Abstract
Epigenetic regulation of genes by DNA methylation contributes to cancer. The present study sought to identify methylation changes in the promoters of E-cadherin and p14ARF, two genes with potential cancer roles promoting in skin squamous cell carcinoma. Skin squamous cell carcinoma specimens were collected from 40 patients and normal skin tissues were collected from 30 individuals as controls. Promoter methylation was detected for E-cadherin and p14ARF by methylation-specific PCR. Correlations between E-cadherin or p14ARF methylation and clinicopathological parameters were analyzed by the Spearman rank test. Methylation of E-cadherin (37.5%) and p14ARF (60.0%) was significantly more common in skin squamous cell carcinoma than in normal skin tissue (10.0 and 6.7%, respectively; P < 0.05). Additionally, E-cadherin and p14ARF methylation were positively correlated within skin squamous cell carcinoma (r = 0.422, P = 0.007). Furthermore, methylation of these gene promoters in skin squamous cell carcinoma was correlated with differentiation, lymph node metastasis, and clinical stage (P < 0.05). Aberrant methylation in promoters of E-cadherin and p14ARF may promote occurrence and progression of skin squamous cell carcinoma.
Keywords: Skin squamous cell carcinoma, E-cadherin, p14ARF, DNA methylation, clinicopathological parameter
Introduction
Advances in epigenetic research, revealing DNA sequence-independent mechanisms of post-translational modification, have uncovered the importance of epigenetic changes in the process of tumorigenesis. For example, many tumors exhibit tumor suppressor genes with one or more methylated CpG islands; DNA methylation serves as a mark for post-translation inactivation or dysfunction. The inactivation of tumor suppressor genes promotes tumor formation and growth [1,2]. Indeed, abnormal methylation of gene promoters is an important contributor to cancer development because this feature has been noted in many tumor suppressor genes that control cell cycle, DNA repair, cell adhesion, and metastasis. Such changes in DNA methylation status appear to occur before tumor formation, rather than in parallel to or as a result of cell transformation. Identifying methylation changes that increase tumor susceptibility can help diagnose or prevent tumors. Importantly, recent studies have also determined that methylation changes can be identified in circulating DNA and other tissue/fluid samples, while still correlating with specific tumor development [3]. These findings indicate that methylation status can be investigated in individuals using minimally invasive methods and straightforward analyses [4,5], making it even more attractive as a diagnostic tool.
Several genes have been demonstrated to be inactivated in tumors because of methylation changes, particularly in their promoters. Hypermethylation of T-cadherin, NT5E, and SLIT2 have been associated with skin, breast, and ovarian cancer, respectively [6-8]. Because skin squamous cell carcinoma accounts for a large proportion of malignant neoplasms of the skin (about 80-90%) [9], and its incidence is increasing annually (particularly among older people), identifying genes in which methylation changes are associated with this cancer is important. E-cadherin, a cell adhesion protein, promotes stability of epithelial cell structures, promoting interaction with adjacent epithelial cells to prevent cell exfoliation. Inactivation of the E-cadherin gene can promote migration of tumor cells [10]. Indeed, E-cadherin expression is reduced in patients with endometrial carcinoma of the uterus, which significantly affects 5-year survival rates of affected patients [11]. Similarly, P14 (produced by p14ARF), a cyclin-dependent kinase inhibitor, is a complex regulatory factor of the cell cycle that plays an important role in inhibiting tumor occurrence and development. Inactivation of p14ARF is associated with a variety of tumors, such as bladder cancer, oral squamous cell carcinoma, and colon cancer [12,13].
The potential for inactivation of E-cadherin and/or p14ARF to result in cancer makes these genes good candidates for use as biomarkers. Here, methylation-specific PCR (MSP) was used to determine the methylation status of E-cadherin and p14ARF gene promoters in 40 samples of squamous cell carcinoma of the skin to identify their potential role in this disease and discover new approaches for early diagnosis.
Patients and methods
Patients and controls
From January 1 to December 31, 2011, samples of skin squamous cell carcinoma were collected from 40 patients who received surgical resection in the First Affiliated Hospital, Harbin Medical University, Harbin, China, and had been diagnosed by pathological confirmation. Each case had detailed clinical and pathological data and none received preoperative chemotherapy or radiotherapy. Cancer patients included 25 males and 15 females, ages 39 to 73 years (mean age 53.9 ± 11.6 years). Clinical evaluation indicated that 25 cases were highly or moderately differentiated, while 15 cases were poorly differentiated, and 27 cases had no lymph node metastasis, while 13 cases had lymph node metastasis. According to Broders’ pathological grading criteria for skin squamous cell carcinoma, 26 cases were grade I+II, and 14 cases were grade III+IV.
Normal tissue specimens were collected by surgical resection from 30 individuals to serve as a control group. These included 18 males and 12 females, ages 35 to 69 years (mean age 49.5 ± 10.4 years). No statistically significant difference was detected in age or gender between the two groups. All specimens were obtained under informed consent with approval by the Ethics Committee of our hospital (Identification No. HMU (Ethics) 20121103).
Methylation-specific polymerase chain reaction
Methylation-specific PCR (MSP) was used to detect the methylation status of E-cadherin and p14ARF promoter regions. Genomic DNA was isolated from tissue using proteinase K digestion and phenol/chloroform extraction. The Wizard clean-up system kit (Promega Corporation, USA) was used to purify DNA according to manufacturer instruction. Unmethylated DNA was converted using hydrosulfite modification, as follows: 2 µL DNA were added to 50 µL sterilized twice-distilled water and 3.3 µL of 3 mol/L NaOH. The reaction mix was denatured at 37°C for 15 min, 30 mL of 10 mol/L hydroquinone and 520 µL of 3 mol/L sodium bisulfite were added, and the mix was covered with 200 µL liquid paraffin. The reaction was performed at 55°C for 16 h. Subsequently, 2 µL purified and modified DNA were combined with 1 µL upstream and 1 µL downstream primers for the target genes (see Table 1), 12.5 µL 2 X Taq PCR MasterMix (TIANGEN, Biotech Co. Led, China), and 8.5 µL ribozyme-free water for PCR amplification. Thermal cycling conditions were as follows: pre-denaturation at 95°C for 5 min; 35 cycles of 94°C for 45 s, 65°C for 45 s (E-cadherin) or 60°C for 45 s (p14ARF), and 72°C for 1 min, and re-extension at 72°C for 7 min. PCR amplification products were separated on 2% agarose gel. If only unmethylated bands were observed during electrophoresis of MSP products, the sample was recorded as unmethylated (U); if methylated bands were observed, the sample was recorded as methylated (M).
Table 1.
Primer sequences for methylation-specific PCR analysis
| Primers | Sense sequences | Antisense sequences | Product size |
|---|---|---|---|
| E-cadherin - U | TAATTTTAGGTTAGAGGGTTATTGT | CACAACCAATCAACAACACA | 151 bp |
| E-cadherin - M | TTAGGTTAGAGGGTTATCGCGT | TAACTAAAAATTCACCTACCGAC | 150 bp |
| p14ARF - U | TTTTTGGTGTTAAAGGGTGGTGTAGT | CACAAAAACCCTCACTCACAACAA | 132 bp |
| p14ARF - M | GTGTTAAAGGGCGGCGTAG | AAAACCCTCACTCGCGACGA | 122 bp |
Statistical methods
SPSS13.0 statistical software was used for statistical analysis. The χ2 test was used to compare methylation status of E-cadherin or p14ARF between normal and cancer tissues, and Spearman correlation was used to analyze the relationship of methylation status between E-cadherin and p14ARF. P < 0.05 was considered to be statistically significant.
Results
Increased methylation of E-cadherin and p14ARF in skin carcinoma
Methylation of E-cadherin and p14ARF was significantly more common in skin squamous cell carcinoma tissues (37.5 and 60.0%, respectively) than in normal skin tissues (10.0 and 6.7%, respectively, P < 0.05; Figure 1 and Table 2). Further, methylation of E-cadherin was positively correlated with methylation of p14ARF in skin squamous cell carcinoma tissues (r = 0.422 P = 0.007; Table 3).
Figure 1.
Electrophoretogram of E-cadherin and p14ARF methylation in skin squamous cell carcinoma and normal skin tissue. PCR amplification products were separated on 2% agarose gel. If only unmethylated bands were observed during electrophoresis of MSP products, the sample was recorded as unmethylated; if methylated bands were observed, the sample was recorded as methylated. Note: Ca = skin squamous cell carcinoma (Stage II); N = normal skin; M = methylated; U = unmethylated.
Table 2.
Methylation of E-cadherin and p14ARF in skin squamous cell carcinoma and normal skin tissues [N (%)]
| Sample | N | E-cadherin | p14ARF | ||
|---|---|---|---|---|---|
|
|
|||||
| Unmethylated | Methylated | Unmethylated | Methylated | ||
| Skin squamous cell carcinoma | 40 | 25 (62.5) | 15 (37.5) | 16 (40.0) | 24 (60.0) |
| Normal skin tissues | 30 | 27 (90.0) | 3 (10.0) | 28 (93.3) | 2 (6.7) |
| χ2 | 6.787 | 20.886 | |||
| P | 0.009 | 0.001 | |||
Data are reported as number of samples with percent in parentheses.
Table 3.
Correlation between E-cadherin and p14ARF methylation in skin squamous cell carcinoma [N (%)]
| E-cadherin | N | p14ARF | |
|---|---|---|---|
|
| |||
| Unmethylated | Methylated | ||
| Unmethylated | 25 | 14 (56.0) | 11 (44.0) |
| Methylated | 15 | 2 (13.3) | 13 (86.7) |
| Total | 40 | 16 (40.0) | 24 (60.0) |
Data are reported as number with percent in parentheses. r = 0.422; P = 0.007 (Spearman correlation test).
Correlation between methylation of E-cadherin and p14ARF and clinicopathological parameters
To determine whether the increased methylation in cancer tissue correlated with disease progression, the methylation status of E-cadherin and p14ARF was compared to the clinicopathological characteristics. Table 4 shows that methylation of both genes in skin squamous cell carcinoma tissues was correlated with differentiation degree, lymph node metastasis, and clinical stage (P < 0.05), but not with gender or age.
Table 4.
Correlation between methylation of E-cadherin and p14ARF and clinicopathological parameters in skin squamous cell carcinoma [N (%)]
| Characteristic | N | E-cadherin | p14ARF | ||||||
|---|---|---|---|---|---|---|---|---|---|
|
| |||||||||
| U | M | χ2 | P | U | M | χ2 | P | ||
| Gender | |||||||||
| Male | 25 | 15 (60.0) | 10 (40.0) | 0.178 | 0.673 | 9 (36.0) | 16 (64.0) | 0.444 | 0.505 |
| Female | 15 | 10 (66.7) | 5 (33.3) | 7 (46.7) | 8 (53.3) | ||||
| Age (years) | |||||||||
| < 60 | 25 | 16 (64.0) | 9 (36.0) | 0.064 | 0.800 | 11 (44.0) | 14 (56.0) | 0.444 | 0.505 |
| ≥ 60 | 15 | 9 (60.0) | 6 (40.0) | 10 (66.7) | 5 (33.3) | ||||
| Pathological differentiation | |||||||||
| High+Moderate | 25 | 20 (80.0) | 5 (20.0) | 8.711 | 0.003 | 14 (56.0) | 11 (44.0) | 7.111 | 0.008 |
| Low | 15 | 5(33.3) | 10 (66.7) | 2 (13.3) | 13 (86.7) | ||||
| Lymph node metastasis | |||||||||
| No | 27 | 21 (77.8) | 6 (22.2) | 8.274 | 0.004 | 15 (55.6) | 12 (44.4) | 8.376 | 0.004 |
| Yes | 13 | 4 (30.8) | 9 (369.2) | 1 (7.7) | 12 (92.3) | ||||
| Clinical stage | |||||||||
| I+II | 26 | 21 (80.8) | 5 (19.2) | 10.579 | 0.001 | 14 (53.8) | 12 (46.2) | 5.934 | 0.015 |
| III+IV | 14 | 4 (28.6) | 10 (71.4) | 2 (14.3) | 7 (85.7) | ||||
The χ2 test was used to compare methylation status between normal and cancer tissues. U = unmethylated; M = methylated.
Discussion
Cancer results from the loss of gene/protein functions because of a variety of different factors, including genetic, epigenetic, and environmental phenomena. In the case of E-cadherin, loss of expression has been linked to the development and progression of a wide variety of tumors, including squamous cell carcinoma [10,14]. Recent evidence indicates that the primary mechanism of E-cadherin inactivation is the abnormal methylation of promoter CpG islands. A high frequency of E-cadherin methylation has been identified in prostate cancer and has been correlated with poor differentiation and rapid progression [15,16]. Furthermore, a study of eyelid sebaceous gland carcinoma demonstrated increased E-cadherin promoter methylation, correlating to loss of protein expression and disease progression [17]. Similarly, we found that E-cadherin was more likely to be methylated in skin squamous cell carcinoma tissues than in normal tissues, and that this methylation correlated with disease severity. Therefore, epigenetic regulation of E-cadherin through promoter methylation appears to promote progression of skin squamous cell carcinoma, consistent with findings for other tumor types.
Loss of the tumor suppressor p14 through pARF14 methylation has also been reported [18]. Hypermethylation of pARF14 is involved in dysregulation of the p53 and RB pathways, inhibiting their tumor suppressive functions, as previously shown in skin squamous cell carcinoma [19]. In addition, inactivation of pARF14 appears to have a synergistic effect with Epstein-Barr virus infection to promote the occurrence of gastrointestinal tumors [20]. Here, methylation of p14ARF was more common in skin squamous cell carcinoma tissues than in normal skin tissues. Additionally, methylation of this gene correlated with differentiation degree, lymph node metastasis, and clinical stage, as well as with E-cadherin methylation. These findings suggest that aberrant p14ARF promoter methylation, as with E-cadherin, promotes squamous cell carcinoma of the skin.
In summary, E-cadherin and p14ARF methylation is abnormal in skin squamous cell carcinoma. Detection of methylation status of these genes may be useful as a biological indicator for and early diagnosis or prognosis estimation in patients with this disease. Further work in identifying a demethylation reagent to restore proper methylation status in these genes may result in new reagents to prevent E-cadherin and p14ARF methylation-related skin squamous cell carcinoma.
Disclosure of conflict of interest
None.
References
- 1.Luczak MW, Jagodzinski PP. The role of DNA methylation in cancer development. Folia Histochem Cytobiol. 2006;44:143–154. [PubMed] [Google Scholar]
- 2.Moskalev EA, Eprintsev AT, Hoheisel JD. DNA methylation profiling in cancer: from single nucleotides towards methylome. Mol Biol (Mosk) 2007;41:793–807. [PubMed] [Google Scholar]
- 3.Wu HC, Wang Q, Yang HI, Tsai WY, Chen CJ, Santella RM. Global DNA methylation levels in white blood cells as a biomarker for hepatocellular carcinoma risk: a nested case-control study. Carcinogenesis. 2012;33:1340–1345. doi: 10.1093/carcin/bgs160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chan KC, Lai PB, Mok TS, Chan HL, Ding C, Yeung SW, Lo YM. Quantitative analysis of circulating methylated DNA as a biomarker for hepatocellular carcinoma. Clin Chem. 2008;54:1528–1536. doi: 10.1373/clinchem.2008.104653. [DOI] [PubMed] [Google Scholar]
- 5.Yu J, Zhu T, Wang Z, Zhang H, Qian Z, Xu H, Gao B, Wang W, Gu L, Meng J, Wang J, Feng X, Li Y, Yao X, Zhu J. A novel set of DNA methylation markers in urine sediments for sensitive/specific detection of bladder cancer. Clin Cancer Res. 2007;13:7296–7304. doi: 10.1158/1078-0432.CCR-07-0861. [DOI] [PubMed] [Google Scholar]
- 6.Takeuchi T, Liang SB, Matsuyoshi N, Zhou S, Miyachi Y, Sonobe H, Ohtsuki Y. Loss of T-cadherin (CDH13, H-cadherin) expression in cutaneous squamous cell carcinoma. Lab Invest. 2002;82:1023–1029. doi: 10.1097/01.lab.0000025391.35798.f1. [DOI] [PubMed] [Google Scholar]
- 7.Lo Nigro C, Monteverde M, Lee S, Lattanzio L, Vivenza D, Comino A, Syed N, McHugh A, Wang H, Proby C, Garrone O, Merlano M, Hatzimichael E, Briasoulis E, Gojis O, Palmieri C, Jordan L, Quinlan P, Thompson A, Crook T. NT5E CpG island methylation is a favourable breast cancer biomarker. Br J Cancer. 2012;107:75–83. doi: 10.1038/bjc.2012.212. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Dong R, Yu J, Pu H, Zhang Z, Xu X. Frequent SLIT2 promoter methylation in the serum of patients with ovarian cancer. J Int Med Res. 2012;40:681–686. doi: 10.1177/147323001204000231. [DOI] [PubMed] [Google Scholar]
- 9.Kraljik N, Rosso M, Ageel A, Sepic T, Gmajnic R. The incidence of skin squamous cell carcinoma in Osijek-Baranja County - an epidemiological study. Coll Antropol. 2011;35:77–80. [PubMed] [Google Scholar]
- 10.Berx G, van Roy F. Involvement of members of the cadherin superfamily in cancer. Cold Spring Harb Perspect Biol. 2009;1:a003129. doi: 10.1101/cshperspect.a003129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Yi TZ, Guo J, Zhou L, Chen X, Mi RR, Qu QX, Zheng JH, Zhai L. Prognostic value of E-cadherin expression and CDH1 promoter methylation in patients with endometrial carcinoma. Cancer Invest. 2011;29:86–92. doi: 10.3109/07357907.2010.512603. [DOI] [PubMed] [Google Scholar]
- 12.Kominami K, Nagasaka T, Cullings HM, Hoshizima N, Sasamoto H, Young J, Leggett BA, Tanaka N, Matsubara N. Methylation in p14(ARF) is frequently observed in colorectal cancer with low-level microsatellite instability. J Int Med Res. 2009;37:1038–1045. doi: 10.1177/147323000903700408. [DOI] [PubMed] [Google Scholar]
- 13.Kordi-Tamandani DM, Moazeni-Roodi A, Rigi Ladez MA, Hashemi M, Birjandian E, Torkamanzehi A. Analysis of methylation patterns and expression profiles of p14ARF gene in patients with oral squamous cell carcinoma. Int J Biol Markers. 2010;25:99–103. [PubMed] [Google Scholar]
- 14.Alt-Holland A, Sowalsky AG, Szwec-Levin Y, Shamis Y, Hatch H, Feig LA, Garlick JA. Suppression of E-cadherin function drives the early stages of Ras-induced squamous cell carcinoma through upregulation of FAK and Src. J Invest Dermatol. 2011;131:2306–2315. doi: 10.1038/jid.2011.188. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Maruyama R, Toyooka S, Toyooka KO, Virmani AK, Zöchbauer-Müller S, Farinas AJ, Minna JD, McConnell J, Frenkel EP, Gazdar AF. Aberrant promoter methylation profile of prostate cancers and its relationship to clinicopathological features. Clin Cancer Res. 2002;8:514–519. [PubMed] [Google Scholar]
- 16.Graff JR, Herman JG, Lapidus RG, Chopra H, Xu R, Jarrard DF, Isaacs WB, Pitha PM, Davidson NE, Baylin SB. E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res. 1995;55:5195–5199. [PubMed] [Google Scholar]
- 17.Jayaraj P, Sen S, Sharma A, Chosdol K, Kashyap S, Rai A, Pushker N, Bajaj MS, Ghose S. Epigenetic inactivation of the E-cadherin gene in eyelid sebaceous gland carcinoma. Br J Dermatol. 2012;167:583–590. doi: 10.1111/j.1365-2133.2012.10968.x. [DOI] [PubMed] [Google Scholar]
- 18.Guney S, Jardin F, Bertrand P, Mareschal S, Parmentier F, Picquenot JM, Tilly H, Bastard C. Several mechanisms lead to the inactivation of the CDKN2A (P16), P14ARF, or CDKN2B (P15) genes in the GCB and ABC molecular DLBCL subtypes. Genes Chromosomes Cancer. 2012;51:858–867. doi: 10.1002/gcc.21970. [DOI] [PubMed] [Google Scholar]
- 19.Murao K, Kubo Y, Ohtani N, Hara E, Arase S. Epigenetic abnormalities in cutaneous squamous cell carcinomas: frequent inactivation of the RB1/p16 and p53 pathways. Br J Dermatol. 2006;155:999–1005. doi: 10.1111/j.1365-2133.2006.07487.x. [DOI] [PubMed] [Google Scholar]
- 20.Geddert H, zur Hausen A, Gabbert HE, Sarbia M. EBV-infection in cardiac and non-cardiac gastric adenocarcinomas is associated with promoter methylation of p16, p14 and APC, but not hMLH1. Cell Oncol (Dordr) 2011;34:209–214. doi: 10.1007/s13402-011-0028-6. [DOI] [PubMed] [Google Scholar]