Skip to main content
International Journal of Microbiology logoLink to International Journal of Microbiology
. 2021 Mar 28;2021:6633888. doi: 10.1155/2021/6633888

AmpC β-Lactamase Variable Expression in Common Multidrug-Resistant Nosocomial Bacterial Pathogens from a Tertiary Hospital in Cairo, Egypt

Aliaa Ali El Shamy 1, Zainab Zakaria 2, Mahmoud M Tolba 3, Nermeen Salah Eldin 1, Al-Taher Rabea 2, Mahmoud M Tawfick 1,4, Hebatallah A Nasser 1,
PMCID: PMC8021464  PMID: 33854549

Abstract

The emergence of AmpC (pAmpC) β-lactamases conferring resistance to the third-generation cephalosporins has become a major clinical concern worldwide. In this study, we aimed to evaluate the expression of AmpC β-lactamase encoding gene among the pathogenic Gram-positive and Gram-negative resistant bacteria screened from clinical samples of Egyptian patients enrolled into El-Qasr El-Ainy Tertiary Hospital in Cairo, Egypt. A total of 153 bacterial isolates of the species Pseudomonas aeruginosa, Klebsiella pneumoniae, and Enterococcus faecium were isolated from patients diagnosed with urinary tract infection (UTI), respiratory tract infection (RTI), and wound infections. The total number of E. faecium isolates was 53, comprising 29 urine isolates, 5 sputum isolates, and 19 wound swab isolates, whereas the total number of P. aeruginosa isolates was 49, comprising 27 urine isolates, 7 sputum isolates, and 15 wound swab isolates, and that of the K. pneumoniae isolates was 51, comprising 20 urine isolates, 25 sputum isolates, and 6 wound swab isolates. Our results indicated that there is no significant difference in the expression of AmpC β-lactamase gene among the tested bacterial species with respect to the type of infection and/or clinical specimen. However, the expression patterns of AmpC β-lactamase gene markedly differed according to the antibacterial resistance characteristics of the tested isolates.

1. Introduction

The introduction of antibiotics to the clinical practice in the twentieth century to combat infectious diseases and microbes was indisputably a blessing to human civilization that has saved billions of people. However, antimicrobial resistance has steadily been increasing during the last decades and has become a global causative threat to human morbidity and mortality [1]. In the USA, more than 63,000 patients die every year because of hospital-acquired bacterial infections. Similarly, an estimation of 25,000 patients die yearly in Europe, due to infections with multidrug-resistant (MDR) bacteria. The widespread and incautious use of antibiotics has significantly contributed to the advent of resistant microbial strains [2]. Resistance to antimicrobials such as the third-generation cephalosporins, quinolones, and carbapenems continues, particularly, to increase sharply among Gram-negative bacterial pathogens [3].

According to the World Health Organization (WHO) global priority list of antimicrobial-resistant bacteria published in 2017, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Enterococcus faecium are among the common healthcare-associated pathogens of critical or high priority [4]. Pseudomonas aeruginosa is an aerobic Gram-negative bacterium that can cause infections in hospitalized patients, as well as in immunocompromised hosts and patients with cystic fibrosis. Therefore, it is one of the worldwide leading nosocomial pathogens that can cause serious nosocomial infections such as pneumonia, urinary tract infections (UTI), bloodstream infections (BSI), surgical-site infections. and skin infections [5]. It can also cause community-acquired infections including ulcerative keratitis, otitis externa, and skin and soft-tissue infections [6]. It is among the increasingly reported and commonly identified multidrug-resistant or even pan-drug-resistant bacteria [5]. Klebsiella pneumoniae is a type of Gram-negative bacteria associated with a wide spectrum of infections, such as UTI, pneumonia, intra-abdominal infections, BSI, meningitis, and pyogenic liver abscesses (PLA) [7], whereas Enterococcus faecium is a Gram-positive bacterium that began to emerge as a leading cause of multidrug-resistant hospital-acquired infections in the 1970s and 1980s, and it currently ranks among the leading causes of hospital-acquired infections of the bloodstream, urinary tract, surgical wounds, and other sites. It is also found to accompany the obligate anaerobes in mixed infections which results in intra-abdominal abscesses [8].

AmpC-type enzymes are β-lactamases that mediate resistance to cephalothin, cefazolin, cefoxitin, most penicillins, and β-lactamase inhibitor-β-lactam combinations [9]. These enzymes may be either encoded on the chromosomes of different microorganisms including many members of the Enterobacteriaceae family or on transmissible plasmids that harbor genes encoding AmpC enzymes in bacteria lacking or poorly expressing the chromosomal ones [10]. Carbapenems can usually be used to treat infections caused by AmpC-producing bacteria. However, carbapenem resistance may arise in some microorganisms by mutations that reduce influx (outer membrane porin loss) or enhance efflux (efflux pump activation) [10]. AmpC β-lactamases can barely degrade carbapenems, but they can covalently bind them to the periplasm and prevent them from accessing their targets [11]. In Egypt, antimicrobial resistance to third-generation cephalosporins is on the rise, causing nosocomial outbreaks. However, a few local studies analyzed the underlying genes behind these increasing resistances. Hence, in our study, we aimed to solve the dilemma of antibiotic resistance through evaluating the role of the expression of AmpC β-lactamase encoding gene among selected Gram-positive and Gram-negative MDR-resistant bacteria that commonly cause infections to patients enrolled into El-Qasr El-Ainy Tertiary Hospital in Cairo, Egypt. The MDR bacterial pathogens we selected were P. aeruginosa, K. pneumoniae, and E. faecium. They are categorized in the WHO global priority list of antimicrobial-resistant bacteria as pathogens with critical priority (P. aeruginosa and K. pneumoniae) or with high priority (E. faecium) [4]. In addition, the correlation between the AmpC β-lactamase expression and the type of different bacterial strains (Gram positive or Gram negative) and their isolation sources, as well as the correlation between the AmpC β-lactamase expression genotype and AmpC β-lactamase enzyme phenotype, was investigated.

2. Materials and Methods

The experimental design of the current study is summarized in Figure 1.

Figure 1.

Figure 1

Flowchart of the followed methodology in this study, drawn by BioRender (https://biorender.com/). (a)Bacterial isolates and clinical samples. (b)Antimicrobial susceptibility testing. (c)Cefoxitin-cloxacillin double-disc synergy test (CC-DDS). (d)Quantification of AmpC β-lactamase encoding gene expression.

2.1. Bacterial Isolates and Clinical Samples

This study was conducted following the Declaration of Helsinki and approved by the Ethics Committee of Heliopolis University and El-Qasr El-Ainy Hospital. Written informed consent was obtained from all participants. The samples were collected from December 2016 to January 2018 from hospitalized patients in El-Qasr El-Ainy Hospital. A total of 153 bacterial isolates obtained from the clinical samples were identified to be of the species P. aeruginosa, K. pneumoniae, and E. faecium. Bacterial isolates were identified to the species level using the conventional microbiological methods (cultural characteristics), and identification was confirmed using the Vitek 2 system (bioMérieux; Marcy l'Etoile, France).

These isolates were recovered from diverse clinical samples including urine, sputum, and wound swabs collected from patients suffering from urinary tract infections (UTIs), respiratory tract infections (RTIs), and wound infections, respectively. The total number of E. faecium isolates was 53, comprising 29 urine isolates, 5 sputum isolates, and 19 wound swab isolates, whereas the total number of P. aeruginosa isolates was 49, comprising 27 urine isolates, 7 sputum isolates, and 15 wound swab isolates. The total number of K. pneumoniae isolates was 51, comprising 20 urine isolates, 25 sputum isolates, and 6 wound swab isolates.

2.2. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing and minimum inhibitory concentration (MIC) determination using diverse antimicrobial classes were performed according to standard protocols, guidelines, and interpretive criteria described by the Clinical and Laboratory Standards Institute [12]. The standard strains P. aeruginosa ATCC 27853, K. pneumoniae ATCC 70060, and Enterococcus faecium ATCC 19434 (American Type Culture Collection, Manassas, VA, USA) were used as positive controls for the production of AmpC β-lactamase. E. coli ATCC 25922 was used as a negative control for the production of AmpC β-lactamase.

2.3. Detection of AmpC β-Lactamase Enzyme Phenotypes

2.3.1. Cefoxitin-Cloxacillin Double-Disc Synergy Test (CC-DDS)

This test was used to determine the production of AmpC β-lactamase enzyme in 111 isolates. Briefly, 0.5-McFarland suspensions of the test isolate were prepared from overnight cultures. Then, the adjusted suspensions were used to inoculate Muller-Hinton agar plates using sterile swabs. Discs containing 30 µg of cefoxitin plus 200 µg of cloxacillin (inhibitors of the AmpC enzyme) were added on the surface of the Muller-Hinton agar. Plates were finally incubated at 35°C for 16–18 hours. A difference in the cefoxitin-cloxacillin inhibition zones minus the cefoxitin alone zones of ≥4 mm was considered indicative for AmpC production [1315].

2.4. Quantification of AmpC β-Lactamase Encoding Gene Expression

2.4.1. Total RNA Extraction

Bacterial isolates were inoculated into 5 mL aliquots of the LB (Luria-Bertani) broth medium and incubated overnight with shaking (200 rpm) at 37°C. Next, isolates were subcultured in 50 mL aliquots of the LB broth medium and allowed to grow until they reached an optical density (OD600 nm) of 0.6—0.8; then, the cell pellets were harvested by centrifugation at 14000 rpm. The total RNA was extracted from each isolate using the GeneElute bacterial total RNA purification kit (Sigma Aldrich, USA) and eluted in RNase-free water following the manufacture's protocol. The DNA contaminants were eliminated by using 2 U of DNase I, RNase-free enzyme (Puregene, India). RNA concentration and purity were determined using the NanoDrop instrument (Nano-100, UK). The final RNA concentrations extracted from P. aeruginosa, K. pneumoniae, and E. faecium were 10 µg, 15 µg, and 12 µg, respectively, and the purity measured by OD 260/280 ratios was between 1.7 and 1.9 [16].

2.4.2. cDNA Synthesis and Quantitative Real-Time-PCR (RT-qPCR) Experiments

Complementary DNA (cDNA) was synthesized using the bacterial isolates extracted RNA template as follows. Firstly, 30 ng of the purified RNA was subjected to reverse transcription into cDNA using the HisenscriptTmRH [−] cDNA Synthesis Kit (iNtRON Biotechnology, Korea) using a PCR thermocycler (A & E Lab, UK). Then, 5 µl of the cDNA was used for real-time PCR amplification using the Maxima SYBR Green/ROX qPCR Master Mix (2X) (ThermoFisher Scientific, USA) with the StepOne Plus real-time PCR system (Applied biosystem, USA) [17]. All PCRs were performed in duplicate. The specific primers of genes were designed by the primer designing tool at the NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and synthesized by HVD life sciences, Cairo, Egypt. The genomic sequences of K. pneumoniae (GenBank accession no. EF125013.1) and E. faecium (GenBank accession no. NC_017960.1) were used as templates in designing the PCR primers. The oligonucleotide primers used in PCR amplifications are listed in Table 1. Bacterial isolates were considered as positive AmpC-producing bacteria if the mRNA levels of P. aeruginosa, K. pneumoniae, and E. faecium were at least 15-fold, 12-fold, and 10-fold overexpressed compared to the control strains.

Table 1.

PCR oligonucleotide primers used for the RT‐qPCR amplification of the AmpC gene extracted from the bacterial species of our study.

Bacterial species Primer name Sequence (5′—3′) PCR product Reference
P. aeruginosa PA. AmpC-F CGCCGTACAACCGGTGAT 113 bp [18]
PA. AmpC-R GAAGTAATGCGGTTCTCCTTTCA
K. pneumoniae KP. AmpC-F ATCTGGCAACCTATACCGCA 227 bp This study
KP. AmpC-R CTTGAGCGGCTTAAAGACCC
E. faecium EF. AmpC-F GATCGACAGGATGTACGCGA 300 bp This study
EF. AmpC-R CAGGTAACGCGGGTCTCTTT

2.5. Statistical Analysis

GraphPad Prism software (version 6.01) was used to perform statistical analysis. The quantitative statistical analyses were performed using one-way ANOVA to determine if there was a significant difference in the AmpC expression levels among the three resistant bacterial strains or the sample sources (urine, sputum, and wound). The Spearman correlation test, one tail at p < 0.05, was performed to test for correlation between the AmpC expression level and antimicrobial resistance. A p value of <0.05 was considered statistically significant.

3. Results

3.1. Antimicrobial Susceptibility Profiles

The antimicrobial susceptibility study showed that there is an overall high resistance of the bacterial isolates included in this study to β-lactam antibiotics (including ampicillin, amoxicillin, and piperacillin whether alone or in combination with β-lactamase inhibitors), as well as to cephalosporins. The antimicrobial resistance profiles of isolates are listed in Table 2. The recovered bacterial isolates showed high levels of multidrug resistance to the tested antimicrobial agents, as 93 out of the 153 isolates (60.8%) were resistant to three or more classes of antimicrobial agents and described as MDR. Moreover, 23 out of the 153 isolates (15%) were found to be susceptible to only one or two categories of antimicrobials and classified as extensively drug-resistant (XDR) bacterial isolates. For the detection of AmpC enzyme production, a CC-DDS phenotypic test revealed that 81% (43/53) of E. faecium isolates, 86% (44/51) of K. pneumoniae isolates, and 48.9% (24/49) of P. aeruginosa isolates were AmpC-producing phenotypes. The evaluation of AmpC β-lactamase encoding gene expression, by real-time PCR detection of AmpC transcript, showed that the gene is expressed in 81% (43/53) of E. faecium isolates and 86% (44/51) and 48.9% (24/49) of P. aeruginosa isolates (Figure 2 and Table 3).

Table 2.

Antimicrobial resistance patterns of isolates included in this study.

Antimicrobial agent E. faecium (53 isolates) N (%)∗∗ K. pneumoniae (51 isolates) N (%)∗∗ P. aeruginosa (49 isolates) N (%)∗∗
AMP 53 (100) 51 (100) 49 (100)
AMX 53 (100) 51 (100) 49 (100)
AMC 53 (100) 51 (100) 49 (100)
SAM 53 (100) 51 (100) 49 (100)
PIP 53 (100) 51 (100) 49 (100)
TZP 53 (100) 51 (100) 38 (77.6)
CEC 53 (100) 51 (100) 49 (100)
CFR 53 (100) 51 (100) 49 (100)
FEP 26 (49) 39 (78) 27 (55)
CFP 38 (72) 44 (86) 30 (61)
CTX 10 (19) 45 (88) 27 (55)
CAZ 53 (100) 45 (88) 40 (82)
CRO 11 (21) 45 (88) 41 (84)
CXM 11 (21) 45 (88) 39 (80)
MEM 26 (49) 36 (71) 18 (37)

AMP, ampicillin; AMX, amoxicillin; AMC, amoxicillin-clavulanate; SAM, ampicillin-sulbactam, TZP, PIP, piperacillin; piperacillin-tazobactam; CEC, cefaclor (30 μg); CFR, cefadroxil; FEP, cefepime; CFP, cefoperazone; CTX, cefotaxime; CAZ, ceftazidime; CRO, ceftriaxone; CXM, cefuroxime (axetil or sodium); MEM, meropenem. ∗∗Percentage of resistant isolates correlated to the total number of isolates within each bacterial species (N).

Figure 2.

Figure 2

AmpC β-lactamase expression pattern, evaluated by RT-qPCR, among the isolates of bacterial species included in this study recovered from urine, sputum, and wound swab.

Table 3.

Mean fold change of AmpC expression among the isolates of bacterial species isolated from urine, sputum, or wound swab samples and included in this study.

Bacterial species and mean fold of AmpC expression Clinical specimen p value
Urine Sputum Wound swab
P. aeruginosa Mean fold change of AmpC expression ± SE 0.799 ± 0.194 1.57 ± 0.821 0.538 ± 0.44 0.3278
Number (%) 13 (54.17%) 3 (12.50%) 8 (33.33%)

K. pneumoniae Mean fold change of AmpC expression ± SE 1.12 ± 0.3 1.17 ± 0.232 1.39 ± 0.531 0.9004
Number (%) 18 (40.91%) 21(47.73%) 5 (11.36%)

E. faecium Mean fold change of AmpC expression ± SE 1.03 ± 0.908 1.09 ± 0.461 0.835 ± 0.787 0.9869
Number (%) 25 (58.14%) 4 (9.30%) 14 (32.56%)

Total 56 (50.45%) 28 (25.23%) 27 (24.32%)

3.2. Quantification of AmpC β-Lactamase Encoding Gene Expression

Based on the expression fold change, AmpC β-lactamase gene was expressed in a total of 54 (48.65%) isolates comprising 13 (54.17%) P. aeruginosa isolates, 19 (43.18%) K. pneumoniae isolates, and 22 (51.16%) E. faecium isolates (Tables 2 and 4).

Table 4.

Mean fold change in differential expression of AmpC (AmpC expressed vs. AmpC unexpressed) among the bacterial species included in this study.

Bacterial species Number (%) Mean fold change of AmpC expression ± SE p value
AmpC expressed AmpC unexpressed AmpC expressed1 AmpC unexpressed
P. aeruginosa 13 (54.17%) 11 (45.83%) 1.552 ± 0.206 0.002 ± 0.239 ∗∗∗0.0001
K. pneumoniae 19 (43.18%) 25 (56.82%) 1.913 ± 0.165 0.081 ± 0.086 ∗∗∗0.0001
E. faecium 22 (51.16%) 21 (48.84%) 1.633 ± 0.096 −0.100 ± 0.087 ∗∗∗0.0001
Total 54 (48.65%) 57 (51.35%)

The fold change of the expression of the AmpC β-lactamase gene among the isolates of P. aeruginosa, K. pneumoniae, or E. faecium did not show any significant difference in their expression levels regardless of being from the urine, sputum, or wound swab origin, p > 0.05, as shown in Figure 2 and Table 3. The difference in the fold change of the expression of the AmpC β-lactamase encoding gene in the isolates of each bacterial species with AmpC expressed and those with AmpC unexpressed was revealed to be statistically significant indicated by three asterisks at the p value 0.0001 (Figure 3 and Table 3). However, it was found that the level of expressed AmpC β-lactamase gene within the three different species showed a nonsignificant difference of p > 0.05.

Figure 3.

Figure 3

AmpC β-lactamase expression evaluated by RT-qPCR among bacterial species included in this study.

4. Discussion

Antibacterial resistance (ABR) is the insensitivity of bacteria to antibacterial drugs, thus causing difficulty in the treatment of infectious diseases and, consequently, high mortality. AmpC β-lactamase, produced by the AmpC gene, is the first determined destroyer of the β-lactam ring of β-lactam antibiotics, resulting in the phenomenal challenge of ABR. Thus, the phenotypic and genotypic aspects of the AmpC gene concerning ABR are interesting to study [19, 20]. It has been shown that AmpC β-lactamase has potential repressing activities on a wide range of antibacterial agents. Indeed, it was reported that the resistance to drugs such as cephalothin, cefazolin, cefoxitin, and most penicillins was epidemiologically and genetically related to the expression of the AmpC gene in the bacterial species P. aeruginosa, K. pneumoniae, and E. faecium [2126]. Growing evidence shows that antimicrobial resistance towards third-generation cephalosporins is increasingly outbreaking in community hospitals that, in some cases, especially with Enterobacteriace infections, can cause mortality [27]. However, limited research investigated the causes. Therefore, in the current study, we aimed to evaluate the impact of AmpC expression on the resistance to different antibacterial agents among clinical isolates of three healthcare-associated pathogens collected from a tertiary hospital in Cairo, Egypt, namely, two Gram-negative (P. aeruginosa and K. pneumoniae) and one Gram-positive (E. faecium) bacteria with critical or high-priority classification, respectively, in the WHO global priority list of antimicrobial-resistant bacteria [4], and based on the bacterial strain and source of infection; three different sources of infection were used to recover the bacterial isolates. These sources were bacterial UTIs, RTIs, and wound infections. Contextually, the worldwide prevalence of bacterial UTIs is 11% [28] and that of RTIs is 5–15%, secondary to influenza virus infections [29].

As for the worldwide prevalence of the underinvestigated bacterial strains related to the source of infection, a study covering 3193 patients in 54 countries with confirmed diagnosis of community-acquired pneumonia (CAP) reported that P. aeruginosa was responsible for 4.2% and 2.0%, respectively, of the P. aeruginosa- and antibiotic-resistant P. aeruginosa-CAP infections. The critical rate of P. aeruginosa causing RTIs reached 67% of patients suffering from tracheostomy, bronchiectasis, and/or very severe chronic obstructive pulmonary disease [30]. In the UTIs/wound infections, P. aeruginosa was presented as the third causative factor in UTIs by 12% and wound infections by 29.6% [31]. For K. pneumoniae, it is prevalently responsible for 15–40%/32.6% of pneumonia/UTIs cases, respectively [30]. It is reported that E. faecium is prevalently responsible for 15% of infections commonly caused by enterococci such as UTIs, RTIs, and wound infections [3234].

In the current study, the expression of the AmpC β-lactamase gene investigated by the expression patterns of the AmpC β-lactamase gene, in resistant and nonresistant isolates, was analyzed using RT-qPCR experiments in 153 clinical isolates of P. aeruginosa, K. pneumoniae, and E. faecium (Table 4). Results revealed that there was no significant difference in AmpC overexpression among the tested bacterial species, regardless of their Gram ± phenotype, type of infection, or clinical specimen.

This is a confirmation of what was previously reported in [11] that in GenBank, AmpC genes are included in COG 1680, where COG stands for a cluster of orthologous groups. COG 1680 comprises other penicillin-binding proteins as well as class C β-lactamases and includes proteins from archaea as well as bacteria, Gram-positive as well as Gram-negative organisms.

Our study demonstrated that the expression of the AmpC gene was detected in a total of 54 (48.65%) isolates of P. aeruginosa, K. pneumoniae, and E. faecium with no significant difference in the AmpC expression level concerning the type of infection or the source of specimen, urine (AmpC expression of 50.45% where n = 56), sputum (AmpC expression of 25.23% where n = 28), or wound swab (AmpC expression of 24.32% where n = 27). These findings are consistent with the results of another study from Egypt regarding the expression of AmpC β-lactamase in microorganisms obtained from Ain Shams University Hospital of Egypt, indicating that 34.8% (22/46) isolates of K. pneumoniae showed overexpression of the AmpC gene [35, 36]. We found that 60% of isolates tested in this study were MDR, which is along the same line of another study conducted in Egypt, and found that 87.5% of the clinical isolates were MDR [37]. Indeed, isolates recorded as AmpC positive using the cefoxitin disc test showed resistance to diverse antimicrobial classes including cephalosporins, ciprofloxacin, amikacin, levofloxacin, cefoperazone-sulbactam, piperacillin/tazobactam, meropenem, and imipenem [38]. Moreover, there was no significant difference in the AmpC expression level in comparison to antibacterial resistance to the abovementioned antibiotics using the Spearman correlation, p > 0.05. That means that there may be other genes which can play an important role together with the AmpC gene in the antibiotic resistance.

For ABR by K. pneumoniae, efforts were put to find the temporal seasonal correlation between its ABR and misuse of β-lactam/β-lactamase inhibitors (BLBLIs), so statistical analysis has been performed by another group to correlate the annually prescribed antibiotics at a tertiary-care hospital of Korean Health Insurance to the detected ABR cases. They found that replacing carbapenems with BLBLIs is not the ideal solution, as ABR is likely to spread rapidly against the piperacillin/tazobactam combination [39]. Also, it was indicated that β-arrestin recruiting gene is a crucial inducer of the β-lactamase signaling pathway, increasing the ABR of K. pneumoniae against clindamycin, erythromycin, linezolid, and penicillin [40].

For P. aeruginosa, our findings are consistent with those of another study which revealed that AmpC-positive P. aeruginosa isolates obtained from burn patients exhibited resistance to cephalosporins and carbapenems [41]. The underlying molecular factors of AmpC positivity in P. aeruginosa were illustrated as the occurrence of genetic mutations in the gene blaAmpC which encodes a wide-spectrum class C β-lactamase and AmpR-activating mutation (G154R), causing an extended-spectrum AmpCs resistance to ticarcillin and piperacillin, monobactams (aztreonam), and third-generation (ceftazidime) and fourth-generation (cefepime) cephalosporins [42, 43]. An extended screening study in northeast China reported that the high prevalence of MDR P. aeruginosa strains exhibiting resistance to ticarcillin/clavulanic acid, piperacillin/tazobactam, cefoperazone/sulbactam, piperacillin, imipenem, meropenem, ceftazidime, cefepime, ciprofloxacin, and levofloxacin is significantly correlated to infections occurring after hospital admission [44]. Moreover, a retrospective study that investigated the development of resistance to antimicrobials in P. aeruginosa showed that imipenem or ciprofloxacin therapy is a key factor of producing resistant strains of P. aeruginosa [45]. Similarly, it was indicated that the ABR of E. faecium to β-lactams is correlated with possessing the blaZ-blaI-blaR1 operon [46].

Many genes are speculated to be involved in the complicated antibiotic resistance characteristics of microorganisms, but the data available are limited. The genetic clarification that the hyperproduction of AmpC increases the resistance to β-lactams is corroborated by the diarrheagenic E. coli (DEC) studies. Based on the transcriptome analysis of AmpC β-lactamases isolated from DEC, it was reported that mutational changes occurred within the AmpC β-lactamase genes resulting in its increased transcription [47]. Moreover, it was indicated that the mutations of β-N-acetylglucosaminidase and PG recycling enzyme play a crucial role in enhancing the AmpC expression via interaction with ampR, the regulatory gene of AmpC, additionally to the plasmid-carrying AmpC gene as a source of AmpC overexpression [43, 48]. It was reported, in the case of drug-sensitive isolates, that the mRNA expression levels were mostly found downregulated, except for few isolates where they were comparable to the control strains, suggesting their nonpathogenic nature. However, the downregulation in sensitive strains could be a result of the process of genetic gain or development. Constitutive expression of AmpC occurs at a lower level in E. coli [49, 50]; however, various mutations may result in constitutive overexpression of the β-lactamase-producing genes [5153].

To uncover the extent of the remarkable crisis of AmpC impact on ABR, we investigated the antimicrobial resistance patterns of the screened isolates and correlated them with the phenotypic overexpression of AmpC. Our results showed that the isolates of the diverse bacterial species included in the study, regardless of their source of infection, were 100% resistant to ampicillin, amoxicillin, amoxicillin-clavulanate, ampicillin-sulbactam, piperacillin, piperacillin-tazobactam, and cefaclor. Overall, the bacterial isolates showed a multidrug-resistance rate of 60.8% and an extended drug resistance of 15%. Consistently, these findings owe positively phenotypic correlations to the CC-DDS test whose results for AmpC are 81% (43/53) for E. faecium isolates, 86% (44/51) for K. pneumoniae isolates, and 48.9% (24/ 49) for P. aeruginosa isolates. From these findings, it is evident that 100% of the tested isolates show ABR to a broad number of antimicrobials. Moreover, we observed that only 48.65% of the isolates showed an expressed AmpC gene, suggesting that AmpC is not the only factor responsible for ABR and that the phenomenal ABR is a complex process involving multigenetic factors.

To tailor an effective solution for the dilemma of ABR, it is recommended to possess a comprehensive understanding of the biological causes of ABR by β-lactams, design novel therapies for microorganisms exhibiting ABR based on our understanding of its underlying factors, and shed light on the widespread antibiotic misuse. The known causes of ABR may be summarized as follows: (i) showing resistance to the bacterial cell wall active agents such as β-lactams (e.g., ampicillin and penicillin) which exert an inhibiting activity on the peptidoglycan synthesis of the cell wall, as in E. faecium. This resistance property may be rendered by mutated overexpressed pbp5 (Met485 ⟶ Ala) and LDTfm, resulting in lowered binding affinity of the β-lactams to the bacterial cell wall, thus allowing the peptidoglycan synthesis [54, 55]. (ii) Drug inactivation: the β-lactam ring is directly susceptible to cleavage by β-lactamase enzymes encoded by the gene blaZ which inactivates antibiotics [56]. (iii) Cell signaling/resistance by mutation: acquired mutations of the intrinsic genes in E. faecium are crucial factors causing ABR. Mutated CroRS [57, 58], IreP, and IreK cause resistance to cephalosporins [39]. In this respect, it was revealed that β-arrestin is a master player for K. pneumoniae to generate resistance to β-lactams [59]. For P. aeruginosa, deficiency in oprD porin results in developing resistance to carbapenems. Additionally, resistance of P. aeruginosa to β-lactams is due to the intrinsic mutated genes (mexR, nalB, nalC, or nalD)/nfxB as key factors for overexpression of MexAB-OprM/MexCD–OprJ, respectively [39, 53, 60, 61]. Based on the antimicrobial susceptibility profiles in the current study, it is strongly hypothesized that K. pneumoniae, P. aeruginosa, and E. faecium isolates have multicausative factors for ABR. Hence, these isolates showed similar resistance patterns to the tested antimicrobials.

It is worth mentioning that the critical question of “how these abovementioned resistance-related genes, either in sequence or in expression, result in ABR?” is not fully answered, and the underlying mechanisms are not clearly understood. The proposed answer is based on knockdown assays to uncover the phenotype of genetic functions of the bacterial susceptibility to antibiotics [6264]. Moreover, the global health issue of antibiotic misuse is an important driving reason to ABR, as antibiotic misuse evolves hypermutable bacteria through the natural selection empowerment against antibiotics, mediated by the transfer of transmissible resistance (R) plasmids [65] through bacterial cell walls of different microorganisms as carriers of genes encoding β-lactamase enzymes [63].

Besides, it is worth stating that antibacterial vaccines, based on bacterial pathogenesis and antiviral vaccines, for the viruses causing a secondary bacterial infection are a blessing that results in the reduction of prescribed antibiotics [66, 67]. As potentially solving approaches for ABR, (i) it is by replacing antibiotics with phage therapy [68], (ii) phage therapy owes significant specificity to bacteria than antibiotics and controllable to be biologically designed against wide bacterial spectrum, (iii) CRISPR-Cas9 is a promising biotechnological tool to abolish pathogenically bacterial genes causing their ABR, especially for children and elders [69, 70], and (iv) further studies for comprehensive understanding of the molecular biology behind AmpC overexpression are required to develop new drugs for resistant infections.

Our work is an addition to the field of bacterial infection therapeutics, aiming to oppose the common habit of antibiotic misuse [65] by healthy individuals, to avoid the emergence of resistant microorganisms. We recommend the performance of further studies to discover new therapeutic alternatives other than the antibiotic-monotherapy for different bacterial infections.

Acknowledgments

The authors would like to acknowledge Mr. Mohamed Tarek, Ms. Esraa Effat, Ms. Esraa Abdelaziz, and Mr. Mohammed Soliman, Faculty of Pharmacy, Heliopolis University, Egypt, for sustainable development and for their help in implementing this work by preparing and collecting the isolates.

Data Availability

Data used to support this study can be obtained upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  • 1.Frieri M., Kumar K., Boutin A. Antibiotic resistance. Journal of Infection and Public Health. 2017;10(4):369–378. doi: 10.1016/j.jiph.2016.08.007. [DOI] [PubMed] [Google Scholar]
  • 2.Freire-Moran L., Aronsson B., Manz C., et al. Critical shortage of new antibiotics in development against multidrug-resistant bacteria-time to react is now. Drug Resistance Updates. 2011;14(2):118–124. doi: 10.1016/j.drup.2011.02.003. [DOI] [PubMed] [Google Scholar]
  • 3.Bin Zaman S., Hussain M. A., Nye R., Mehta V., Mamun K. T., Hossain N. A review on antibiotic resistance: alarm bells are ringing. Cureus. 2017;9(6) doi: 10.7759/cureus.1403.e1403 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.World Health Organization. Prioritization of Pathogens to Guide Discovery, Research and Development of New Antibiotics for Drug Resistant Bacterial Infections, Including Tuberculosis. Geneva, Switzerland: Wrold Health Organization; 2017. https://doi.org/WHOreferencenumber:WHO/EMP/IAU/2017.12. [Google Scholar]
  • 5.Roca I., Akova M., Baquero F., et al. The global threat of antimicrobial resistance: science for intervention. New Microbes and New Infections. 2015;6:22–29. doi: 10.1016/j.nmni.2015.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Potron A., Poirel L., Nordmann P. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: mechanisms and epidemiology. International Journal of Antimicrobial Agents. 2015;45(6):568–585. doi: 10.1016/j.ijantimicag.2015.03.001. [DOI] [PubMed] [Google Scholar]
  • 7.Driscoll J. A., Brody S. L., Kollef M. H. The epidemiology, pathogenesis and treatment of Pseudomonas aeruginosa infections. Drugs. 2007;67(3):351–368. doi: 10.2165/00003495-200767030-00003. [DOI] [PubMed] [Google Scholar]
  • 8.Vading M., Nauclér P., Kalin M., Giske C. G. Invasive infection caused by Klebsiella pneumoniae is a disease affecting patients with high comorbidity and associated with high long-term mortality. PLoS ONE. 2018;13 doi: 10.1371/journal.pone.0195258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lebreton F., Willems R. J. L., Gilmore M. S. Enterococcus diversity, origins in nature, and gut colonization. In: Gilmore M. S., Clewell D. B., Ike Y., et al., editors. Enterococci: From Commensals to Leading Causes of Drug Resistant Infection. Boston, MA, USA: Massachusetts Eye and Ear Infirmary; 2014. [PubMed] [Google Scholar]
  • 10.Van Boxtel R., Wattel A. A., Arenas J., Goessens W. H. F., Tommassen J. Acquisition of carbapenem resistance by plasmid-encoded-AmpC-expressing Escherichia coli. Antimicrobial Agents Chemother. 2017;61(1):e01413–e0116. doi: 10.1128/aac.01413-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jacoby G. A. AmpC β-lactamases. Clinical Microbiology Reviews. 2009;22(1):161–182. doi: 10.1128/cmr.00036-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Polsfuss S., Bloemberg G. V., Giger J., Meyer V., Böttger E. C., Hombach M. Practical approach for reliable detection of AmpC beta-lactamase-producing Enterobacteriaceae. Journal of Clinical Microbiology. 2011;49(8):2798–2803. doi: 10.1128/jcm.00404-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility. Annapolis, MD, USA: Clinical and Laboratory Standards Institute; 2018. [Google Scholar]
  • 14.Yagi T., Wachino J.-I., Kurokawa H., et al. Practical methods using boronic acid compounds for identification of class C -lactamase-producing Klebsiella pneumoniae and Escherichia coli. Journal of Clinical Microbiology. 2005;43(6):2551–2558. doi: 10.1128/jcm.43.6.2551-2558.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Brenwald N. P., Jevons G., Andrews J., Ang L., Fraise A. P. Disc methods for detecting AmpC β-lactamase-producing clinical isolates of Escherichia coli and Klebsiella pneumoniae. Journal of Antimicrobial Chemotherapy. 2005;56(3):600–601. doi: 10.1093/jac/dki278. [DOI] [PubMed] [Google Scholar]
  • 16.Sigma-Aldrich. GenEluteTM Total RNA Purification Kit. Product Information. St. Louis, MO, USA: Sigma-Aldrich; 2020. [Google Scholar]
  • 17.Thermo Scientific. Maxima SYBR Green/ROX qPCR Master Mix (2X) Waltham, MA, USA: Thermo Fisher Scientific; 2011. [Google Scholar]
  • 18.Tam V. H., Schilling A. N., LaRocco M. T., et al. Prevalence of AmpC over-expression in bloodstream isolates of Pseudomonas aeruginosa. Clinical Microbiology and Infection. 2007;13(4):413–418. doi: 10.1111/j.1469-0691.2006.01674.x. [DOI] [PubMed] [Google Scholar]
  • 19.Kong K.-F., Schneper L., Mathee K. Beta-lactam antibiotics: from antibiosis to resistance and bacteriology. Apmis. 2010;118(1):1–36. doi: 10.1111/j.1600-0463.2009.02563.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bush K., Bradford P. A. β-lactams and β-lactamase inhibitors: an overview. Cold Spring Harbor Perspective Medicine. 2016;6 doi: 10.1101/cshperspect.a025247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tamma P. D., Doi Y., Bonomo R. A., Johnson J. K., Simner P. J. A primer on AmpC β-lactamases: necessary knowledge for an increasingly multidrug-resistant World. Clinical Infectious Diseases. 2019;69(8):1446–1455. doi: 10.1093/cid/ciz173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.King D. T., Sobhanifar S., Strynadka N. C. J. The mechanisms of resistance to β-lactam antibiotics. Handbook of Antimicrobial Resistance. 2017;23:177–201. doi: 10.1007/978-1-4939-0694-9_10. [DOI] [Google Scholar]
  • 23.De Jesus M. B., Ehlers M. M., Dos Santos R. F., Kock M. M. Review—understanding β-lactamase producing Klebsiella pneumoniae. In: Ossiprandi M. C., editor. Antimicrob. Resistance—An Open Challenge. London, UK: In Tech; 2015. [DOI] [Google Scholar]
  • 24.Iseppi R., Di Cerbo A., Messi P., Sabia C. Antibiotic resistance and virulence traits in vancomycin-resistant enterococci (Vre) and extended-spectrum β-lactamase/AmpC-producing (ESBL/AmpC) enterobacteriaceae from humans and pets. Antibiotics. 2020;9(4):p. 152. doi: 10.3390/antibiotics9040152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tankhiwlae S. Beta-lactamases in P. aeruginosa: a threat to clinical therapeutics. Current Pediatric Research. 2016;4 [Google Scholar]
  • 26.Medina M., Castillo-Pino E. An introduction to the epidemiology and burden of urinary tract infections. Therapeutic Advances in Urology. 2019;11 doi: 10.1177/1756287219832172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Angela Dramowski, Ong’ayo G., Rehman A. M., et al. Mortality attributable to third-generation cephalosporin resistance in gram-negative bloodstream infections in african hospitals: a multi-site retrospective study. JAC-antimicrobial Resistance. 2021;3(1) doi: 10.1093/jacamr/dlaa130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.WHO. The Global Impact of Respiratory Disease. Lausanne, Switzerland: European Respiratory Society; 2017. [Google Scholar]
  • 29.Restrepo M. I., Babu B. L., Reyes L. F., et al. Burden and risk factors for Pseudomonas aeruginosa community-acquired pneumonia: a multinational point prevalence study of hospitalised patients. Euroean Respiratory Journal. 2018;52(2) doi: 10.1183/13993003.01190-2017.1701190 [DOI] [PubMed] [Google Scholar]
  • 30.Ranjan K. P., Ranjan N., Bansal S. K., Arora D. R. Prevalence of Pseudomonas aeruginosa in post-operative wound infection in a referral hospital in Haryana, India. Journal of Laboratory Physicians. 2010;2(2):74–77. doi: 10.4103/0974-2727.72153. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 31.Won S. Y., Munoz-Price L. S., Lolans K., Hota B., Weinstein R. A., Hayden M. K. Emergence and rapid regional spread of Klebsiella pneumoniae carbapenemase-producing enterobacteriaceae. Clinical Infectious Diseases. 2011;53(6):532–540. doi: 10.1093/cid/cir482. [DOI] [PubMed] [Google Scholar]
  • 32.Arias C. A., Murray B. E. Enterococcus species, Streptococcus gallolyticus group, and leuconostoc species. Mandell Douglas and Bennett’s Principles and Practice Infectious Disease. 2014;2:2328–2339. doi: 10.1016/B978-1-4557-4801-3.00202-2. [DOI] [Google Scholar]
  • 33.Bereket W., Hemalatha K., Getenet B., et al. Update on bacterial nosocomial infections. European Review for Medical and Pharmacological Sciences. 2012;16(8):1039–1044. [PubMed] [Google Scholar]
  • 34.El-Hady S. A., Adel L. A. Occurrence and detection of AmpC β-lactamases among enterobacteriaceae isolates from patients at Ain Shams university hospital. Egyptian Journal of Medical Human Genetics. 2015;16(3):239–244. doi: 10.1016/j.ejmhg.2015.03.001. [DOI] [Google Scholar]
  • 35.El-Kholy A. A., Girgis S. A., Shetta M. A. F., Abdel-Hamid D. H., Elmanakhly A. R. Molecular characterization of multidrug-resistant gram-negative pathogens in three tertiary hospitals in Cairo, Egypt. European Journal of Clinical Microbiology & Infectious Diseases. 2020;39(5):987–992. doi: 10.1007/s10096-020-03812-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Pishtiwan A. H., Khadija K. M. Prevalence of blaTEM, blaSHV, and blaCTX-M genes among ESBL-producing Klebsiella pneumoniae and Escherichia coli isolated from thalassemia patients in Erbil, Iraq. Mediterranean Journal of Hematology and Infectious Diseases. 2019;11(1) doi: 10.4084/MJHID.2019.041.e2019041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Younas S., Ejaz H., Zafar A., Ejaz A., Saleem R., Javed H. AmpC beta-lactamases in Klebsiella pneumoniae: an emerging threat to the paediatric patients. The Journal of the Pakistan Medical Association. 2018;68(6):893–897. [PubMed] [Google Scholar]
  • 38.Ryu S., Klein E. Y., Chun B. C. Temporal association between antibiotic use and resistance in Klebsiella pneumoniae at a tertiary care hospital. Antimicrobial Resistance Infection Control. 2018;7(83) doi: 10.1186/s13756-018-0373-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wei J., Wenjie Y., Ping L., Na W., Haixia R., Xuequn Z. Antibiotic resistance of Klebsiella pneumoniae through β-arrestin recruitment-induced β-lactamase signaling pathway. Experimental and Therapeutic Medicine. 2018;15:2247–2254. doi: 10.3892/etm.2018.5728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Mirsalehian A., Kalantar-Neyestanaki D., Nourijelyani K., et al. Detection of AmpC-β-lactamases producing isolates among carbapenem resistant P. aeruginosa isolated from burn patient. Iranian Journal of Microbiology. 2014;6(5):306–310. [PMC free article] [PubMed] [Google Scholar]
  • 41.Berrazeg M., Jeannot K., Ntsogo Enguéné V. Y., et al. Mutations in β-lactamase AmpC increase resistance of Pseudomonas aeruginosa isolates to antipseudomonal cephalosporins. Antimicrobial Agents and Chemotherapy. 2015;59(10):6248–6255. doi: 10.1128/aac.00825-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Balasubramanian D., Kumari H., Mathee K. Pseudomonas aeruginosa AmpR: an acute-chronic switch regulator. Pathogens and Disease. 2014;73(2):1–14. doi: 10.1111/2049-632X.12208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Xu J., Duan X., Wu H., Zhou Q. Surveillance and correlation of antimicrobial usage and resistance of Pseudomonas aeruginosa: a hospital population-based study. PLoS ONE. 2013;8(11) doi: 10.1371/journal.pone.0078604.e78604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kallel H., Mahjoubi F., Dammak H., et al. Correlation between antibiotic use and changes in susceptibility patterns of Pseudomonas aeruginosa in a medical-surgical intensive care unit. Indian Journal of Critical Care Medicine. 2008;12(1):18–23. doi: 10.4103/0972-5229.40945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sarti M., Campanile F., Sabia C., Santagati M., Gargiulo R., Stefani S. Polyclonal diffusion of beta-lactamase-producing Enterococcus faecium. Journal of Clinical Microbiology. 2012;50(1):169–172. doi: 10.1128/jcm.05640-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Singh T., Singh P. K., Das S., Wani S., Jawed A., Dar S. A. Transcriptome analysis of beta-lactamase genes in diarrheagenic Escherichia coli. Scientific Report. 2019;9 doi: 10.1038/s41598-019-40279-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Ruh E., Zakka J., Hoti K., et al. Extended-spectrum β-lactamase, plasmid-mediated AmpC β-lactamase, fluoroquinolone resistance, and decreased susceptibility to carbapenems in Enterobacteriaceae: fecal carriage rates and associated risk factors in the community of Northern Cyprus. Antimicrobial Resistance Infection Control. 2019;8(98) doi: 10.1186/s13756-019-0548-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Jaurin B., Grundström T., Edlund T., Normark S. The E. coli β-lactamase attenuator mediates growth rate-dependent regulation. Nature. 1981;290(5803):221–225. doi: 10.1038/290221a0. [DOI] [PubMed] [Google Scholar]
  • 49.Jaurin B., Grundström T., Normark S. Sequence elements determining AmpC promoter strength in E. coli. The EMBO Journal. 1982;1(7):875–881. doi: 10.1002/j.1460-2075.1982.tb01263.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Corvec S., Caroff N., Espaze E., Marraillac J., Reynaud A. −11 mutation in the AmpC promoter increasing resistance to β-lactams in a clinical Escherichia coli strain. Antimicrobial Agents and Chemotherapy. 2002;46(10):3265–3267. doi: 10.1128/aac.46.10.3265-3267.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tracz D. M., Boyd D. A., Bryden L., et al. Increase in AmpC promoter strength due to mutations and deletion of the attenuator in a clinical isolate of cefoxitin-resistant Escherichia coli as determined by RT-PCR. Journal of Antimicrobial Chemotherapy. 2005;55(5):768–772. doi: 10.1093/jac/dki074. [DOI] [PubMed] [Google Scholar]
  • 52.Tracz D. M., Boyd D. A., Hizon R., et al. AmpC gene expression in promoter mutants of cefoxitin-resistantEscherichia coliclinical isolates. FEMS Microbiology Letters. 2007;270(2):265–271. doi: 10.1111/j.1574-6968.2007.00672.x. [DOI] [PubMed] [Google Scholar]
  • 53.Duez C., Hallut S., Rhazi N., et al. The ponA gene of Enterococcus faecalis JH2-2 codes for a low-affinity class A penicillin-binding protein. Journal of Bacteriology. 2004;186(13):4412–4416. doi: 10.1128/jb.186.13.4412-4416.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Rice L. B., Bellais S., Carias L. L., et al. Impact of specific pbp5 mutations on expression of β-lactam resistance in Enterococcus faecium. Antimicrobial Agents and Chemotherapy. 2004;48(8):3028–3032. doi: 10.1128/aac.48.8.3028-3032.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Hackbarth C. J., Chambers H. F. blaI and blaR1 regulate beta-lactamase and PBP 2a production in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 1993;37(5):1144–1149. doi: 10.1128/aac.37.5.1144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Le Breton Y., Muller C., Auffray Y., Rincé A. New insights into the Enterococcus faecalis CroRS two-component system obtained using a differential-display random arbitrarily primed PCR approach. Applied and Environmental Microbiology. 2007;73(11):3738–3741. doi: 10.1128/aem.00390-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Muller C., Le Breton Y., Morin T., Benachour A., Auffray Y., Rincé A. The response regulator CroR modulates expression of the secreted stress-induced salB protein in Enterococcus faecalis. Journal of Bacteriology. 2006;188(7):2636–2645. doi: 10.1128/jb.188.7.2636-2645.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Kristich C. J., Wells C. L., Dunny G. M. A eukaryotic-type Ser/Thr kinase in Enterococcus faecalis mediates antimicrobial resistance and intestinal persistence. Proceedings of the National Academy of Sciences. 2007;104(9):3508–3513. doi: 10.1073/pnas.0608742104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Lambert P. A. Mechanisms of antibiotic resistance in Pseudomonas aeruginosa. Journal of the Royal Society Medicine. 2002;95:22–26. [PMC free article] [PubMed] [Google Scholar]
  • 60.Pang Z., Raudonis R., Glick B. R., Lin T.-J., Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnology Advances. 2019;37(1):177–192. doi: 10.1016/j.biotechadv.2018.11.013. [DOI] [PubMed] [Google Scholar]
  • 61.Stone A. B. R factors: plasmids conferring resistance to antibacterial agents. Science Progress. 1975;62(245):89–101. [PubMed] [Google Scholar]
  • 62.Elden N. M. K., Nasser H. A., Alli A., et al. Risk factors of antibiotics self-medication practices among university students in Cairo, Egypt. Open Access Macedonian Journal of Medical Sciences. 2020;8(3):7–12. doi: 10.3889/oamjms.2020.3323. [DOI] [Google Scholar]
  • 63.Price M. N., Wetmore K. M., Waters R. J., et al. Mutant phenotypes for thousands of bacterial genes of unknown function. Nature. 2018;557(7706):503–509. doi: 10.1038/s41586-018-0124-0. [DOI] [PubMed] [Google Scholar]
  • 64.Peters J. M., Colavin A., Shi H., et al. A comprehensive, CRISPR-based functional analysis of essential genes in bacteria. Cell. 2016;165(6):1493–1506. doi: 10.1016/j.cell.2016.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Zimmer A. M., Pan Y. K., Chandrapalan T., Kwong R. W. M., Perry S. F. Loss-of-function approaches in comparative physiology: is there a future for knockdown experiments in the era of genome editing? Journal of Experimental Biololgy. 2019;222 doi: 10.1242/jeb.175737. [DOI] [PubMed] [Google Scholar]
  • 66.Ernst J. D. Toward the development of antibacterial vaccines: report of a symposium and workshop. Clinical Infection Disease. 1999;29:1295–1302. doi: 10.1086/313484. [DOI] [PubMed] [Google Scholar]
  • 67.Jansen K. U., Knirsch C., Anderson A. S. The role of vaccines in preventing bacterial antimicrobial resistance. Nature Medicine. 2018;24(1):10–19. doi: 10.1038/nm.4465. [DOI] [PubMed] [Google Scholar]
  • 68.Moghadam M. T., Amirmozafari N., Shariati A., et al. How phages overcome the challenges of drug resistant bacteria in clinical infections. Infection and Drug Resistance. 2020;13:45–61. doi: 10.2147/IDR.S234353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Shabbir M. A. B., Shabbir M. Z., Wu Q., et al. CRISPR-cas system: biological function in microbes and its use to treat antimicrobial resistant pathogens. Annal of Clinical Microbiology and Antimicrobials. 2019;18(1):p. 21. doi: 10.1186/s12941-019-0317-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rodrigues M., McBride S. W., Hullahalli K., Palmer K. L., Duerkop B. A. Conjugative delivery of CRISPR-Cas9 for the selective depletion of antibiotic-resistant enterococci. Antimicrobial Agents and Chemotherapy. 2019;63(11) doi: 10.1128/aac.01454-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data used to support this study can be obtained upon request.


Articles from International Journal of Microbiology are provided here courtesy of Wiley

RESOURCES