in situ or decreased migration of ALX/FPR2-positive cells into these compartments.
To further understand the progression of the disease and the beneficial effects of LXA4 treatment, we analysed the expression of TGF-β, a mediator involved in cell proliferation and differentiation as well as in tissue repair. TGF-β is highly expressed in the endometrium and is secreted by endometrial glands and macrophages [32], [70]. Patients with endometriosis have higher levels of TGF-β1 in the peritoneal fluid compared to disease-free subjects [10], [71] and higher TGF-β2 mRNA expression was reported in the ectopic endometriotic lesions [72]. In our study, LXA4 differentially regulated TGF-β isoforms. Upon LXA4 treatment, the expression of TGF-β1 and 2 was attenuated in endometriotic lesions and PFCs, whereas TGF-β3 expression was upregulated in the same compartments. These findings merit further investigation as, besides being a growth factor, TGF-β was shown to be essential in wound healing and tissue repair by inducing extracellular matrix components [73]. We also assessed the activity of MMPs, involved in extracellular matrix degradation and thereby likely contributing to the local invasiveness of the lesions. Of note, Wu et al., reported that high levels of PGE2 in the peritoneal cavity of endometriotic patients inhibited MMP-9 activity, thus interfering with the clearance of endometrial tissue [21]. We observed elevated MMP-9 expression in endometriotic lesions, but not in PFCs, of LXA4-treated mice, where it was decreased. On a functional level, MMP-9 activity in this environment was increased, possibly contributing to decreased lesion size. However, these molecules are regulated in a complex manner and our findings likely reflect the expression patterns of the various TGF-β isotypes and MMP subtypes which may be both differentially regulated and compartmentalized as a function of specific anatomical sites and cell types during the course of disease.
Current standard medical treatments for endometriosis include therapies that control the production of estrogens alone or in combination with anti-inflammatory drugs [74], [75]. However, as well as being partially effective these treatments have considerable systemic side-effects including a hypo-estrogenic state that may lead to osteoporosis, as well as impaired fertility. Much published data suggest that endometriosis is a local rather than a systemic phenomenon with the induction of a local microenvironment in the peritoneal cavity which promotes ectopic lesion growth. We have demonstrated that LXA4 inhibits the progression of endometriosis via multiple local mechanisms. In this context, LXA4 regulates mediators which are responsible for diverse biological activities such as inflammation (IL-1β, IL-6, COX-2, PGE2), cell survival and proliferation (PGE2, CYP19a1, CCND1, c-Myc, GREB1), cell adhesion and invasion (MMPs, TGF-β) and angiogenesis (HIF-1α, VEGF, TGF-β). Further investigations are necessary to delineate whether the anti-inflammatory effects of LXA4 are directly exerted on epithelial and stromal cells and/or via trafficking immune cells. As macrophages are major sources of pro-inflammatory cytokines and PGE2, the subsets in the peritoneal cavity and in the lesions necessitate elucidation.
LXA4 inhibited the progression of endometriosis by attenuating local estrogen-mediated signaling in endometriotic lesions and in peritoneal fluid cells, and most likely reducing estrogen production. This, without affecting the estrous cycle as was also previously reported [22] or evoking any other noticeable adverse effects. We also made the novel and clinically relevant observation that LXA4 was effective when administered in the context of established disease. Taken together, LXA4 and its stable analogues warrant further consideration as potential therapeutics for the treatment of peritoneal endometriosis.
Acknowledgments
The authors thank Dr. C. Becker for showing us the endometriosis model, Dr. S. Leuba for cutting paraffin sections and Dr. H. Henry for estrogen LC-MS-MS and LXA4 purity analyses. The Department of Gynecology and Obstetrics, Prof. P. Hohlfeld, and the Institute of Pathology, CHUV are acknowledged for having provided infrastructural support.
Funding Statement
This study was funded by the Swiss National Science Foundation (grant number 310030-120761), as well as grants from the European Society of Clinical Microbiology and Infectious Diseases, the Novartis Foundation for Medical-Biological Research, the Roche Research Foundation and the Department of Gynecology and Obstetrics (GOC). DG is supported by the Swiss National Science Foundation (SCORE 32323B-111370 and 32003B-111371), the Faculty of Biology and Medicine of the University of Lausanne, Fondation Medi-CAL Futur, Fondation Pierre Mercier pour la Science and the Institute of Pathology. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Eskenazi B, Warner ML (1997) Epidemiology of endometriosis. Obstet Gynecol Clin North Am 24: 235–258. [DOI] [PubMed] [Google Scholar]
- 2. Bulun SE (2009) Endometriosis. The New England journal of medicine 360: 268–279. [DOI] [PubMed] [Google Scholar]
- 3. Gruppo Italiano per lo Studio dE (2001) Relationship between stage, site and morphological characteristics of pelvic endometriosis and pain. Hum Reprod 16: 2668–2671. [DOI] [PubMed] [Google Scholar]
- 4. Waller KG, Shaw RW (1993) Gonadotropin-releasing hormone analogues for the treatment of endometriosis: long-term follow-up. Fertility and sterility 59: 511–515. [DOI] [PubMed] [Google Scholar]
- 5. Vercellini P, Crosignani P, Somigliana E, Vigano P, Frattaruolo MP, et al. (2011) ‘Waiting for Godot’: a commonsense approach to the medical treatment of endometriosis. Hum Reprod 26: 3–13. [DOI] [PubMed] [Google Scholar]
- 6. Harada T, Iwabe T, Terakawa N (2001) Role of cytokines in endometriosis. Fertility and sterility 76: 1–10. [DOI] [PubMed] [Google Scholar]
- 7. Huhtinen K, Stahle M, Perheentupa A, Poutanen M (2012) Estrogen biosynthesis and signaling in endometriosis. Mol Cell Endocrinol 358: 146–154. [DOI] [PubMed] [Google Scholar]
- 8. Dmowski WP, Ding J, Shen J, Rana N, Fernandez BB, et al. (2001) Apoptosis in endometrial glandular and stromal cells in women with and without endometriosis. Hum Reprod 16: 1802–1808. [DOI] [PubMed] [Google Scholar]
- 9. Beliard A, Noel A, Foidart JM (2004) Reduction of apoptosis and proliferation in endometriosis. Fertility and sterility 82: 80–85. [DOI] [PubMed] [Google Scholar]
- 10. Oosterlynck DJ, Meuleman C, Waer M, Koninckx PR (1994) Transforming growth factor-beta activity is increased in peritoneal fluid from women with endometriosis. Obstet Gynecol 83: 287–292. [PubMed] [Google Scholar]
- 11. Sillem M, Prifti S, Koch A, Neher M, Jauckus J, et al. (2001) Regulation of matrix metalloproteinases and their inhibitors in uterine endometrial cells of patients with and without endometriosis. European journal of obstetrics, gynecology, and reproductive biology 95: 167–174. [DOI] [PubMed] [Google Scholar]
- 12. Serhan CN (2005) Lipoxins and aspirin-triggered 15-epi-lipoxins are the first lipid mediators of endogenous anti-inflammation and resolution. Prostaglandins, leukotrienes, and essential fatty acids 73: 141–162. [DOI] [PubMed] [Google Scholar]
- 13. Chiang N, Serhan CN, Dahlen SE, Drazen JM, Hay DW, et al. (2006) The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo. Pharmacological reviews 58: 463–487. [DOI] [PubMed] [Google Scholar]
- 14. Fiore S, Maddox JF, Perez HD, Serhan CN (1994) Identification of a human cDNA encoding a functional high affinity lipoxin A4 receptor. J? Exp Med 180: 253–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Fiore S, Romano M, Reardon EM, Serhan CN (1993) Induction of functional lipoxin A4 receptors in HL-60 cells. Blood 81: 3395–3403. [PubMed] [Google Scholar]
- 16. Krishnamoorthy S, Recchiuti A, Chiang N, Yacoubian S, Lee CH, et al. (2010) Resolvin D1 binds human phagocytes with evidence for proresolving receptors. Proceedings of the National Academy of Sciences of the United States of America 107: 1660–1665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Schaldach CM, Riby J, Bjeldanes LF (1999) Lipoxin A4: a new class of ligand for the Ah receptor. Biochemistry 38: 7594–7600. [DOI] [PubMed] [Google Scholar]
- 18. Russell R, Gori I, Pellegrini C, Kumar R, Achtari C, et al. (2011) Lipoxin A4 is a novel estrogen receptor modulator. FASEB? J 25: 4326–4337. [DOI] [PubMed] [Google Scholar]
- 19. Mitchell S, Thomas G, Harvey K, Cottell D, Reville K, et al. (2002) Lipoxins, aspirin-triggered epi-lipoxins, lipoxin stable analogues, and the resolution of inflammation: stimulation of macrophage phagocytosis of apoptotic neutrophils in vivo. Journal of the American Society of Nephrology: JASN 13: 2497–2507. [DOI] [PubMed] [Google Scholar]
- 20. Serhan CN, Savill J (2005) Resolution of inflammation: the beginning programs the end. Nature immunology 6: 1191–1197. [DOI] [PubMed] [Google Scholar]
- 21. Wu MH, Shoji Y, Wu MC, Chuang PC, Lin CC, et al. (2005) Suppression of matrix metalloproteinase-9 by prostaglandin E(2) in peritoneal macrophage is associated with severity of endometriosis. Am? J? Pathol 167: 1061–1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Chen QH, Zhou WD, Pu DM, Huang QS, Li T, et al. (2010) 15-Epi-lipoxin A(4) inhibits the progression of endometriosis in a murine model. Fertility and sterility 93: 1440–1447. [DOI] [PubMed] [Google Scholar]
- 23. Xu Z, Zhao F, Lin F, Chen J, Huang Y (2012) Lipoxin A4 inhibits the development of endometriosis in mice: the role of anti-inflammation and anti-angiogenesis. Am? J? Reprod Immunol 67: 491–497. [DOI] [PubMed] [Google Scholar]
- 24. Vernon MW, Wilson EA (1985) Studies on the surgical induction of endometriosis in the rat. Fertility and sterility 44: 684–694. [PubMed] [Google Scholar]
- 25. Cummings AM, Metcalf JL (1995) Induction of endometriosis in mice: a new model sensitive to estrogen. Reproductive toxicology 9: 233–238. [DOI] [PubMed] [Google Scholar]
- 26. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]
- 27. Becker CM, D'Amato RJ (2007) Angiogenesis and antiangiogenic therapy in endometriosis. Microvascular research 74: 121–130. [DOI] [PubMed] [Google Scholar]
- 28. Sivridis E, Giatromanolaki A, Gatter KC, Harris AL, Koukourakis MI, et al. (2002) Association of hypoxia-inducible factors 1alpha and 2alpha with activated angiogenic pathways and prognosis in patients with endometrial carcinoma. Cancer 95: 1055–1063. [DOI] [PubMed] [Google Scholar]
- 29. Reid G, Wielinga P, Zelcer N, van der Heijden I, Kuil A, et al. (2003) The human multidrug resistance protein MRP4 functions as a prostaglandin efflux transporter and is inhibited by nonsteroidal antiinflammatory drugs. Proc Natl Acad Sci? U? S? A 100: 9244–9249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Dunselman GA, Hendrix MG, Bouckaert PX, Evers JL (1988) Functional aspects of peritoneal macrophages in endometriosis of women. J? Reprod Fertil 82: 707–710. [DOI] [PubMed] [Google Scholar]
- 31. Lin YJ, Lai MD, Lei HY, Wing LY (2006) Neutrophils and macrophages promote angiogenesis in the early stage of endometriosis in a mouse model. Endocrinology 147: 1278–1286. [DOI] [PubMed] [Google Scholar]
- 32. Jones RL, Stoikos C, Findlay JK, Salamonsen LA (2006) TGF-beta superfamily expression and actions in the endometrium and placenta. Reproduction 132: 217–232. [DOI] [PubMed] [Google Scholar]
- 33. Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM, et al. (1994) Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 15: 342–355. [DOI] [PubMed] [Google Scholar]
- 34. Haining RE, Cameron IT, van Papendorp C, Davenport AP, Prentice A, et al. (1991) Epidermal growth factor in human endometrium: proliferative effects in culture and immunocytochemical localization in normal and endometriotic tissues. Hum Reprod 6: 1200–1205. [DOI] [PubMed] [Google Scholar]
- 35. Resnitzky D, Reed SI (1995) Different roles for cyclins D1 and E in regulation of the G1-to-S transition. Mol Cell Biol 15: 3463–3469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Pelengaris S, Khan M, Evan G (2002) c-MYC: more than just a matter of life and death. Nat Rev Cancer 2: 764–776. [DOI] [PubMed] [Google Scholar]
- 37. Oster SK, Ho CS, Soucie EL, Penn LZ (2002) The myc oncogene: MarvelouslY Complex. Adv Cancer Res 84: 81–154. [DOI] [PubMed] [Google Scholar]
- 38. Ghosh MG, Thompson DA, Weigel RJ (2000) PDZK1 and GREB1 are estrogen-regulated genes expressed in hormone-responsive breast cancer. Cancer research 60: 6367–6375. [PubMed] [Google Scholar]
- 39. Pellegrini C, Gori I, Achtari C, Hornung D, Chardonnens E, et al. (2012) The expression of estrogen receptors as well as GREB1, c-MYC, and cyclin D1, estrogen-regulated genes implicated in proliferation, is increased in peritoneal endometriosis. Fertility and sterility 98: 1200–1208. [DOI] [PubMed] [Google Scholar]
- 40. Rae JM, Johnson MD, Scheys JO, Cordero KE, Larios JM, et al. (2005) GREB 1 is a critical regulator of hormone dependent breast cancer growth. Breast Cancer Res Treat 92: 141–149. [DOI] [PubMed] [Google Scholar]
- 41. Serhan CN, Chiang N, Van Dyke TE (2008) Resolving inflammation: dual anti-inflammatory and pro-resolution lipid mediators. Nature reviews Immunology 8: 349–361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Grummer R (2006) Animal models in endometriosis research. Hum Reprod Update 12: 641–649. [DOI] [PubMed] [Google Scholar]
- 43. Chen Q, Zhou W, Pu D, Li Z, Huang Q, et al. (2009) The inhibitory effect of 15-R-LXA4 on experimental endometriosis. European journal of obstetrics, gynecology, and reproductive biology 145: 200–204. [DOI] [PubMed] [Google Scholar]
- 44. Shay JE, Celeste Simon M (2012) Hypoxia-inducible factors: crosstalk between inflammation and metabolism. Semin Cell Dev Biol 23: 389–394. [DOI] [PubMed] [Google Scholar]
- 45. Becker CM, Rohwer N, Funakoshi T, Cramer T, Bernhardt W, et al. (2008) 2-methoxyestradiol inhibits hypoxia-inducible factor-1{alpha} and suppresses growth of lesions in a mouse model of endometriosis. Am? J? Pathol 172: 534–544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Mahnke JL, Dawood MY, Huang JC (2000) Vascular endothelial growth factor and interleukin-6 in peritoneal fluid of women with endometriosis. Fertility and sterility 73: 166–170. [DOI] [PubMed] [Google Scholar]
- 47. Bourlev V, Iljasova N, Adamyan L, Larsson A, Olovsson M (2010) Signs of reduced angiogenic activity after surgical removal of deeply infiltrating endometriosis. Fertility and sterility 94: 52–57. [DOI] [PubMed] [Google Scholar]
- 48. Nap AW, Griffioen AW, Dunselman GA, Bouma-Ter Steege JC, Thijssen VL, et al. (2004) Antiangiogenesis therapy for endometriosis. J? Clin Endocrinol Metab 89: 1089–1095. [DOI] [PubMed] [Google Scholar]
- 49. Laschke MW, Elitzsch A, Vollmar B, Vajkoczy P, Menger MD (2006) Combined inhibition of vascular endothelial growth factor (VEGF), fibroblast growth factor and platelet-derived growth factor, but not inhibition of VEGF alone, effectively suppresses angiogenesis and vessel maturation in endometriotic lesions. Hum Reprod 21: 262–268. [DOI] [PubMed] [Google Scholar]
- 50. Ricci AG, Olivares CN, Bilotas MA, Meresman GF, Baranao RI (2011) Effect of vascular endothelial growth factor inhibition on endometrial implant development in a murine model of endometriosis. Reprod Sci 18: 614–622. [DOI] [PubMed] [Google Scholar]
- 51. Ota H, Igarashi S, Sasaki M, Tanaka T (2001) Distribution of cyclooxygenase-2 in eutopic and ectopic endometrium in endometriosis and adenomyosis. Hum Reprod 16: 561–566. [DOI] [PubMed] [Google Scholar]
- 52. Tamura M, Sebastian S, Yang S, Gurates B, Fang Z, et al. (2002) Interleukin-1beta elevates cyclooxygenase-2 protein level and enzyme activity via increasing its mRNA stability in human endometrial stromal cells: an effect mediated by extracellularly regulated kinases 1 and 2. J? Clin Endocrinol Metab 87: 3263–3273. [DOI] [PubMed] [Google Scholar]
- 53. Tamura M, Sebastian S, Yang S, Gurates B, Ferrer K, et al. (2002) Up-regulation of cyclooxygenase-2 expression and prostaglandin synthesis in endometrial stromal cells by malignant endometrial epithelial cells. A? paracrine effect mediated by prostaglandin E2 and nuclear factor-kappa B.? J? Biol Chem 277: 26208–26216. [DOI] [PubMed] [Google Scholar]
- 54. Bulun SE, Zeitoun KM, Takayama K, Sasano H (2000) Estrogen biosynthesis in endometriosis: molecular basis and clinical relevance. J? Mol Endocrinol 25: 35–42. [DOI] [PubMed] [Google Scholar]
- 55.Gori I, Rodriguez Y, Pellegrini C, Achtari C, Hornung D, et al.. (2013) Augmented epithelial multidrug resistance-associated protein 4 expression in peritoneal endometriosis: regulation by lipoxin A(4). Fertil Steril 99: 1965–1973 e1962. [DOI] [PubMed]
- 56. Felsher DW, Bishop JM (1999) Transient excess of MYC activity can elicit genomic instability and tumorigenesis. Proc Natl Acad Sci? U? S? A 96: 3940–3944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Shimizu Y, Takeuchi T, Mita S, Mizuguchi K, Kiyono T, et al. (2009) Dienogest, a synthetic progestin, inhibits the proliferation of immortalized human endometrial epithelial cells with suppression of cyclin D1 gene expression. Mol Hum Reprod 15: 693–701. [DOI] [PubMed] [Google Scholar]
- 58. Fu L, Osuga Y, Morimoto C, Hirata T, Hirota Y, et al. (2008) Dienogest inhibits BrdU uptake with G0/G1 arrest in cultured endometriotic stromal cells. Fertility and sterility 89: 1344–1347. [DOI] [PubMed] [Google Scholar]
- 59. Velarde MC, Aghajanova L, Nezhat CR, Giudice LC (2009) Increased mitogen-activated protein kinase kinase/extracellularly regulated kinase activity in human endometrial stromal fibroblasts of women with endometriosis reduces 3′,5′-cyclic adenosine 5′-monophosphate inhibition of cyclin D1. Endocrinology 150: 4701–4712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Nyholt DR, Low SK, Anderson CA, Painter JN, Uno S, et al. (2012) Genome-wide association meta-analysis identifies new endometriosis risk loci. Nat Genet 44: 1355–1359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Pello OM, De Pizzol M, Mirolo M, Soucek L, Zammataro L, et al. (2012) Role of c-MYC in alternative activation of human macrophages and tumor-associated macrophage biology. Blood 119: 411–421. [DOI] [PubMed] [Google Scholar]
- 62. Johnson MC, Torres M, Alves A, Bacallao K, Fuentes A, et al. (2005) Augmented cell survival in eutopic endometrium from women with endometriosis: expression of c-myc, TGF-beta1 and bax genes. Reprod Biol Endocrinol 3: 45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Meola J, Rosa e Silva JC, Dentillo DB, da Silva WA, Veiga-Castelli LC, et al. (2010) Differentially expressed genes in eutopic and ectopic endometrium of women with endometriosis. Fertility and sterility 93: 1750–1773. [DOI] [PubMed] [Google Scholar]
- 64. Clark JH, Markaverich BM (1984) The agonistic and antagonistic actions of estriol. J? Steroid Biochem 20: 1005–1013. [DOI] [PubMed] [Google Scholar]
- 65. Melamed M, Castano E, Notides AC, Sasson S (1997) Molecular and kinetic basis for the mixed agonist/antagonist activity of estriol. Mol Endocrinol 11: 1868–1878. [DOI] [PubMed] [Google Scholar]
- 66. Burns KA, Rodriguez KF, Hewitt SC, Janardhan KS, Young SL, et al. (2012) Role of estrogen receptor signaling required for endometriosis-like lesion establishment in a mouse model. Endocrinology 153: 3960–3971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Gronert K, Gewirtz A, Madara JL, Serhan CN (1998) Identification of a human enterocyte lipoxin A4 receptor that is regulated by interleukin (IL)-13 and interferon gamma and inhibits tumor necrosis factor alpha-induced IL-8 release. The Journal of experimental medicine 187: 1285–1294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Hashimoto A, Hayashi I, Murakami Y, Sato Y, Kitasato H, et al. (2007) Antiinflammatory mediator lipoxin A4 and its receptor in synovitis of patients with rheumatoid arthritis. J? Rheumatol 34: 2144–2153. [PubMed] [Google Scholar]
- 69.Pelch KE, Schroder AL, Kimball PA, Sharpe-Timms KL, Davis JW, et al.. (2010) Aberrant gene expression profile in a mouse model of endometriosis mirrors that observed in women. Fertil Steril 93: 1615–1627 e1618. [DOI] [PMC free article] [PubMed]
- 70. Polli V, Bulletti C, Galassi A, Borini A, Ciotti PM, et al. (1996) Transforming growth factor-beta 1 in the human endometrium. Gynecol Endocrinol 10: 297–302. [DOI] [PubMed] [Google Scholar]
- 71. Kupker W, Schultze-Mosgau A, Diedrich K (1998) Paracrine changes in the peritoneal environment of women with endometriosis. Hum Reprod Update 4: 719–723. [DOI] [PubMed] [Google Scholar]
- 72. Sotnikova NY, Antsiferova YS, Posiseeva LV, Shishkov DN, Posiseev DV, et al. (2010) Mechanisms regulating invasiveness and growth of endometriosis lesions in rat experimental model and in humans. Fertility and sterility 93: 2701–2705. [DOI] [PubMed] [Google Scholar]
- 73. Blobe GC, Schiemann WP, Lodish HF (2000) Role of transforming growth factor beta in human disease. N? Engl? J? Med 342: 1350–1358. [DOI] [PubMed] [Google Scholar]
- 74. Giudice LC (2010) Clinical practice. Endometriosis. N? Engl? J? Med 362: 2389–2398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75. Streuli I, de Ziegler D, Santulli P, Marcellin L, Borghese B, et al. (2013) An update on the pharmacological management of endometriosis. Expert Opin Pharmacother 14: 291–305. [DOI] [PubMed] [Google Scholar]







