Carbamate C-N Hydrolase Gene ameH Responsible for the Detoxification Step of Methomyl Degradation in Aminobacter aminovorans Strain MDW-2

Based on the structural characteristic, carbamate insecticides can be classified into oxime carbamates (methomyl, aldicarb, oxamyl, etc.) and N-methyl carbamates (carbaryl, carbofuran, isoprocarb, etc.). So far, research on the degradation of carbamate pesticides has mainly focused on the detoxification step and hydrolysis of their carbamate bond. Several genes, such as cehA, mcbA, cahA, and mcd, and their encoding enzymes have also been reported to be involved in the detoxification step. However, none of these enzymes can hydrolyze methomyl. In this study, a carbamate C-N hydrolase gene, ameH, responsible for the detoxification step of methomyl in strain MDW-2 was cloned and the key amino acid sites of AmeH were investigated. These findings provide insight into the microbial degradation mechanism of methomyl.

ABSTRACT

Methomyl {bis[1-methylthioacetaldehyde-O-(N-methylcarbamoyl)oximino]sulfide} is a highly toxic oxime carbamate insecticide. Several methomyl-degrading microorganisms have been reported so far, but the role of specific enzymes and genes in this process is still unexplored. In this study, a protein annotated as a carbamate C-N hydrolase was identified in the methomyl-degrading strain Aminobacter aminovorans MDW-2, and the encoding gene was termed ameH. A comparative analysis between the mass fingerprints of AmeH and deduced proteins of the strain MDW-2 genome revealed AmeH to be a key enzyme of the detoxification step of methomyl degradation. The results also demonstrated that AmeH was a functional homodimer with a subunit molecular mass of approximately 34 kDa and shared the highest identity (27%) with the putative formamidase from Schizosaccharomyces pombe ATCC 24843. AmeH displayed maximal enzymatic activity at 50°C and pH 8.5. K_m and k_cat of AmeH for methomyl were 87.5 μM and 345.2 s⁻¹, respectively, and catalytic efficiency (k_cat/K_m) was 3.9 μM⁻¹ s⁻¹. Phylogenetic analysis revealed AmeH to be a member of the FmdA_AmdA superfamily. Additionally, five key amino acid residues (162, 164, 191, 193, and 207) of AmeH were identified by amino acid variations.

IMPORTANCE Based on the structural characteristic, carbamate insecticides can be classified into oxime carbamates (methomyl, aldicarb, oxamyl, etc.) and N-methyl carbamates (carbaryl, carbofuran, isoprocarb, etc.). So far, research on the degradation of carbamate pesticides has mainly focused on the detoxification step and hydrolysis of their carbamate bond. Several genes, such as cehA, mcbA, cahA, and mcd, and their encoding enzymes have also been reported to be involved in the detoxification step. However, none of these enzymes can hydrolyze methomyl. In this study, a carbamate C-N hydrolase gene, ameH, responsible for the detoxification step of methomyl in strain MDW-2 was cloned and the key amino acid sites of AmeH were investigated. These findings provide insight into the microbial degradation mechanism of methomyl.

INTRODUCTION

Carbamate insecticides can be classified into oxime carbamates and N-methyl carbamates based on their structural characteristics (Fig. 1). They can kill insects by competitively inhibiting the insects’ acetylcholinesterase activity. However, these insecticides could be a potential threat to nontarget organisms with acetylcholinesterase, including mammals (1–3). Methomyl is a oxime carbamate insecticide and was widely adopted for foliar treatment of vegetables, fruits, crops, cotton, and commercial ornamental plants (4). It is well known for contaminating the agricultural areas’ groundwater due to its high water solubility (58 g liter⁻¹) and low affinity for sorption to soils (5, 6). Recently, methomyl has been identified to be a strong genotoxic agent and an agent inducing cell DNA damage and apoptosis in vitro (7). The WHO (World Health Organization), EPA (Environmental Protection Agency), and EC (European Commission) have also declared methomyl to be a toxic and hazardous pesticide (8). Although the use of methomyl has been banned in Europe and the United States for several years, it is still used in some developing countries (9). Therefore, the environmental behavior and degradation mechanisms of methomyl are of great concern and interest.

FIG 1.

Chemical structure of the carbamate insecticides.

Microbial degradation plays an important role in the elimination of carbamate pesticides from the environment. Therefore, most researchers have focused on the isolation of several N-methyl carbamate-degrading microbial strains (10–24). Previous studies identified and cloned several genes, including cehA, mcd, cahA, and mcbA, responsible for the detoxification step of hydrolysis of the carbamate bond (11–13, 19, 21, 22). In addition, only a few methomyl-degrading microorganisms, including Stenotrophomonas maltophilia M1, Paracoccus sp. strain mdw-1, Pseudomonas sp. strain EB20, the combination of white-rot fungi strains WR2 and WR9, and the combination of Aminobacter aminovorans MDW-2 with Afipia sp. strain MDW-3, have been isolated and characterized (24–27). The methomyl degradation pathway has been postulated based on the intermediates produced in different strains, with amide bond hydrolysis being the common detoxification step (Fig. S1). However, the molecular basis of the pathway has not yet been described, as the evidence for methomyl degradation comes from metabolite identification.

Aminobacter aminovorans MDW-2, a methomyl-degrading strain utilizing methomyl as the sole carbon source for growth, was previously isolated (27). In the present study, we focused on cloning the carbamate C-N hydrolase gene ameH, responsible for the hydrolysis of the amide bond of methomyl in strain MDW-2, which is a common detoxification degradation step in all microorganisms. Additionally, the characteristics and key amino acid sites of AmeH were investigated. The study results suggest that ameH is essential for the degradation of methomyl, which will provide insight into the methomyl degradation mechanism.

RESULTS

Purification of AmeH and cloning of ameH from strain MDW-2.

AmeH was purified from strain MDW-2 cell extract to deduce the protein sequence and corresponding gene involved. The AmeH purification protocol is summarized in Table S1. The detoxification activity of AmeH on the cell extract was only 18.8 U/mg protein. After four purification steps, the specific activity of AmeH increased to 222.2 U/mg and the protein was concentrated 11.8-fold with 12.5% recovery (Table S1). The molecular mass of the protein on ExpressPlus PAGE gels was about 30 kDa (Fig. S2). Preliminary identification of methomyl degradation was carried out by high-performance liquid chromatography (HPLC). The protein band was then excised and analyzed by matrix-assisted laser desorption ionization–time-of-flight (MALDI-TOF) mass spectrometry, and the amino acid sequences of the peptide fragments were obtained.

The whole genome of strain MDW-2 was sequenced to identify the gene encoding AmeH. The analysis revealed four replicons, consisting of one circular chromosome (5,823,430 bp, 63.7% G+C, 6,050 open reading frames [ORFs]) and three circular plasmids: pMDW1 (519,487 bp, 63.2% G+C, 483 ORFs), pMDW2 (157,689 bp, 61.4% G+C, 165 ORFs), and pMDW3 (107,222 bp, 61.0% G+C, 101 ORFs) (Table S2 and Fig. S3). The whole genome had an average G+C content of 63.2%. A total of 6,799 protein-coding genes were predicted. The amino acid sequences of the above-mentioned peptide fragments were then compared with all annotated proteins from the strain MDW-2 genome. The sequences were matched with a hydrolase encoded on orf1623 (951 bp) (Fig. S4) in pMDW1; this gene was designated ameH and selected for further study. The digital DNA-DNA hybridization (dDDH) between the genomes of strain MDW-2 (CP060197 to CP060200) and Aminobacter aminovorans DSM 7048^T (ASM434164v1) was 78.3%, higher than the standard species boundary for dDDH (70%). The results indicated that strain MDW-2 could be identified as the same species as Aminobacter aminovorans DSM 7048^T. Therefore, strain MDW-2 was identified as Aminobacter aminovorans MDW-2.

Sequence analysis of AmeH.

A BLASTP search in the NCBI protein databases (the UniProt Knowledge Base/Swiss-Prot databases) revealed that AmeH shares low amino acid sequence identity (26% to 28%) with three biochemically characterized FmdA_AmdA superfamily amidases from Mycobacterium smegmatis NCTC 8159 (formamidase [ForM] [Q07838]; 28% identity) (28), Schizosaccharomyces pombe ATCC 24843 (formamidase [ForM] [Q9URY7]; 27% identity) (29), and Methylophilus methylotrophus NCBI 10515 (acetamidase [AceM] [Q50228]; 26% identity) (30). The phylogenetic analysis based on the amino acid sequences of AmeH and closely related proteins revealed that AmeH is a member of the FmdA_AmdA superfamily and could form a clade with other amidases within the FmdA_AmdA superfamily, suggesting a close evolutionary relationship with amidases within the FmdA_AmdA superfamily (Fig. 2). These results indicate that AmeH constitutes a novel carbamate C-N hydrolase within the FmdA_AmdA superfamily.

FIG 2.

Phylogenetic tree constructed based on the alignment of AmeH with related proteins. The multiple-alignment analysis was performed with ClustalX 2.1 software. The neighbor-joining method was used to construct the unrooted phylogenetic tree through MEGA 7.0. Bootstrap percentages (based on 1,000 replications) of >50% are shown on the branches. According to their respective amino acid sequence and function, the clustering of amidases is displayed in different colors. The green, blue, and purple colors correspond to the FmdA_AmdA superfamily, nitrilase superfamily, and amidase signature family, respectively. ForM, formamidase; AceM, acetamidase; Ami, amidase; ALAM, aliphatic amidase. In the FmdA_AmdA superfamily clan, accession numbers are as follows: AAN87355, Paracoccidioides brasiliensis ForM; AAG60585, Aspergillus nidulans ForM; Q9URY7, Schizosaccharomyces pombe ForM; ACM68705, Lupinus albus ForM; Q50228, Methylophilus methylotrophus ForM; Q07838, Mycobacterium smegmatis ForM; AAM25099, Thermoanaerobacter tengcongensis AceM; WP044436960, Skermanella aerolata AceM; WP013640752, Acidiphilium multivorum AceM; WP039888139, Acidiphilium sp. PM AceM; WP057592521, Variovorax paradoxus AceM; WP012764433, Dickeya paradisiaca AceM; WP034389513, Comamonas thiooxydans AceM; WP018421042, Burkholderiaceae AceM. In the amidase signature family clan, accession numbers are as follows: CAG29798, Microbacterium sp. AJ115 Ami; D16207, Rhodococcus rhodochrous J1 Ami; AF290611, Sulfolobus solfataricus Ami; AAK11724, Rhodococcus erythropolis MP50 Ami; AAS87173, Achromobacter xylosoxidans Ami; CAC93616, Stenotrophomonas maltophilia Ami; ALB08735, Delftia tsuruhatensis Ami; ALB08736, Delftia tsuruhatensis Ami; AAD01507, Bradyrhizobium japonicum Ami. In the nitrilase superfamily clan, accession numbers are as follows: XP002179811, Phaeodactylum tricornutum CCAP 1055/1 ForM; NP791184, Pseudomonas syringae ALAM; WP011654378, Rhizobium leguminosarum ForM; O25836, Helicobacter pylori ForM; ADQ27473, Bacillus cereus CECT 5050T ForM; CAA72932, Helicobacter pylori ALAM; WP012745300, Variovorax paradoxus ALAM; AAX83004, Rhodococcus rhodochrous ALAM; AAF14257, Bacillus stearothermophilus BR388 Ami; AAA22990, Brevibacterium sp. R312 Ami; WP012723740, Pseudomonas fluorescens ALAM.

Heterogeneous expression of ameH.

The ameH gene was cloned and expressed in Escherichia coli BL21(DE3) to further investigate the catalytic activity of AmeH on the hydrolysis of methomyl. The yield of purified AmeH-6His was approximately 3.8 ± 0.2 mg per liter of culture. The molecular mass of native AmeH-6His was calculated to be 65 kDa by gel filtration chromatography. The purified AmeH-6His appeared as a single band on SDS-PAGE with a molecular mass of 34 kDa. Therefore, we inferred that AmeH-6His exists as a homodimer naturally (Fig. S5).

HPLC-tandem mass spectrometry (MS/MS) was employed to identify the hydrolysis product of methomyl by AmeH-6His in the enzyme assay. Two compounds were detected with retention times of 3.63 min (compound I) and 4.01 min (compound II) (Fig. 3A). The prominent protonated molecular ion of compound I was m/z 163.0534 [M+H]⁺, which was identified as methomyl (C₅H₁₁N₂O₂S⁺, m/z 163.0536) with a 1.2-ppm error (Fig. 3B). The molecular ion mass of compound II was m/z 106.0322 [M+H]⁺, which was consistent with the protonated derivative of methomyl oxime (C₃H₈NOS₂⁺, m/z 106.0321) with a 0.6-ppm error (Fig. 3C). Generally, a mass error between −5 ppm and 5 ppm is acceptable for the identification of compounds (31). These results indicated that AmeH-6His hydrolyzed the amide bond of methomyl to produce methomyl oxime (Fig. 3D), which was different from the catabolism pathway reported previously in the degradation of methomyl by strain MDW-2 (27) (Fig. S1). The reason is addressed in Discussion.

FIG 3.

HPLC and MS/MS analyses of the products of methomyl treated with purified AmeH. (A) HPLC analysis of metabolites that appeared during the conversion of methomyl by AmeH. (B) MS/MS analysis of compound I (m/z 163.0534 [M+H]⁺), identified as methomyl. (C) MS/MS analysis of compound II (m/z 106.0322 [M+H]⁺), identified as methomyl oxime. (D) The conversion pathway of methomyl by AmeH.

Biochemical characterization of purified AmeH-6His.

The specific AmeH-6His activity was determined to be 358.9 U mg⁻¹ protein for methomyl, while its V_max, K_m, and k_cat were 10.5 ± 0.2 μM s⁻¹mg⁻¹, 87.5 ± 2.3 μM, and 345.2 ± 10.5 s⁻¹, respectively (Fig. S6). The optimal AmeH-6His activity was observed at 50°C (Fig. S7A) and pH 8.5 (Fig. S8A). The enzyme retained more than 80% of its activity at 55°C for 1 h; however, at a higher temperature, 70°C, the residual AmeH-6His activity fell below 10% in 1 h (Fig. S7B). AmeH-6His exhibited high activity levels at a pH range of 6.5 to 9.0, and retained 75% of its activity after storage at pH 7.0 to 8.5 for 1 h at 30°C (Fig. S8B).

AmeH-6His showed no catalytic activity on any carbamate pesticide other than methomyl, including carbaryl, isoprocarb, fenobucarb, propoxur, aldicarb, carbofuran, and oxamyl, but it showed activity on formamide and acetamide, the substrates of amidases (Table S3).

ameH is essential for degradation of methomyl.

The ameH gene was disrupted by a single-crossover event to verify whether it is the only gene involved in the detoxification degradation step of methomyl in strain MDW-2. The resulting mutant, strain MDW-2M, lost the ability to hydrolyze methomyl, while the complemented strain MDW-2M (pBBR1-ameH) regained the ability to degrade methomyl (Fig. S9). These results confirmed that AmeH is responsible for hydrolysis of the amide bond of methomyl, which is the detoxification step of methomyl degradation in strain MDW-2.

Identification of key amino acid sites of AmeH.

Alignment of the amino acid sequences of AmeH and closely related proteins (identity, 26% to 33%) whose crystal structures are available in the protein data bank (PDB) revealed 26 conserved amino acid sites (indicated by shading in Fig. S10). Of these, five were predicted to be key amino acids in 3TKK_A (an acetamidase from Thermotoga maritima), corresponding to the residues G162, N164, D191, H193, and E207 in AmeH (indicated by green diamonds in Fig. S10) (32). To verify this further, the five amino acids were individually replaced by alanine in AmeH, and five variants (AmeH-6His G162A, AmeH-His N164A, AmeH-His D191A, AmeH-His H193A, and AmeH-His E207A) were obtained (Fig. S11). The yield of purified variants was estimated to be approximately 3.8 mg per liter of culture. The enzyme activity assay showed that only AmeH-His H193A retained 10% of AmeH-6His hydrolysis activity against methomyl, while the activity in the other four variants was abolished entirely (Table. S4). The results confirmed these five amino acids to be the key residues of AmeH-6His.

DISCUSSION

To date, many bacterial strains capable of degrading carbamate insecticides have been reported from the genera Stenotrophomonas, Achromobacter, Flavobacterium, Pseudomonas, Sphingomonas, Novosphingobium, Paracoccus, Aminobacter, and Cupriavidus (11–19, 23). The molecular basis of degradation of certain carbamate insecticides has been studied extensively. Four carbamate hydrolase genes, cehA, mcd, cahA, and mcbA, have been cloned so far (11, 13, 14, 22, 33). Among the reported carbamate hydrolases, only McbA has been proven to have no catalytic activity against methomyl (22). However, the activities of the other three enzymes (CehA, Mcd, and CahA) against methomyl have not been studied so far. Therefore, in this study, the heterologous expression of CehA, Mcd, and CahA was carried out, and their activity on methomyl was determined. The results demonstrated that these enzymes could not hydrolyze methomyl (the experimental methods and related conclusions are shown in Text S1 in the supplemental material). None of the known carbamate hydrolases could hydrolyze methomyl. In this study, ameH was cloned from the methomyl-degrading strain Aminobacter aminovorans MDW-2. Although AmeH has relatively good hydrolysis activity for methomyl, it showed a narrow substrate spectrum and no activity against other carbamate insecticides (Table S3).

In this study, AmeH hydrolyzed methomyl to methylamine and an unstable compound that spontaneously transformed to methomyl oxime and carbon dioxide (Fig. 3D). This was different from the catabolism pathway previously proposed for the degradation of methomyl by strain MDW-2. In that pathway, methomyl was hydrolyzed to methomyl oxime and methylcarbamic acid (27) (Fig. S1), as only methomyl oxime was detected during the analysis of degrading product of methomyl by strain MDW-2, while HPLC did not detect methylcarbamic acid. Moreover, methylcarbamic acid could not be used for the growth and analytical experiments, as it is commercially unavailable. Therefore, this pathway was proposed based on the difference in chemical formulas of methomyl and methomyl oxime, in the absence of evidence of enzymes and genes. However, the results of the present study demonstrated the degradation of methomyl at the enzyme and gene levels and also corrected the shortcomings of the metabolic pathway of methomyl proposed by Zhang et al. (27). In this study, the hydrolyzing product of methomyl by AmeH was also the only one detected. Therefore, it was proposed that AmeH hydrolyzed methomyl to methylamine and an unstable compound that spontaneously transformed to methomyl oxime and carbon dioxide. The basis for this speculation is that AmeH is a carbamate C-N hydrolase from the FmdA_AmdA superfamily which catalyzes the cleavage of the amide bond; methomyl has only one amide bond. After being hydrolyzed, it forms methylamine and an unstable compound. Although methylamine was not detected, since strain MDW-2 was able to grow with methomyl as the sole carbon source, instead of methomyl oxime (27), this strain might use either methylamine or carbon dioxide as the sole carbon source for growth. However, strain MDW-2 can only use methylamine as the sole carbon to support its growth (Fig. S12), which also provides evidence for the speculation that methylamine was formed during the hydrolysis of methomyl. Accumulating studies have reported the generation of methylamine and carbon dioxide in the detoxification hydrolysis step (14, 17, 18). Knockout and complementation experiments with ameH have also proved that it is responsible for the hydrolysis of methomyl in strain MDW-2 (Fig. S9). The above information was combined to derive the metabolic pathway of methomyl in strain MDW-2 proposed here (Fig. S13). The unstable compound in the metabolic pathway was proposed based on the detection of methomyl oxime and the function of AmeH. In order to be strictly accurate, the unstable compound is indicated by square brackets in Fig. 3D.

Many amidases have been reported to catalyze the degradation of xenobiotics through the hydrolysis of C-N bonds (34–41), such as hydrolysis of propham by the amidase MmH (37), hydrolysis of iprodione by the amidase IpaH (38), hydrolysis of N-methylpyrrolidone by an N-methylhydantoin amidohydrolase NmpAB (40), and hydrolysis of N,N-dimethylformamide by the dimethylformamidase DmfA1A2 (41). Most of these enzymes belong to the AS (amidase signature) family and often have a broad substrate spectrum (42). In comparison, only a few enzymes belong to the FmdA_AmdA superfamily, which often has a narrow substrate spectrum, limited to its specific substrate and simple amidase substrates only, such as formamide and acetamide (43, 44). Therefore, the characteristics and catalytic mechanisms of these enzymes are less studied. In the present study, AmeH was classified as a member of the FmdA_AmdA superfamily (Fig. 2). Similar to other members of this superfamily, it has a narrow substrate spectrum. Among the tested substrates, apart from methomyl, AmeH could hydrolyze only formamide and acetamide. Five conserved amino acids (G162, N164, D191, H193, and E207) were identified as the key residues of AmeH (Table S4), but whether these amino acid sites affect its correct folding or the active center requires further study on its crystal structure.

MATERIALS AND METHODS

Chemicals and culture media.

Methomyl (99.0%), carbofuran (98.5%), carbaryl (98.0%), isoprocarb (99.2%), fenobucarb (99.6%), propoxur (98.8%), aldicarb (99.7%), oxamyl (99.8%), methomyl oxime (99.0%), formamide (99.0%), and acetamide (99.0%) were purchased from Shanghai Pesticide Research Institute. Luria-Bertani (LB) broth consisted of the following (grams per liter): tryptone, 10.0; yeast extract, 5.0; and NaCl, 10.0. Mineral salts medium (MSM) consisted of the following (grams per liter): NH₄NO₃, 1.0; NaCl, 1.0; K₂HPO₄, 1.5; KH₂PO₄, 0.5; and MgSO₄·7H₂O [pH 7.0], 0.2. Methomyl (0.5 mM) was used as the sole carbon source, unless stated otherwise. All other chemical reagents used in this study were of the highest available analytical grade.

Strains, plasmids, and culture conditions.

The bacterial strains and plasmids used in this study are listed in Table 1, and the primers used are listed in Table 2. Strain MDW-2, a methomyl-degrading strain utilizing methomyl as the sole carbon source for growth, was previously isolated by our lab. It was cultured aerobically in LB broth or MSM at 30°C. Escherichia coli strains were cultured in LB broth on a rotary shaker (180 rpm) or on LB agar (1.5% [wt/vol]) plates at 37°C. Antibiotics were used at the following concentrations: ampicillin (Amp), 100 μg ml⁻¹; kanamycin (Km), 50 μg ml⁻¹; and tetracycline (Tc), 10 μg ml⁻¹.

TABLE 1.

Strains and plasmids used in this study

Strain or plasmid	Characteristic(s)a	Reference or source
Strains
Aminobacter aminovorans MDW-2	Wild-type, able to degrade methomyl; Kmr	27
MDW-2M	ameH-disrupted mutant of strain MDW-2	This study
MDW-2M (pBBR1-ameH)	ameH gene complemented by pBBR1-ameH in MDW-2M; Kmr Tcr Ampr	This study
E.coli DH5α	F– recA1 endA1 thi-1 supE44 relA1 deoR Δ(lacZYA-argF)U169 ϕ80dlacZΔM15	Vazyme
E.coli BL21(DE3)	F– ompT hsdSB(rB– mB–) dcm gal λ(DE3)	Vazyme
Plasmids
pBBR1MCS-4	Broad-host-range vector; Ampr	64
pBBR1-ameH	ameH gene complementation vector containing ameH; Ampr	This study
pEX18Tc	Gene knockout vector; oriT sacB Tcr	62
pEX-ameH	ameH gene knockout vector containing partial homologous regions of ameH, Tcr	This study
pET-24b(+)	Expression vector, Kmr	Laboratory stock
pET-ameH	pET-24b(+) harboring ameH, Kmr	This study
pET-G162A	pET-24b(+) harboring ameH-G162A, Kmr	This study
pET-N164A	pET-24b(+) harboring ameH-N164A, Kmr	This study
pET-D191A	pET-24b(+) harboring ameH-D191A, Kmr	This study
pET-H193A	pET-24b(+) harboring ameH-H193A, Kmr	This study
pET-E207A	pET-24b(+) harboring ameH-E207A, Kmr	This study

^aKm^r, kanamycin resistant; Amp^r, ampicillin resistant; Tc^r, streptomycin resistant.

TABLE 2.

Oligonucleotides used in this study

Primer	DNA sequence (5′ to 3′)a	Use
ameH-F	TAAGAAGGAGATATACATATGGCGCGTCAGACGACA	Construction of plasmid pET-ameH
ameH-R	GTGGTGGTGGTGGTGCTCGAGGCCGGCGAAGATGCTTCG
G162A-F	CCGCCGCGTAGCATGGCCGGGAACTTGGACAG	Amplification of mutant gene ameH-G162A, with Gly162 replaced with Ala162
G162A-R	CTGTCCAAGTTCCCGGCCATGCTACGCGGCGG
N164A-F	GTAGCATGGGCGGGGCCTTGGACAGCCGCCACCTC	Amplification of mutant gene ameH-N164A, with Asn164 replaced with Ala164
N164A-R	GAGGTGGCGGCTGTCCAAGGCCCCGCCCATGCTAC
D191A-F	CTTGTTCTCGACCGGCGCCGGGCATCTCGGTC	Amplification of mutant gene ameH-D191A, with Asp191 replaced with Ala191
D191A-R	GACCGAGATGCCCGGCGCCGGTCGAGAACAAG
H193A-F	CTCGACCGGCGACGGGGCTCTCGGTCAGGGTG	Amplification of mutant gene ameH-H164A, with His193 replaced with Ala193
H193A-R	CACCCTGACCGAGAGCCCCGTCGCCGGTCGAG
E207A-F	GTGTATCACCGCGCTCGCGGGTCCGCTGACG	Amplification of mutant gene ameH-E207A, with Glu207 replaced with Ala207
E207A-R	CGTCAGCGGACCCGCGAGCGCGGTGATACAC
pEX-F	CATGATTACGAATTCGAGCTCAGATCCTGGACTTCGAGCATGA	Construction of plasmid pEX-ameH
pEX-R	CAGGTCGACTCTAGAGGATCCGGCAGCGGATGTGACGTAGT
pBBR1-F	GATAAGCTTGATATCGAATTCATGGCGCGTCAGACGACA	Construction of plasmid pBBR1-ameH
pBBR1-R	CGCTCTAGAACTAGTGGATCCCTAGCCGGCGAAGATGCTT

^aUnderlined nucleotides are restriction endonuclease sites. Nucleotides in bold are mutated sites, where wild-type amino acid residues were replaced with alanine residues.

Sequencing, assembly, and annotation.

DNA extraction was performed as described by Sambrook and Russell (45). The whole-genome sequencing of strain MDW-2 was performed by Shanghai Biozeron Biotechnology Co., Ltd. (Shanghai, China), using Illumina MiSeq sequencing technology, the Pacific Biosciences platform, and PCR validation (46–48). Gene prediction and functional annotation were performed using Glimmer 3.02 (49), tRNAscan-SE version 1.3.1 (50), Barrnap 0.4.2 (51), and the Rapid Annotation Subsystem Technology (RAST) database (52). The Genome-to-Genome Distance Calculator (GGDC 2.1; http://ggdc.dsmz.de) was used to calculate the digital DNA-DNA hybridization (dDDH) values (53).

Purification of methomyl hydrolase.

First, strain MDW-2 cells were cultured in LB broth, harvested by centrifugation at 6,000 × g for 5 min at 4°C, and then washed twice with 20 mM Tris-HCl buffer (pH 7.5). The cell pellets were resuspended in 15 ml 20 mM Tris-HCl buffer (pH 7.5) and lysed by sonication (UH-650B ultrasonic processor; 40% intensity; Auto Science) in an ice bath for 15 min. Later, the lysate was centrifuged at 12,000 × g for 30 min at 4°C, and the supernatant, i.e., the cell extract, was subjected to ammonium sulfate precipitation. The fraction between 40% and 60% ammonium sulfate was then collected by centrifugation at 12,000 × g for 30 min at 4°C. The precipitate obtained was dissolved in 20 mM Tris-HCl buffer (pH 7.5) and dialyzed overnight in a Slide-A-Lyzer dialysis membrane (10 kDa) (Pierce, USA) against 20 mM Tris-HCl buffer (pH 7.5) at 4°C. After dialysis, the resulting mixture was subjected to DEAE-Sepharose fast-flow anion-exchange chromatography, and proteins were eluted with a 0-to-0.35 M linear gradient of NaCl in 20 mM Tris-HCl buffer (pH 7.5). The active fractions obtained were applied to a Q-Sepharose fast flow anion-exchange chromatography column and washed with a 0-to-0.5 M linear gradient of NaCl in 20 mM Tris-HCl buffer (pH 7.5). The active fractions were concentrated by Microcon centrifugal filters (10-kDa cutoff) and subjected to Sephadex-200 gel chromatography. The flow rate was 0.4 ml min⁻¹ with 0.1 M NaCl in 20 mM Tris-HCl buffer (pH 7.5). The active fractions were concentrated with Microcon centrifugal filters (10-kDa cutoff). ExpressPlus PAGE gels (4 to 20%) purchased from GenScript (Nanjing) Co., Ltd., were employed to determine the molecular weight of the denatured protein (54). The protein components obtained from each purification step were subjected to a methomyl catalysis assay, and the component showing catalytic activity was named the active fraction. Protein concentrations were estimated by a Bradford assay (55).

Protein assay, sequencing, mass spectroscopy analysis, and genome comparison.

The protein strip from the ExpressPlus PAGE gel (Fig. S2, lane 6) was excised and sent to Bo-Yuan Biological Technology Co., Ltd. (Shanghai, China), for peptide mass fingerprint analysis. The resulting peptide fragments were compared with the amino acid sequences of the annotated ORF from the draft genome of strain MDW-2 to identify high-identity sequences. Later, the related protein sequences were aligned in Clustal X (version 2.1), and the phylogenetic tree was constructed by MEGA software (version 7.0) using the neighbor-joining method for phylogenetic analysis of methomyl hydrolase (AmeH) (56–58). The distances were calculated using a Kimura two-parameter distance model (59).

Expression of ameH and purification of recombinant AmeH.

ameH was amplified from the genomic DNA of strain MDW-2 using primers ameH-F and ameH-R (Table 2). The resulting amplicon was ligated into the NdeI and XhoI sites of pET-24b(+) using a ClonExpress II one-step cloning kit (Vazyme Biotech Co., Ltd., China) to produce pET-ameH, which was then transformed into E. coli BL21(DE3). The cells were cultured at an optical density at 600 nm (OD₆₀₀) of 0.5 in an LB medium supplemented with kanamycin (50 mg liter⁻¹) at 37°C. Isopropyl-β-d-thiogalactopyranoside (IPTG) was then added to a final concentration of 0.1 mM. The cells were incubated for an additional 12 h at 16°C, harvested by centrifugation, and subjected to ultrasonic disruption (UH-650B ultrasonic processor; 40% intensity; Auto Science) for 10 min. The lysate was then clarified by centrifugation at 12,000 × g for 30 min to remove the intact cells (4°C). A nickel-nitrilotriacetic acid (Ni²⁺-NTA) resin was used to purify the enzymes from the supernatant (60). A series of imidazole concentrations were used to elute the recombinant AmeH from the resin. SDS-PAGE and Bradford assays were employed to determine the molecular weight and protein concentration, respectively (55). Gel filtration chromatography was used to determine the native molecular mass of AmeH. All the experiments were performed at a flow rate of 0.4 ml min⁻¹ using an AKTA purifier 10UPC system and a Superdex 200 10/300 GL column (GE Healthcare). The buffer used was 20 mM Tris-HCl buffer (pH 7.5) containing 0.1 M NaCl. The native molecular mass of AmeH was estimated by plotting a calibration curve using standard proteins, including thyroglobulin from porcine thyroid (669 kDa), ferritin from equine spleen (440 kDa), catalase from bovine liver (232 kDa), lactate dehydrogenase from bovine liver (140 kDa), bovine serum albumin (66 kDa), and cytochrome c (12.4 kDa).

Enzyme activity assay.

The enzymatic reaction was performed at 30°C for 10 min in 1 ml of 20 mM Tris-HCl buffer (pH 7.5) containing 0.5 mM methomyl and 3 μg AmeH. One enzyme activity unit was defined as the amount of enzyme required to hydrolyze 1 μΜ methomyl per minute.

Enzyme kinetics were studied using various concentrations of methomyl (10 to 150 μM) in the reaction mixture. The enzyme was diluted to 3 μg to ensure that the substrate’s consumption remained within the linear range during the reaction. The substrate concentration was determined based on the integration of chromatographic peak areas observed during HPLC analysis. K_m and k_cat values were calculated by nonlinear regression fitted to the Michaelis-Menten equation. All the reactions were carried out in triplicate, and the data were reported as means and standard deviations (SD).

Biochemical properties of recombinant AmeH.

The concentrations of AmeH and methomyl used to investigate the optimal temperature and pH of AmeH were those used in the standard enzyme reaction. AmeH activity was tested between 15°C and 70°C (in increments of 5°C) to determine the optimal reaction temperature. The optimal reaction pH was assessed using several buffers with various pH values adjusted using 20 mM disodium hydrogen phosphate-citric acid buffer (pH 4.0 to 7.0), 20 mM Tris-HCl (pH 7.0 to 9.0), or 20 mM glycine-NaOH buffer (pH 9.0 to 10.0) (in increments of 0.5 pH unit). The thermal stability of AmeH was assessed by incubating the enzyme preparations at different temperatures for 1 h and measuring their residual activities under the assay conditions described above. The nonheated enzyme was used as the control (100% activity). AmeH was incubated at 4°C for 1 h in buffers with different pH values, and the residual activity was measured to determine pH stability. The samples were collected before the methomyl was completely consumed. The activity observed for the standard enzyme was defined as 100%, and the relative activities for individual reactions were calculated by comparing with the standard enzyme activity.

The AmeH substrate specificity was determined using carbaryl, isoprocarb, fenobucarb, propoxur, aldicarb, carbofuran, oxamyl, formamide, and acetamide. The assays were conducted under standard reaction conditions, as outlined above, with a 0.5 mM concentration of each individual substrate.

Construction of strain MDW-2M carrying an ameH gene disruption.

A 500-bp DNA fragment (in the middle of ameH) was amplified from the genomic DNA of strain MDW-2 with pEX-F and pEX-R primers to disrupt ameH through a single crossover (61) (Table 2). The fragment was cloned into plasmid pEX18Tc (62), digested with SacI and EcoRI using the ClonExpress II one-step cloning kit to generate pEX-ameH. pEX-ameH was introduced into strain MDW-2 by electroporation, as described by Zhang et al. (63). Single-crossover clones were selected on LB plates supplemented with kanamycin (50 μg/ml) and tetracycline (10 μg/ml). The ameH disruption mutant, designated strain MDW-2M, was verified by PCR. The loss of its ability to degrade methomyl was tested in MSM supplemented with 0.5 mM methomyl.

Complementation of the ameH disruption mutant.

A 951-bp fragment of ameH was PCR amplified from the genomic DNA of strain MDW-2 using primers pBBR1-F and pBBR1-R (Table 2). The PCR product was cloned into EcoRI and BamHI sites of the broad-host-range plasmid pBBR1MCS-4 (64) using the ClonExpress II one-step cloning kit to generate pBBR1-ameH. This plasmid was introduced into strain MDW-2M by electroporation to generate strain MDW-2M (pBBR1-ameH). The ability of this strain to degrade methomyl was tested in MSM supplemented with 0.5 mM methomyl.

Site-directed mutagenesis.

The point mutations were introduced in the ameH gene by overlap PCR. ameH-F and ameH-R were used as the forward and reverse flanking primers, respectively. The internal primer pairs G162A-F/R, N164A-F/R, D191A-F/R, H193A-F/R, and E207A-F/R are listed in Table 2. All PCRs were performed using Phanta Max Super-Fidelity DNA polymerase (Vazyme Biotech Co., Ltd., China) with the standard site-directed mutagenesis protocol (65). The PCR products were gel purified and cloned into NdeI and XhoI sites of pET-24b(+), as described above. Successful substitutions were confirmed by DNA sequencing. Purification of the recombinant proteins and their activity were detected, as described above.

Analytical methods.

The reaction solutions were centrifuged at 12,000 × g for 5 min, and the supernatants were filtered through 0.2-μm-pore-size filters to analyze methomyl and its metabolites. Methomyl concentrations were determined using a high-performance liquid chromatography (HPLC) system (600 controller, Rheodyne 7725i manual injector, and a 2487 dual-wavelength absorbance detector; Waters Co., Milford, MA) equipped with a C₁₈ reverse-phase column (4.6 by 250 nm; 5 μm). The mobile phase consisted of acetonitrile-water (50:50 [vol/vol]) at a flow rate of 0.8 ml min⁻¹. The column elution was monitored by measuring absorbance at 245 nm. Mass spectrum data were collected using a TripleTOF 5600 (AB SCIEX) mass spectrometer. The metabolites were ionized by electrospray with positive polarity, and characteristic fragment ions were detected using MS/MS.

To identify the substrate spectrum of AmeH, the amidase activity of AmeH with formamide and acetamide was determined by estimating ammonia release via the phenol-hypochlorite ammonia detection method (66). Carbaryl, isoprocarb, fenobucarb, propoxur, and carbofuran were detected by a HPLC system (Dionex UltiMate 3000, USA) equipped with a C₁₈ reverse-phase column (4.6 by 250 nm; 5 μm), with the mobile phase consisting of methanol-water (80:20 [vol/vol]) at a flow rate of 0.8 ml min⁻¹. The column elution was monitored by measuring the absorbance at 280 nm. Aldicarb and oxamyl were also detected by HPLC with a mobile phase consisting of acetonitrile-water (50:50 [vol/vol]) at a flow rate of 0.8 ml min⁻¹. The column elution was monitored by measuring the absorbance at 245 nm.

Data availability.

The data sets generated and analyzed in this study are available from the corresponding author upon request. Aminobacter aminovorans MDW-2 has been deposited in the China Center for Type Culture Collection (CCTCC) under accession number M2019221. Sequence data that support the findings of this study have been deposited in GenBank with the accession numbers MN686213 (methomyl hydrolase gene ameH) and CP060197 to CP060200 (genome sequence of strain MDW-2).