Skip to main content
PLOS One logoLink to PLOS One
. 2015 Feb 6;10(2):e0116547. doi: 10.1371/journal.pone.0116547

Detection of Japanese Encephalitis Virus Genotype V in Culex orientalis and Culex pipiens (Diptera: Culicidae) in Korea

Hyunwoo Kim 1,3,, Go-Woon Cha 2,, Young Eui Jeong 2,4, Wook-Gyo Lee 1, Kyu Sik Chang 1, Jong Yul Roh 1, Sung Chan Yang 1, Mi Yeoun Park 1, Chan Park 2, E-Hyun Shin 1,*
Editor: Matthew Baylis5
PMCID: PMC4319795  PMID: 25658839

Abstract

Japanese encephalitis virus (JEV) causes significant viral encephalitis and is distributed throughout the Asian countries. The virus is known to be transmitted by Culex tritaeniorhynchus, which mainly breeds in rice paddies in Korea. In this study, we investigated the presence of other mosquito species that can transmit JEV as a second or regional vector. We selected five cities where patients have experienced JE in the last 5 years as mosquito-collecting locations and subdivided them into four collection sites according to the mosquito habitats (cowshed, downtown area, forest, and swamp). Mosquitoes were caught using the BG-Sentinel trap, CDC black-light trap, Fay-Prince trap, and Gravid trap. A total of 993 pools from 22,774 mosquitoes were prepared according to their species, collection date, and site. We performed a SYBR Green 1-based real-time RT-PCR assay to detect JEV from the mosquito pools. A total of six JEV-positive pools were detected from Culex orientalis and Culex pipiens caught in the Gangwon-do and Gyeonngi-do provinces. All the detected JEVs were revealed as genotype V by phylogenetic analysis of the envelope gene. Our findings confirm that a new genotype of JEV was introduced in Korea and suggest that two mosquito species may play a role in JEV transmission.

Introduction

Japanese encephalitis virus (JEV) is a mosquito-borne RNA virus in the genus Flavivirus (family Flaviviridae) and causes approximately 30,000–50,000 human encephalitis cases each year throughout Asian countries [1,2]. JEV is of a circulating nature, forming a transmission cycle from mosquitoes to birds and swine, which together form the virus’s reservoir, and the swine act as an amplifying host. Thereafter, the cycle continues to mosquitoes, and then to humans or some incidentally infected vertebrates. JEV has five genotypes (I–V) based on the genetic distances of the envelope gene or complete genome sequences when it has only one serotype [2].

JEV is distributed in temperate and tropical areas of eastern and southern Asia, extending to India and Pakistan in the west. In these areas, rice irrigation is a common agricultural method. This ecosystem provides a good habitat for paddy-breeding mosquitoes such as Culex tritaeniorhynchus, the major vector mosquito of JEV in most parts of Asia, and other Culex mosquitoes that play roles as secondary or regional vectors [3]. Since these species share a similar ecological niche in irrigated rice paddies, JE is largely associated with rural areas [4]. In South Korea, JE has been well controlled after vaccine importation in the late 1970s. An extensive surveillance program, the JE epidemic forecast program, has been conducted since 1975 [5]. Through this program, vector mosquito density was monitored on a weekly basis, and the JEV was isolated from the mosquitoes. Antibody levels in unvaccinated pigs were also monitored in order to predict an epidemic. As a result, annual JE cases have been below ten after the last epidemic in 1983 (139 cases). We experienced an abrupt increase in JE cases in 2010, with five out of 26 cases occurring in Gangwon-do where Culex trtitaneniorhyncus mosquitoes are rarely distributed during the JE season (August to October) [6]. While health authorities investigated the reason for this increase based on mosquito density and antibody levels in pigs, they could not provide a clear explanation for the JE outbreak in an unexpected province. A possible answer was given in an article published by a US military research group in South Korea [7]. They detected JEV genotype V from Culex bitaeniorhynchus mosquitoes in north Gyeonggi-do in 2010, which was the third case following the previous reports in Malaysia and China [8,9]. In Taiwan, Chen et al suggested that the detection of a JEV antibody on a rice-free islet might be related to another potential vector mosquito found in similar ecological conditions [4]. These data indicate that JEV is rampant in nature and suggest the possibility of new vector-mosquito involvements in the natural cycle of JEV.

We also reviewed the current mosquito trapping methods and collection sites. In the JE epidemic forecast program, black-light traps were mainly used to capture mosquitoes, and the collection sites are primarily near cowsheds in villages. This condition would be acceptable for the purpose of the program (to detect JEV activity near human habitats and to take timely preventive measures) but does not reflect the distribution of mosquito species in various habitats. This makes it difficult to investigate the virus activity in nature. In this study, we investigated the presence of new mosquito species that may transmit JEV in a variety of different habitats, and using various mosquito traps.

Materials and Methods

Ethics Statement

The animal protocol used in this study was reviewed and approved based on its ethical procedures and scientific care by the KCDC-Institutional Animal Care and Use Committee (KCDC-IACUC).

Mosquito collection

Mosquitoes were collected from May through October 2012 in five cities (Ansan, Cheongju, Hwacheon, Nonsan, and Yeoju) where JE patients occurred from 2007 to 2011 in South Korea (Fig. 1). Each city was subdivided into four collecting sites (cowshed, downtown area, forest, and swamp). Four different types of traps: A CDC black-light trap (John W. Hock, USA), BG-Sentinel trap (Biogents AG, Germany), Fay-Prince trap (John W. Hock, USA), and CDC-Gravid trap (John W. Hock, USA) were placed in each habitat and operated once a month from 4:00 pm to 10:00 am. Trap indices (TI: mean number of female mosquitoes collected per trap per night) were determined for each site. There was no need for specific permission for using these collecting sites, because these sites were not located at national parks or protected areas, and mosquito collecting was supported by each local Public Health Center. Collected mosquitoes were killed by freezing and stored in an icebox containing dry ice. They were then transported to the laboratory.

Figure 1. Locations of mosquito collection in South Korea.

Figure 1

Mosquitoes were caught in five cities (four sites per city) once a month from May through October 2012.

Virus detection

Female mosquitoes were identified morphologically and labeled based on the date and geographic region of their capture. Each mosquito pool (up to 50 mosquitoes) was placed in a 2-ml sterile tube containing four to six 2.5-mm-diameter glass beads. Different amounts of sterile phosphate-buffered saline (PBS) were then added to each tube according to the number of mosquitoes contained therein (0.3 ml PBS for up to 10 mosquitoes, 0.6 ml PBS for 11–20 mosquitoes, and 1.2 ml PBS for 21–50 mosquitoes). Mosquitoes were homogenized using automatic equipment, FastPrep (MP Biomedicals, Solon, OH, USA), 2 times for 20 s at 5000 rpm. Homogenates were placed on ice for at least 5 min, clarified by brief centrifugation, and used for RNA extraction.

The viral RNAs were extracted from the clarified supernatant of the homogenates using a QIAamp viral RNA mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The RNAs were analyzed using one-step SYBR Green 1-based real-time RT-PCR with flavivirus group-specific primers detecting the NS 5 partial gene [10]. Verso SYBR Green 1-Step QRT-PCR ROX (Thermo, Waltham, MA, USA) and StepOnePlus instruments (Applied Biosystems, Foster City, CA, USA) were used for the RT-PCR assay. The reaction mixture (25 μl) contained 12.5 μl of 1-Step QRT-PCR SYBR ROX mix, 1.75 μl of each of the three primers (FL-F1, FL-R3, and FL-R4, 1μM stock), 1.25 μl of RT enhancer, 0.25 μl of verso enzyme, 0.75 μl of RNase/DNase free water, and 5 μl of the RNA sample. The thermal cycling consisted of reverse transcription at 50°C for 30 min, activation of Taq polymerase at 95°C for 15 min followed by 45 cycles of PCR (94°C for 15 s, 58°C for 20 s, 72°C for 30 s). After amplification, a melting-curve analysis was performed to verify each product by its specific melting temperature. Positive reactions, including for dengue virus, Japanese encephalitis virus, yellow fever virus, and West Nile virus showed melting temperatures ranging from 81°C to 85°C. The expected size of the positive product was approximately 212 bp in agarose gel electrophoresis.

The positive products were extracted from the gels using the QIAquick gel extraction kit (QIAGEN) and sequenced with primers FL-F1, FL-R3, and FL-R4. PCR direct sequencing was done in both directions using the ABI PRISM BigDye Terminator Cycle Sequencing kits and an ABI 3730xl sequencer (Applied Biosystems) at Macrogen (Seoul, South Korea). The resulting nucleotide sequences were done via an NCBI-BLAST search to identify the exact pathogens involved.

Nucleotide sequencing and phylogenetic analysis

We designed five set of primer to obtain the complete envelope gene for JEV-positive pools (Table 1). The primers were designed manually by comparing two sequences of JEV genotype V (XZ0934 and 10–1827) available from GenBank. The eight microliters of RNA extracted from mosquito homogenate were reverse transcribed with a random hexamer using the SuperScript III First-Strand Synthesis System (Invitrogen, CA, USA) according to the manufacturer’s protocol. Then, synthesized cDNA was amplified with each primer set using the DyNAzyme EXT DNA Polymerase. The composition of reaction mixture was 5 μl of 10× optimized buffer, 1 μl of dNTP mix, 2.5 μl of each of the forward and reverse primers (10 μM stock), 1 μl of DNA Polymerase, 36 μl of RNase/DNase free water, and 2 μl of the cDNA template. The thermal profile for the PCR was as follows: pre-denaturation at 94°C for 2 min, 40 cycles of 94°C for 30 s, 60°C for 20 s (55°C for primer set of 1240F and 1734R), 72°C for 20 s, and a final extension cycle at 72°C for 3 min. The amplified fragments were visualized in agarose gel and extracted for nucleotide sequencing. PCR direct sequencing was done at Macrogen (Seoul, South Korea) as described in the section above. The resulting sequence files were compiled using the SeqMan program in the Lasergene software version 8.0 (DNASTAR, WI, USA) and the final 1,500 bp of the envelope gene sequences were obtained. The nucleotide sequences were compared with those of 38 other JEV strains deposited in the GenBank (Table 2). The phylogenetic analyses were performed using MEGA 6.06 [11]. A multiple alignment was generated with the MUSCLE program [12] in MEGA and the best evolutionary model for estimating genetic distances between sequences was estimated using the ‘Models’ function in MEGA. Phylogenetic trees were inferred by both distance- and character-based methods. For the distance method, a Neighbor Joining (NJ) tree was constructed using the evolutionary model of Tamura-Nei and the rate variation among sites was estimated from a gamma distribution (shape parameter = 5). The reliability of the tree was tested by bootstrap methods with 1,000 replications. For the character-base method, a Maximum Likelihood (ML) tree was constructed using the same substitution model and gamma distribution. The envelope gene sequence of the West Nile virus was used as the out-group (B956strain, GenBank accession number: NC_001563). Detailed parameters for the tree construction are available upon request from the corresponding author.

Table 1. Primers for amplification of the complete envelope gene of JEV genotype V.

Primer Sequence (5′-3′) Position Polarity Size (bp)
69F TGCAAACCCACGGAGAA 763–779 Forward 501
550R GCCTTGCTTGCAGACATAG 1262-1244 Reverse
373F CCTCACTATCATGGCGAACGACA 1067–1089 Forward 557
908R CGCGATGGACTAGGAACGACTTA 1623-1601 Reverse
819F AGCTTGGAGATTACGGAGAGGTCA 1513–1536 Forward 572
1370R CTTCGAATTGGCGGTGGATGT 2084-2064 Reverse
1240F TGGTACGGTTGTCATAGAA 1934–1952 Forward 512
1734R CACCTCCTGTAGCAAGAA 2445-2428 Reverse
1622F GGAGCTTTCAGAACCCTTTTTG 2316–2337 Forward 378
1980R CCTGACGGCTTCCCACATTT 2693-2674 Reverse

The nucleotide position was based on the JEV XZ0934 strain (Genotype V, GenBank accession number, JF915894).

Table 2. Details of the Japanese encephalitis viruses used in the phylogenetic analysis.

Strain Genotype Location Sampling year GenBank accession number.
YN86-B8639 1 China 1986 DQ404133
SH80 1 China 2001 JN381848
3XG009 1 China 2011 JX514950
IND/11/WB/JEV45 1 India 2011 KC526872
99P104 1 Japan 1999 FJ943474
09P123 1 Japan 2009 GU108334
K94P05 1 South Korea 1994 U34929
K01-JN 1 South Korea 2001 FJ938222
K05-GS 1 South Korea 2005 FJ938223
A10.825 1 South Korea 2010 JN587259
K10CT661 1 South Korea 2010 JX018150
TC2009-11 1 Taiwan 2009 JF499801
CY2010-3 1 Taiwan 2010 JF499824
ThCMAr4492 1 Thailand 1992 D45362
JE_CM_1196 1 Thailand 2005 DQ238602
90VN70 1 Vietnam 1990 HM228921
VN88 1 Vietnam 2001 AY376464
07VN310 1 Vietnam 2007 HM228922
FU 2 Australia 1995 AF217620
JKT5441 2 Indonesia 1980-Jun JQ429306
BN19 3 China 1982 FJ185038
YN03-A151 3 China 1998 DQ404136
SCDJY01 3 China 2011 JX045833
GP78 3 India 1978 AF075723
IND/12/WB/JEV50 3 India 2012 KC526871
JaOArS982 3 Japan 1982 M18370
JaNAr0290 3 Japan 1990 AY427794
K88A071 3 South Korea 1988 FJ938228
K94A071 3 South Korea 1994 FJ938217
CH1392 3 Taiwan 1990 AF254452
YL0506a 3 Taiwan 2005 GQ260611
HL0805a 3 Taiwan 2008 GQ260628
VN207 3 Vietnam 1986 AY376461
04VN75 3 Vietnam 2004 HQ009263
JKT6468 4 Indonesia 1981 AY184212
XZ0934 5 China 2009 JF915894
Muar 5 Malaysia 1952 HM596272
10-1827 5 South Korea 2010 JN587258

Results

Mosquito collection

A total of 20,774 mosquitoes representing 9 genera and 20 species were collected, including 9 species of Culex, 2 species of Aedes, 3 species of Ochlerotatus, and Armigeres, Coquillettidia, Culiseta, Mansonia, Tripteroides, and Anopheles complex. The predominant species were Cx. pipiens (44.7%) and Ae. vexans (18.0%). Details are presented in Table 3. The TI of all traps (Table 4) during the study period was 45.5, ranging from a low of 0.9 (Hwacheon, at GV) to a high of 337.5 (Ansan, at BG) female mosquitoes per trap night.

Table 3. Total number mosquitoes collected at 5 cities in South Korea.

Species Cheongju (%) Nonsan (%) Ansan (%) Yeoju (%) Hwacheon (%) Total (%)
Culex bitaeniorhynchus 6 (0.1) 2 (0.1) 34 (0.4) 8 (0.4) 50 (0.2)
Culex hayshii 3 (0.1) 1 (0.1) 4 (<0.1)
Culex inatomii 2 (0.1) 468 (4.9) 470 (2.3)
Culex mimeticus 1 (<0.1) 1 (<0.1)
Culex orientalis 83 (2.1) 73 (2.3) 31 (0.3) 264 (12.0) 47 (2.6) 498 (2.4)
Culex pipiens 1,155 (28.7) 757 (23.8) 6,254 (65.5) 917 (41.5) 208 (11.5) 9,291 (44.7)
Culex rubensis 1 (<0.1) 1 (<0.1)
Culex tritaeniorhyncus 2 (<0.1) 3 (0.1) 1 (<0.1) 4 (0.2) 10 (<0.1)
Culex vagans 3 (0.1) 2 (<0.1) 5 (<0.1)
Aedes albopictus 110 (2.7) 180 (5.7) 191 (2.0) 73 (3.3) 9 (0.5) 563 (2.7)
Aedes vexans 1,135 (28.2) 928 (29.1) 164 (1.7) 602 (27.3) 917 (50.8) 3,746 (18.0)
Ochlerotatus dorsalis 6 (0.1) 6 (<0.1)
Ochlerotatus koreicus 544 (13.5) 5 (0.2) 63 (0.7) 7 (0.3) 7 (0.4) 626 (3.0)
Ochlerotatus nipponicus 2 (0.1) 2 (<0.1)
Anopheles spp. 353 (8.8) 846 (26.6) 84 (0.9) 210 (9.5) 552 (30.6) 2,045 (9.8)
Armigeres subalbatus 551 (13.7) 373 (11.7) 31 (0.3) 117 (5.3) 60 (3.3) 1,132 (5.4)
Coquillettidia ochracea 11 (0.3) 104 (1.1) 115 (0.6)
Culiseta bergrothi 1 (<0.1) 1 (<0.1)
Mansonia uniformis 59 (1.5) 2,116 (22.2) 1 (<0.1) 2,176 (10.5)
Tripteroides bambusa 15 (0.4) 14 (0.4) 2 (0.1) 1 (0.1) 32 (0.2)
Total 4,028 (100.0) 3,184 (100.0) 9,550 (100.0) 2,208 (100.0) 1,804 (100.0) 20,774 (100.0)

Anopheles spp.: Includes An. sinensis, An. lesteri, An. lindesai, An. pullus, An. sineroides, An. belenrae, An. kleini.

Table 4. Total number of female mosquitoes collected at mosquito collecting cities with four traps during May to October in 2012.

Cities Name of traps No. trap Mosquitoes No. species Trap nights TI
Cheongju BL 4 250 9 63 10.5
BG 4 1,821 13 455 75.8
FP 4 1,913 12 478 79.7
GV 4 41 5 10 1.7
Nonsan BL 4 1,352 9 338 56.3
BG 4 972 11 243 40.5
FP 4 801 9 200 33.3
GV 4 59 6 15 2.5
Ansan BL 3 65 9 22 3.7
BG 3 6,075 15 2,025 337.5
FP 3 3,363 12 1,121 186.8
GV 3 47 5 16 2.7
Yeoju BL 4 96 5 24 4.0
BG 4 957 10 239 39.8
FP 4 1,125 11 281 46.8
GV 4 31 6 8 1.3
Hwachon BL 4 1,130 7 283 47.2
BG 4 306 8 77 12.8
FP 4 349 9 87 14.5
GV 4 21 6 5 0.8
Total 76 20,774 20 273 45.5

TI (Trap Index): Average number of mosquitoes per trap night.

BL: Black light trap, BG: BG sentinel trap, FP: Fay prince trap, GV: Gravid trap.

Virus detection and phylogenetic analysis

Of the 933 pools of mosquitoes tested by real-time RT-PCR, 6 JEVs and 2 chaoyang viruses were detected from 2 species of Culex and Aedes vexans mosquitoes, respectively (Table 5). In detail, JEVs were detected in Culex orientalis and Culex pipiens mosquitoes caught in mid August to early September in Hwacheon, Ansan, and Yeoju cities (Table 6). The JEV-positive mosquitoes were caught at all the four habitats (cowshed, downtown area, forest, and swamp) using three collecting traps except the Gravid trap. It is notable that the RT-PCR protocols used in this study allowed the detection of JEV harbored in only one of five mosquitoes (Table 6). The chaoyang virus was detected in the Aedes vexans mosquito, which is the dominant species throughout the country. We did not further analyze this virus because it was outside the scope of this study.

Table 5. Results of flavivirus detection from field-caught mosquitoes.

Species Total (%) Tested pool* JEV Other Flavivirus
Culex bitaeniorhynchus 50 (0.2) 16 0 0
Culex hayshii 4 (0.0) 2 0 0
Culex inatomii 470 (2.3) 16 0 0
Culex mimeticus 1 (0.0) 1 0 0
Culex orientalis 498 (2.4) 83 5 0
Culex pipiens 9,295 (44.7) 264 1 0
Culex rubensis 1 (0.0) 1 0 0
Culex tritaeniorhyncus 10 (0.0) 7 0 0
Culex vagans 5 (0.0) 2 0 0
Aedes albopictus 564 (2.7) 64 0 0
Aedes vexans 3,744 (18.0) 168 2
Ochlerotatus dorsalis 6 (0.0) 4 0 0
Ochlerotatus koreicus 625 (3.0) 70 0 0
Ochlerotatus nipponicus 2 (0.0) NT - -
Anopheles spp. 2,045 (9.8) NT - -
Armigeres subalbatus 1,132 (5.4) 145 0 0
Coquillettidia ochracea 115 (0.6) 14 0 0
Culiseta bergrothi 1 (0.0) 1 0 0
Mansonia uniformis 2,176 (10.5) 66 0 0
Tripteroides bambusa 30 (0.1) 9 0 0
Total 20,774 933 6 2

Anopheles spp.: Includes An. sinensis, An. lesteri, An. lindesai, An. pullus, An. sineroides, An. belenrae, An. kleini; An. sinensis was not used in the virus survey.

*Tested pools: ≤50/1pool, separated by locality and time.

Identified as Chaoyang virus by sequencing analysis and NCBI-BLAST search (data not shown).

NT: Not tested.

Table 6. Japanese encephalitis viruses detected from mosquitoes in this study.

Code Mosquito species (numbers/pool) Collection date Location Trap GenBank Accession no.
K12HC959 Culex orientalis (12) 2012-08-16 Hwacheon (swamp) BL KJ420589
K12AS1148 Culex pipiens (50) 2012-08-29 Ansan (swamp) BG KJ420590
K12AS1151 Culex orientalis (5) 2012-08-29 Ansan (swamp) BG KJ420591
K12YJ1174 Culex orientalis (46) 2012-09-06 Yeoju (cowshed) FP KJ420593
K12YJ1182 Culex orientalis (30) 2012-09-06 Yeoju (forest) BG KJ420594
K12YJ1203 Culex orientalis (1) 2012-09-06 Yeoju (downtown) BG KJ420592

BL: CDC Black-Light trap, BG: BG Sentinel trap, FP: Fay-Prince trap

K12YJ1174 and K12YJ1182 are partial length of envelope gene. Others are complete length of 1,500 nts.

The nucleotide sequences of six JEVs showed sequence similarity ranging from 99.5% to 100% based on the NS 5 gene (180–200 nucleotides). When an NCBI-BLAST search was done for each sequence, the highest hit was the sequence of JEV genotype V. To confirm the genotype, we amplified five fragments covering the complete envelope gene using genotype specific primers. We named the resultant sequences according to the country, year, location and sample number. For example, in the sequence named K12HC959, K means Korea, 12 is a two-digit marking of the sampling year, HC is the abbreviation of location and 959 is the sample number. Among the six JEVs, four pools were successful in having their complete envelope gene sequenced. Only partial sequences around 490 nucleotides were obtained for K12YJ1174 and K12YJ1182 (Table 6). Instead of the two partial sequences, we used K12YJ1203 as a representative sequence which was from the same mosquito species, but acquired on 6 September in Yeoju. An NCBI-BLAST search showed all the envelope gene sequences were best matched to those of JEV genotype V. When phylogenetic analyses were performed with other JEV strains representing each genotype and geography, Korean JEVs were able to be divided into genotypes I, III, and V on the NJ tree (Fig. 2). Both the NJ and ML trees showed the same genotype classification, albeit with differences in branch lengths and bootstrap values. All the JEVs detected in this study were grouped into genotype V, together with the findings of Muar (1952, Malaysia), XZ0934 (2009, China) and 10–1827(2010, Korea). We edited the original tree to make the relationship between the Korean JEV genotype V sequences clear. Because branch length from K12AS1151to its ancestral node was zero in the original tree, we moved the descendant node (K12AS1151 and 10–18927) back to its ancestral node (Fig. 2). Genotype changes in Korean JEVs were shown in 1994 (genotype III → I) and in 2010 (genotype I → V) in the tree. Four JEV sequences obtained in this study showed a nucleotide sequence similarity of 99.1%–99.7% and an amino acid sequence similarity of 99.2%–100% (Table 7). When all seven genotype V sequences in the world were compared to each other, the sequence similarity was 89.9%–99.9% and 95.2%–100% at the nucleotide and amino acid sequence levels, respectively. The genotype V group showed mean sequence divergence ranging from 21.9%–22.8% against the other four genotypes, while those genotypes showed mean sequence divergence of 10.8–18.2% each other.

Figure 2. Phylogenetic analysis of Japanese encephalitis virus (JEV) based on the complete envelope gene (1,500 nt) from 42 strains representing each genotypes and countries.

Figure 2

The Maximum-Likelihood tree was constructed with a substitution model of Tamura-Nei plus gamma distribution using MEGA software 6.06. West Nile virus (WNV, B956 strain, NC_001563) was used as the outgroup in the tree. Branch reliability is indicated by the percentage of bootstrap values at each node (1,000 replications). The scale bar indicates the number of base substitutions per site. JEVs detected in this study were marked with a closed circle. The left side of the tree is omitted for ease of understanding. In a small rectangle, the topology of genotype V sequences in the original tree is presented. The branch length between K12AS 1154 and its ancestral node is zero and is edited to make the ancestor-descendant relationship clear.

Table 7. Nucleotide sequence similarity and divergence of envelope gene among JEV genotype V.

Muar XZ0934 10–1827 K12AS1148 K12AS1151 K12HC959 K12YJ1203
Muar 90.2 89.9 90.1 90.1 89.9 89.9
XZ0934 9.8 97.3 97.0 97.5 97.1 97.3
10–1827 10.1 2.7 99.1 99.9 99.3 99.5
K12AS1148 9.9 3.0 0.9 99.3 99.2 99.1
K12AS1151 9.9 2.5 0.1 0.7 99.4 99.7
K12HC959 10.1 2.9 0.7 0.8 0.6 99.2
K12YJ1203 10.1 2.7 0.5 0.9 0.3 0.8

The upper right of diagonal shows percentage sequence similarity and the lower left of diagonal shows sequence divergence (p-distance).

Discussion

In this study we detected six JEVs from Culex orientalis and Culex pipiens mosquitoes. These results may provide answers to the question of why JE patients have increased abruptly since 2010 and why the outbreaks have occurred in an unexpected province where the density of Culex tritaeniorhynchus mosquitoes was very low throughout the JE season. Recently, two research groups in Italy and Korea have reported that Culex pipiens mosquitoes may transmit JEV [13,14]. In addition, JEV was isolated from Culex pipiens which were collected during winter in Korea in the early 1970s. Despite the low vector competence that Culex pipiens displays in laboratory studies [15], our study strongly supports the previous finding that this mosquito is infected by JEV, and may transmit the virus.

Here, the name Culex pipiens is used to represent Culex pipiens pallens Coquillett. In Korea, the Culex pipiens complex consists of two species of mosquitoes, Culex pipiens pallens and Culex pipiens molestus Forskal. However, it is agreed that molestus is not a subspecies, but rather a strain of Culex pipiens pallens [16].

This is the first report of JEV detection in a Culex orientalis mosquito that was distributed in Far-East Asia, including China, Japan, Korea, Siberia, and Taiwan. However, this mosquito is not likely to cause a large impact JE outbreak because of its bionomics. The larvae of this species live strictly in fresh water, such as slowly moving ponds and streams, on mountains in Korea, and the adults apparently do not feed on humans [17]. However, Culex pipiens is the most common mosquito in human dwelling areas in Korea. The larvae of this mosquito occur in a very wide variety of artificial containers, or other types of stagnant water, such as ditches, gutters, ground pools, etc. They prefer polluted water containing abundant organic matter [17]. The adult mosquito is commonly considered to be an avian blood feeder, but a recent study has shown that the mammal feeding rate was comparatively high [18]. Therefore, the role of Culex pipiens and Culex orientalis in the transmission of JEV should be studied urgently.

In this study virus isolation was not attempted because dead mosquitoes were stored for several weeks before the RT-PCR. According to our long-term experience, and another paper [19], virus recovery could not be expected in such a circumstance. Instead, we sequenced the complete envelope gene using genotype specific primers. Interestingly, all the JEVs detected in this study belonged to genotype V, which was the second report in Korea to do so, after a US military research group detected it in 2010 in north Gyeonggi-do province [7]. Historically, genotype III was the dominant strain worldwide until the latter part of the 20th century. Then, a JEV genotype shift from type III to I was reported in many regions, and genotype I became recognized as the dominant strain in many countries [20]. Genotype V, on the other hand, is a very rare strain that was first reported from an encephalitis patient in Malaysia in 1952 [8] and then in 2009 in China [9]. In Korea, JEV genotype III strains were also dominant until the genotype I was first isolated in 1994. Since then, only genotype I strains were isolated until 2010 [21]. The pathogenic properties of the genotype V strain have only rarely been documented, and there is no relevant information on whether current genotype III-based vaccines could protect against this new genotype. Thus, we could not determine the effects of the emergence of this new genotype on the current JE outbreak in South Korea.

JEV vector surveillance is one of the most important tools for providing information on the distribution, intensity, and abundance of circulating viruses that can be used to create strategies for public health [14]. As a mosquito collection tool, we traditionally used a black-light trap in cowsheds or downtown areas. However, this trap attracts only some of the dominant species of mosquitoes, and consequently failed to collect the full diversity of species distributed in the natural ecosystem. Therefore, we tried four different trapping methods in various habitats. The number of collected mosquito species has showed a strong contrast by trap type (Table 4). This strategy proved to be a success in that JEV-positive pools were collected in both forests and swamps as well as the traditional sampling sites, and four out of six positive pools were collected with a BG sentinel trap. To accurately understand the circulation of viruses in nature, we recommend the collection of mosquitoes in various habitats.

In conclusion, we found that two new Culex mosquitoes, Culex orientalis and Culex pipiens may transmit JEVs as a secondary or regional vector. Additionally, we confirmed that JEV genotype V strains were disseminated in at least the Gangwon-do and Gyeonggi-do provinces. These findings broaden our knowledge on the vector diversity of JEV and highlight the need to review the current vector surveillance protocol in Korea.

Data Availability

Detected JEV partial envelope genes in our study are available from GenBank at the following accession numbers: KJ420589; KJ420590; KJ420591; KJ420593; KJ420594; KJ420592.

Funding Statement

This research was supported by funding (2012-N55001-00) from Research of Korea Center for Disease Control and Prevention. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Chambers TJ, Hahn CS, Galler R, Rice CM (1990) Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 44: 649–688. [DOI] [PubMed] [Google Scholar]
  • 2. Solomon T, Ni H, Beasley DW, Ekkelenkamp M, Cardosa MJ, et al. (2003) Origin and evolution of Japanese encephalitis virus in southeast Asia. J Virol 77: 3091–3098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. van den Hurk AF, Ritchie SA, Mackenzie JS (2009) Ecology and geographical expansion of Japanese encephalitis virus. Annu Rev Entomol 54: 17–35. 10.1146/annurev.ento.54.110807.090510 [DOI] [PubMed] [Google Scholar]
  • 4. Chen WJ, Dong CF, Chiou LY, Chuang WL (2000) Potential role of Armigeres subalbatus (Diptera: Culicidae) in the transmission of Japanese encephalitis virus in the absence of rice culture on Liu-chiu islet, Taiwan. J Med Entomol 37: 108–113. [DOI] [PubMed] [Google Scholar]
  • 5. Sohn YM (2000) Japanese encephalitis immunization in South Korea: past, present, and future. Emerg Infect Dis 6: 17–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Lee DW, Choe YJ, Kim JH, Song KM, Cho H, et al. (2012) Epidemiology of Japanese encephalitis in South Korea, 2007–2010. Int J Infect Dis 16: e448–452. 10.1016/j.ijid.2012.02.006 [DOI] [PubMed] [Google Scholar]
  • 7. Takhampunya R, Kim HC, Tippayachai B, Kengluecha A, Klein TA, et al. (2011) Emergence of Japanese encephalitis virus genotype V in the Republic of Korea. Virol J 8: 449 10.1186/1743-422X-8-449 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Mohammed MA, Galbraith SE, Radford AD, Dove W, Takasaki T, et al. (2011) Molecular phylogenetic and evolutionary analyses of Muar strain of Japanese encephalitis virus reveal it is the missing fifth genotype. Infect Genet Evol 11: 855–862. 10.1016/j.meegid.2011.01.020 [DOI] [PubMed] [Google Scholar]
  • 9. Li MH, Fu SH, Chen WX, Wang HY, Guo YH, et al. (2011) Genotype v Japanese encephalitis virus is emerging. PLoS Negl Trop Dis 5: e1231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Yang CF, Chen CF, Su CL, Teng HJ, Lu LC, et al. (2010) Screening of mosquitoes using SYBR Green I-based real-time RT-PCR with group-specific primers for detection of Flaviviruses and Alphaviruses in Taiwan. J Virol Methods 168: 147–151. 10.1016/j.jviromet.2010.05.006 [DOI] [PubMed] [Google Scholar]
  • 11. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 2725–2729. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ravanini P, Huhtamo E, Ilaria V, Crobu MG, Nicosia AM, et al. (2012) Japanese encephalitis virus RNA detected in Culex pipiens mosquitoes in Italy. Euro Surveill 17 [DOI] [PubMed] [Google Scholar]
  • 14. Seo HJ, Kim HC, Klein TA, Ramey AM, Lee JH, et al. (2013) Molecular detection and genotyping of Japanese encephalitis virus in mosquitoes during a 2010 outbreak in the Republic of Korea. PLoS One 8: e55165 10.1371/journal.pone.0055165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Turell MJ, Mores CN, Dohm DJ, Lee WJ, Kim HC, et al. (2006) Laboratory transmission of Japanese encephalitis, West Nile, and Getah viruses by mosquitoes (Diptera: Culicidae) collected near Camp Greaves, Gyeonggi Province, Republic of Korea 2003. J Med Entomol 43: 1076–1081. [DOI] [PubMed] [Google Scholar]
  • 16. Ree H-I (2003) Taxonomic review and revised key of the Korean mosquitoes (Diptera: Culicidae). Korean journal of Entomology 33: 39–52. [Google Scholar]
  • 17.Tanaka K, Mizusawa K, Saugstad ES (1974) A revision of the adult and larval mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara Islands) and Korea (Diptera: Culicidae).
  • 18. Hamer GL, Kitron UD, Brawn JD, Loss SR, Ruiz MO, et al. (2008) Culex pipiens (Diptera: Culicidae): a bridge vector of West Nile virus to humans. J Med Entomol 45: 125–128. [DOI] [PubMed] [Google Scholar]
  • 19. Johansen CA, Hall RA, van den Hurk AF, Ritchie SA, Mackenzie JS (2002) Detection and stability of Japanese encephalitis virus RNA and virus viability in dead infected mosquitoes under different storage conditions. Am J Trop Med Hyg 67: 656–661. [DOI] [PubMed] [Google Scholar]
  • 20. Nga PT, del Carmen Parquet M, Cuong VD, Ma SP, Hasebe F, et al. (2004) Shift in Japanese encephalitis virus (JEV) genotype circulating in northern Vietnam: implications for frequent introductions of JEV from Southeast Asia to East Asia. J Gen Virol 85: 1625–1631. [DOI] [PubMed] [Google Scholar]
  • 21. Yun SM, Cho JE, Ju YR, Kim SY, Ryou J, et al. (2010) Molecular epidemiology of Japanese encephalitis virus circulating in South Korea, 1983–2005. Virol J 7: 127 10.1186/1743-422X-7-127 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Detected JEV partial envelope genes in our study are available from GenBank at the following accession numbers: KJ420589; KJ420590; KJ420591; KJ420593; KJ420594; KJ420592.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES