Abstract
Necrotizing enterocolitis (NEC) is a devastating gastrointestinal disease of prematurity that typically develops after the administration of infant formula, suggesting a link between nutritional components and disease development. One of the most significant complications that develops in patients with NEC is severe lung injury. We have previously shown that the administration of a nutritional formula that is enriched in pre-digested triglycrides that do not require lipase action can significantly reduce the severity of NEC in a mouse model. We now hypothesize that this ‘pre-digested fat system (PDF)’ may reduce NEC-associated lung injury. In support of this hypothesis, we now show that rearing newborn mice on a nutritional formula based on the ‘pre-digested fat (PDF) system’ promotes lung development, as evidenced by increased tight junctions and surfactant protein expression. Mice who were administered this ‘PDF fat system’ were significantly less vulnerable to the development of NEC-induced lung inflammation, and the administration of the ‘PDF fat system’ conferred lung protection. In seeking to define the mechanisms involved, the administration of the PDF system’ significantly enhanced lung maturation and reduced the production of reactive oxygen species (ROS). These findings suggest that the PDF system protects the development of NEC-induced lung injury through effects on lung maturation and reduced reactive oxygen species in the lung, and also increase lung maturation in non-NEC mice.
Keywords: Necrotizing enterocolitis, lung injury, infant nutrition, reactive oxygen species
Introduction
Necrotizing enterocolitis (NEC) is a devastating disease of prematurity, and a leading cause of death from gastrointestinal disease in the neonatal intensive care units of hospitals around the world (1; 2; 3). One of the most devastating complications of NEC is the development of lung injury (4), which is more severe than the lung injury which occurs in premature infants who do not develop NEC (5; 6). In seeking to understand the causes of NEC and its associated lung injury, a growing body of research (7) has shown that NEC typically develops in the premature infant in the setting of an abnormal microbiome that is enriched in gram negative bacteria(8), often after the administration of formula feeds(9). These findings suggest that the interplay between formula administration and gut immaturity combine in the pathogenesis of this disease(10). Prior studies – including our own - have focused on the first of these factors, showing that the premature intestine expresses high levels of the bacterial receptor, TLR4, which becomes activated by the abnormal microbiome of the premature host, leading to barrier injury and NEC (11; 12). There has been less focus on the role of infant formula in NEC development, which represents a significant gap in our knowledge. This gap is particularly important given that the solid link between formula administration and NEC development reveals that specific components of the infant formula may contribute to both NEC development and the presence of NEC-induced lung injury(13). The precise components of formula that induce NEC, and strategies to manipulate these components as a therapeutic approach for NEC and NEC-induced lung injury, thus remain of great interest.
In seeking to understand the mechanisms leading to the development of NEC-induced lung injury, our laboratory has recently shown that the activation of TLR4 on the intestinal epithelium leads to the release of the damage associated molecule HMGB1, which can activate TLR4 on the pulmonary epithelium, resulting in NEC (14). Mice lacking HMGB1 on the intestinal epithelium, and mice lacking TLR4 in the lung epithelium, were both protected from NEC, indicating that a link between the gut and the lung leads to disease development. Moreover, the presence of greater lung immaturity and impaired lung development could also contribute to the presence of lung injury in NEC (15; 16). In seeking to understand how nutritional strategies could influence NEC development, we recently developed a modified fat nutritional formula which is enriched in fats that do not require lipase for their digestion, an approach that was based upon the known deficiency of lipase in the premature host (13). Administration of formula containing this pre-digested fat (which we called the ‘PDF’ system) in place of standard formula reduced experimental NEC in mice, through the reduction of ROS within the intestinal mucosa(13). We now seek to extend these studies to test whether administration of an formulas that is enriched in “PDF system” could prevent the development of NEC-associated lung injury in neonatal mice, and if so, whether it could do so by enhancing lung development.
In order to test the potential role of the “PDF system” in the protection against NEC associated lung injury, we turned to a well established and clinically validated model of NEC in 7 day old neonatal mice. To induce NEC, we used a clinically relevant model that mimics the disease in humans, in which neonatal mice that were exposed to twice daily hypoxia were gavaged with infant formula for four days along with enteric bacteria from a patient that had suffered severe NEC (17). At the end of the four day model, mice develop patchy intestinal necrosis that resembles human NEC, and upregulate proinflammatory cytokines within the intestinal epithelium that are also seen in the human disease(18). In testing the role of PDF-containing formula on NEC-associated lung development, we studied mice at postnatal age 7–8, which is an age similar to premature human infants at approximately 28weeks gestation, when clinical NEC is seen (19). Neonatal mice of this age also express high levels of TLR4 in the intestine, just as in the human condition(20), rendering them highly susceptible to developing human NEC-like disease(12). The current experimental system therefore allows us to evaluate the role of pre-digested fats in infant formula in the prevention of NEC-induced lung injury, and to also shed light on key potential mechanisms involved.
Methods
Animal study approval
All mice experiments described in this study were carried out following the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and approved by Johns Hopkins University protocol, according to the ‘NC3R’S The ARRIVE Guidelines. C57BL/6J mice were purchased from the Jackson Laboratory and bred in the pathogen-free facility at Johns Hopkins University for multiple generations to stabilize intestinal microbiota. All mice were given ad libitum access to water, food, and housed in a temperature-controlled room (22°C) with 12 hours’ light and dark cycles. All mice used in the study were euthanized humanely using isoflurane anesthesia by inhalation (~3–4% isoflurane) followed by cervical dislocation.
Induction of NEC in neonatal mice
Experimental NEC was induced in 7–8 day old (~3g body weight) neonatal mouse pups as previously described(17; 18; 21; 22; 23). In brief, mouse pups of both sexes were separated from dams, and then randomnly allocated into control (Non-NEC) or NEC groups. NEC-group mice were gavage fed (40μL/g) five times/day (7 am to 7 pm) with formula containing either ‘standard fat’, or ‘predigested fat’(PDF), supplemented with bacterial stock that had been cultured from the stool of an infant with severe NEC (12.5μl stool slurry in 1ml formula). The formula (50μl per gram of mouse body weight) was administered using a 24-French angiocatheter placed into the mouse esophagus. Mice were also exposed to hypoxia (5% O2, 95% N2) for 10 minutes in a chamber (Billups-Rothenberg INC. Del Mar, CA), twice daily for 4 days. Where indicated, non-NEC control mice were reared on standard fat or PDF formulas for 4 days without NEC stool and no hypoxia. The breast-fed (control) animals remained with their mothers and received breast milk ad lib. Assignments of pups to each group were made based on the available pups from each litter, after reaching the required number to reach significance according to the power analysis (below).
Nutritional formulas
Nutritional formulas were manufactured by and obtained from Abbott Nutrition (Columbus, OH). Their detailed nutritional profiles and ingredients have been previously published(13). Briefly, the standard fat formula oil system was composed entirely of triglyceride oils, a mixture of 39% (by weight) high oleic safflower oil (HOSO), 29% (by weight) soya oil, 27.9% (by weight) coconut oil and 4.1% (by weight) oils associated with vitamins and proteins). The pre-digested fat-enriched formula is composed of a mixture of soybean free fatty acids (17.5%), monoglycerides (20%), and phospholipid lecithin (10.3%) along with triglyceride oils, HOSO (34.8%) and coconut oil (14.8%). In the manufacture of the PDF-enriched fat formula, soybean non-esterified free fatty acids (NEFA) were sourced from crude soy oil and then were physically distilled by combining oil and water hydrolysis at a high temperature. Formulas also contained monoglycerides and phospholipid lecithins, small molecular emulsifiers that are widely utilized in various nutritional products and are derived from fatty acids. Soybean NEFA was added into the formula in the calcium salt form, where the NEFA was first mixed with calcium hydroxide during manufacturing. Both standard and pre-digested fat-containing formulas were subjected to the same manufacturing conditions, including equal emulsification, homogenization, and final thermal treatment. All formulas are representative of commercial ready-to-feed shelf-stable human infant formulas.
NEC severity assessment
NEC severity was determined based upon a validated scoring system that was applied to de-identified, paraformaldehyde (PFA) fixed/paraffin embedded/H&E-stained intestinal sections from distal small intestine (ileum). Slide reviewers were blinded to the group allocation. Histological NEC severity score were assigned as described previously(24), 0 (no injury), 1 (minor- submucosal, lamina propria separation), 2 (moderate separation of submucosa, lamina propria, and edema in submucosal and muscular layers), and 3 (severe separation of submucosa, lamina propria, severe edema, and villous sloughing or loss of villi).
Immunohistochemistry (IHC) and Hematoxylin and Eosin (H&E) staining.
Immunofluorescent staining of lung tissues was performed on 4% paraformaldehyde-fixed 5μM thick paraffin sections. The sections were first warmed to 56°C in a vacuum incubator (Isotemp Vacuum Oven, Fisher Scientific) then washed immediately in xylene, gradually re-dehydrated in ethanol (100%, 95%, 70%, water), and then processed for antigen retrieval in citrate buffer (10mM pH6.0)/microwave (1000 watt, 6 minutes). Samples were then washed with PBS, blocked with 1% BSA/5% donkey-serum (1hour, room temperature), then incubated overnight at 4°C with primary antibodies (1:200 dilutions in 0.5% BSA), washed 3 times with PBS, incubated with appropriate fluorescent-labeled secondary antibodies (1:1000 dilution in 0.5% BSA, Life Technologies Inc) and the nuclear marker, 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Cat # D9542, Sigma, St. Louis, MO). The primary antibodies used were anti-3’-nitrotyrosine (3’-NT, Cat # ab61392, Abcam), anti-myeloperoxidase (MPO, Cat # RB373A, Thermo Scientific), anti-surfactant A (SP-A, Cat # ab49566, Abcam), anti-surfactant D (SP-D, Cat # ab168366, Abcam), anti-ZO-1 (Cat # 40–2200, ZYMED). In Situ Death Detection Kit, Fluorescein (TUNEL, Cat # 11684795910, Roche) were stained was per manufacture instructions. For MPO color development, ABC DAB staining kit (Vector labs, Cat# SK-4100) was used as per manufacturer’s instructions. All IHC and H&E stained slides were mounted using Gelvatol solution prior to imaging using a Nikon confocal microscope (Nikon, Inc). Images were quantified for fluorescent intensity using ImageJ software.
Quantitative Real-time Polymerase Reaction (qRT-PCR).
Total RNA was isolated from the snap-frozen, full thickness small intestine (ileum) using RNeasy® kit (Cat # 74106, Qiagen, Germantown, MD), and checked first for RNA purity and concentration on a SpectraMax® microplate reader (Molecular Devices, San Jose, CA). 0.5μg of total RNA was reverse transcribed for cDNA synthesis using the QuantiTect® Reverse Transcription kit (Cat # 205313, Qiagen, Germantown, MD). qRT-PCR was then performed on a Bio-Rad CFX96 Real-Time System (Bio-Rad Labs, Hercules, CA) using Sybr green mix (Bio-Rad Labs, Hercules, CA), forward and reverse primers (custom designed using NCBI Primer-BLAST online program and ordered from Integrated DNA Technologies, Coralville, Iowa) (Table 1). The mRNA expression relative to the housekeeping gene ribosomal protein large P0 (Rplp0) was calculated using the 2-ΔΔ CT method as described(18).
Table. 1.
Primers
| Gene | Forward sequence | Reverse sequence | Amplicon Size (BP) |
|---|---|---|---|
| Cldn1 | ATGCCAGGTATGAATTTGGCCAGG | ATAAGGCCGTGGTGTTGGGTAAGA | 131 |
| Elane | CAGAGGCGTGGAGGTCATTT | GAAGATCCGCTGCACAGAGA | 174 |
| Il6 | CCAATTTCCAATGCTCTCCT | ACCACAGTGAGGAATGTCCA | 182 |
| Lcn2 | ACAACCAGTTCGCCATGGTAT | AAGCGGGTGAAACGTTCCTT | 121 |
| Mpo | GACAGTGTCAGAGATGAAGCTACT | TTGATGCTTTCTCTCCGCTCC | 189 |
| Nox2 | GACACGCATGCCTTTGAGTG | TGCACAGCAAAGTGATTGGC | 143 |
| Puma | GCAGTACGAGCGGCGGAGAC | GGGCGGGTGTAGGCACCTAGT | 149 |
| Tnf-α | TTCCGAATTCACTGGAGCCTCGAA | TGCACCTCAGGGAAGAATCTGGAA | 144 |
| Rplp0 | GGCGACCTGGAAGTCCAACT | CCATCAGCACCACAGCCTTC | 143 |
| Zo-1 | AAAACGCTCTACAGGCTCCC | ATGTGCAGAAGGCTTGCTCT | 194 |
Nasal instillation of N-acetylcysteine (NAC)
Some NEC group mice on the standard fat formula were given 20μl of NAC (Cat # A9165, Sigma, 25mg/ml stock in saline) via direct nasal instillation, once daily for four days of the NEC model. NAC was intranasally delivered dropwise to the nares using a p20 pipette while the mouse was in a nose-up supine position as described previously(25).
Induction of LPS induced lung injury in neonatal mice
Age and body weight-matched C57BL/6 at postnatal day 7(p7) mice of both sexes were separated from the lactating dams, randomly divided into two groups, and housed in a 32°C pediatric incubator. Mice were then reared on formulas containing either “standard fat formula” or the “PDF-containing formula” (40μL mL/g), and were fed using a 24-French angiocatheter placed into the mouse esophagus five times per day for four days. On day 5, both standard fat and PDF-containing fat groups were further subdivided into two groups, i.e. “LPS” and “control” groups. The “LPS group” were given LPS via the intraperitoneal route (5mg/kg, i.p) or intranasal (20μg/mice in 20ul volume from 1mg/ml LPS stock). Mice in the “control group” received saline via the same route as the “LPS group”. All mice were sacrificed 6 hours later, and lungs were harvested for analysis.
Lung maturation and wet/dry mass studies
Age and body weight-matched C57BL/6 at postnatal 7(p7) mice of both sexes were separated from the lactating dams, randomly divided into two different groups, and housed in a 32°C pediatric incubator (Air Shields Isolette C-400, Hill-Rom Hatboro, PA). Mice were either orally gavaged with ‘standard fat formula’ or ‘PDF system’ 40μL mL/g, five times/day, using a 24-French angiocatheter placed into the mouse esophagus for four days. On day 5, mice were euthanized using CO2 euthanasia, and lungs were harvested for total RNA or fixed with 4% paraformaldehyde (PFA) for the histological studies. For wet/dry mass studies, the whole lungs were briefly dried on the absorbent paper, transferred to pre-weighed aluminum foil, measured for the wet lung weight, dried for 48h in 58°C incubator re-measured for the dried lung weight.
Statistical analysis.
All data were analyzed using Graph Pad Prism 9 (GraphPad Software). A power analysis was performed in order to calculate sample size, using an effect size of 2-fold for gene expression, NEC severity, expression of surfactant protein, zo-1, 3’-NT, and a difference of 20% for dry lung weight, and a difference of 10% for wet/dry lung weight between groups. The standard deviation for each of these parameters was based upon our previously published studies(17; 18; 21; 22; 23), and we accepted significance (type 1 error) of 5% (P=0.05), the probability of finding an effect of 80%, and an attrition rate based on prior studies of 10%. The corrected sample size (including attrition) was then determined according to Charan et al (26). Experiments were thus performed with at least 3 mice per group, as indicated in each figure where a dot represents an individual mouse, and within the figure legends.
Data were analyzed for statistical significance by ordinary one-way ANOVA followed by Tukey’s multiple comparison test. The pups of both sexes were randomized to the treatment group, and blinded analyses.
RESULTS
Administration of infant formula containing ‘predigested fat’ prevents lung injury in neonatal mice with necrotizing enterocolitis
To evaluate the effects of the fat component of infant formula on the development of NEC-induced lung injury, we subjected neonatal mice to our well-established experimental NEC model, that includes formula feeding, hypoxia and the administration of stool bacteria from an infant with severe NEC, and then altered the fat composition, from ‘standard fat’ to ‘predigested fat. As shown in Fig. 1(A–E), the induction of NEC in mice using formula containing “standard fat” resulted in inflammation in the small intestine that was characterized by disruption of the mucosa, loss of the intact villus architecture (Fig. 1(D)) and the expression of the pro-inflammatory cytokines Tnf-α (Fig. 1(K)) and Lcn-2 (Fig. 1(L)). Moreover, the inflammation that developed in the intestine was also associated with the development of inflammation in the corresponding lungs of these mice, as manifest by an influx of inflammatory cells, as well as a loss of airway architecture and vascular extravasation (Fig. 1(L)), and increased in pro-inflammatory cytokines, Tnf-α (Fig. 1(M)) and Lcn-2 (Fig. 1(N)). Importantly, mice that were fed formula that contained the ‘predigested sytem’ which was enriched in predigested tryiglycerides ( i.e. free fatty acids and monoglycerides) that are not dependent on the activity of endogenous lipases - did not get the NEC, as revealed by normal histology and reduced proinflammatory cytokine response both in the intestine (Fig. 1(E), (K) and (L)) and lungs (Fig. 1(E), (J) and (M–N)). In Non-NEC control studies, mice that were reared on either the ‘standard fat’ or the ‘PDF sytem’ alone did not deveop any inflammatory response or histological abnormatilies in either the intestine (Fig. 1(B–C) and (K–L)) or the lungs (Fig. 1(G–H) and (M–N)), excluding a toxic effect of the formula alone.
Fig 1. Administration of formula containing predigested fat prevents NEC-induced lung injury in neonatal mice.

(A-N) representative photomicrographs of Hematoxylin-Eosin (H&E) stained small showing histology and gene expression of pro-inflammatory cytokines, in non-NEC control and NEC mice. (A-E) histology of the small intestine (ileum). (F-J) histology of the lungs. (K-L) qRT-PCR expression of pro-inflammatory cytokines in the small intestine (ileum), (K) Tnf-α and (L) Lcn-2. (M-N) qRT-PCR expression of pro-inflammatory cytokines in the lungs, (M) Tnf-α and (N) Lcn-2. Each dot in scatter-dot plots represents data from an individual mouse, (n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 100μm.
Two additional endpoints were evaluated in order to determine the effects of either the ‘standard fat or ‘PDF system’ on the extent of lung injury. As shown in Fig. 2, neonatal mice that were induced to develop NEC with ‘standard fat’-containing infant formula developed extensive apoptosis within the lung, seen as brightly stained TUNEL positive lung cells in lung sections (Fig. 2(D)i–ii, (F)) when compared to the lung sections from Non-NEC control mice (Fig. 2(A–C)i, (A–C)ii, (F)). In contrast, mice fed with modified fat formula containing ‘predigested fat’ NEC showed little apoptosis (Fig. 2(E)i–ii, (F)). The immunohistochemical findings were corroborated by increased expression levels within the lungs of the pro-apoptosis gene PUMA (The p53 upregulated modulator of apoptosis), which were significantly higher in ‘standard fat’ NEC formula mice compared to breastfed control and NEC mice fed ‘predigested fat’ vs. ‘standard fed NEC (Fig. 2(G), p<0.001). In parallel, we measured the extent of polymorphonuclear neutrophil (PMN) infiltration into the lungs of mice induced to develop NEC using the above fat-containing formulas. As shown in Fig. 3, in mice administered standard fat containing formula, NEC induction resulted in marked accumulation of PMNs in the airways, as characterized as an intense immunostaining of the PMNs marker myeloperoxidase (MPO) (Fig. 3(D)i–ii, (F)). The immunostaining findings were confirmed by the presence of increased mRNA expression of neutrophil-specific enzyme ELANE (Elastase of neutrophils) (Fig. 3(G)). Importantly, the induction of NEC using formula containing the ‘predigested fat’ system resulted in minimal PMN accumulation in the lungs (Fig. 3(E)i–ii, F), and a corresponding reduction in the expression ELANE mRNA levels (Fig. 3G), which were both similar to Non-NEC control mice (Fig. 3(A–C)i–ii, (F–G)). Taken together, these findings reveal the beneficial effect of modifying the fat composition of infant formula as a strategy to prevent NEC-induced lung injury.
Fig 2. Administration of formula containing predigested fat prevents apoptosis of lung epithelial cells in necrotizing enterocolitis.

(A-E)i-ii representative immunofluorescence images of TUNEL staining (TUNEL green, DAPI nuclei blue), showing apoptosis (white arrows), in lungs of non-NEC control (A-C)i-ii and NEC mice (D-E)i-ii. (F) quantification of TUNEL positive cells, using ImageJ software (2 or more separate areas from each mouse lung section were imaged and quantified, total mice n≥4 mice/group). (G) qRT-PCR of Apoptosis gene Puma (P53 Up-Regulated Modulator Of Apoptosis), each dot in scatter-dot plot represents data from an individual mouse (n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 25μm.
Fig 3. Administration of formula containing predigested fat reduces polymorphonuclear neutrophil (PMNs) accumulation into the neonatal lung.

(A-E)i-ii representatative photomicrographs of Myeloperoxidase (MPO) stained images with DAB staining showing accumulation of PMNs (DAB stained brown cells, black arrows) in lungs of non-NEC controls (A-C)i-ii and NEC (D-E)i-ii mice. (F-G) qRT-PCR expression of of PMNs marker genes, (G) Mpo and (H) neutrophil expressed neutrophil (Elane) (each dot in scatter-dot plots represents data from an individual mouse, n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 20μm.
Administration of modified fat formula containing ‘predigested fat system’prevents loss of lung surfactant proteins and tight junctions in mice with NEC.
After establishing that the ‘PDF system’ containing formula is protective against NEC induced lung injury, we next sought to determine the effects on lung surfactant proteins secreted by the epithelial type II cells into the lung space, which are critical components of the protective barrier of the lung (27). As shown in Fig. 4, the induction of NEC with formula containing ‘standard fat’ resulted in a marked decrease in the expression by immunostaining within the lung of surfactant protein SP-A (Fig. 4(D) and (K)) and surfactant protein SP-D (Fig. 4(I) and (L)). Importantly, both SP-A and SP-D were restored to baseline levels in the lungs of mice that had been administered the ‘PDF system’ containing formula (Fig. 4(D), (I), (K), and (L)). Interestingly, both surfactant A and D were significantly higher in the Non-NEC control mice fed with the predigested fat system’ (Fig. 4(C), (H)) when compared to the ‘standard fat’ non-NEC control mice (Fig. 4(B), (G), (K–L), p<0.05). These findings demonstrate that administration of the ‘PDF system’ results in the development of lungs with significantly higher surfactant proteins as compared with control mice.
Fig 4. Administration of formula containing predigested fat prevents loss of lung surfactant proteins in the lungs in neonatal mice with NEC.

(A-J) representative confocal images of surfactant proteins in lungs of non-nec control (A-C, F-H) and NEC (D-E, I-J) mice. (A-E) immunostaiing of surfactant protein A (SP-A, green staining, white arrowheads). (F-J) immunostaining of surfactant protein D (SP-D, red staining, white arrowheads). (K-L) quantification of immunofluorescence intestity of SP-A (K) and SP-D (L) using ImageJ software (each dot in scatter-dot plots represents data from an individual area, 2 or more areas from each mouse lung section IHC were imaged and quantified, n≥4 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 20μm.
We next evaluated the effects of the PDF containing formula on the expression of tight junctions within the lungs of mice with NEC. As shown in Fig. 5, the administration of standard fat containing formula resulted in a marked decrease in the expression of the tight junction proteins ZO-1 by immunostaining (Fig. 5(D)i–ii and (F)) and qRT-PCR (Fig. 5(G), and these were restored in the presence of pre-digested fat (Fig. 5(E)i–i and (F–G)). It is again noteworthy that Zo-1 staining and mRNA expression were both significantly higher in non-NEC mice that were reared on the ‘PDF system’ compared to the ‘ standard fat’ (Fig. 5(B–C)i–ii, and (F), p<0.01), suggesting again that the alveolar epithelial cells are more differentiated with PDF nutrition. Taken together, these findings illustrate that PDF within formula can reduce lung injury and enhance lung differentiation. We next focused on the mechanisms involved, and examined the potential effects of ROS-mediated damage to the newborn lung.
Fig 5. Administration of formula containing predigested fat prevents the loss of tight junctions in the neonatal lungs of mice with NEC.

(A-E)i-ii representataive confocal images of tight junction protein Zona-Occludin (ZO-1, red staining, white arrowheads) in lungs of non-nec control (A-C)i-ii and NEC (D-E)i-ii mice. (F) quantification of Zo-1 immunofluorescence intestity measured using ImageJ software (each dot represents a diffenent area under focus, 1–2 areas/section/mice, n≥7 mice/group). (G) qRT-PCR expression ZO-1 (each dot represents data from an individual mouse, n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 25μm.
Administration of modified fat formula containing ‘predigested fat’ reduces oxidative stress in the lungs of mice induced to develop NEC.
Neonatal lung disease is thought to develop in response to the development of ROS, which causes significant cellular injury, leading to pneumocyte death and alveolar injury Lung injury in the setting of other inflammatory processes involves the accumulation of ROS (28). We therefore next investigated whether NEC-induced lung injury was associated with the accumulation ROS, and whether these were reduced by the administration of formula containing pre-digested fat. As shown in Fig 6, the expression levels of 3’-nitrotyrosine (3’-NT), which is a marker of cell damage and a product of the oxidation of proteins by superoxide (O2-) and peroxynitrite (ONOO-), were elevated in the lungs of mice who were fed ‘standard-fat’ formula (Fig. 6(C)i–ii and F). Importantly, the levels of 3’-NT were significantly reduced in the presence of ‘PDF system’ enriched formula (Fig. 6(E)i–ii, (F), p<0.001), suggesting a protective, anti-oxidant effect of the PDF diet. Additionally, the transcripts levels of superoxide-generating enzyme NADPH oxidase 2 (NOX2) also known as cytochrome b (558) subunit beta or Cytochrome b-245 heavy chain (29) that produce ROS, is significantly increased in lungs of ‘standard formula fed NEC mice and was reduced in the presence of ‘PDF enriched formula fed NEC mice vs. ‘standard formula fed’ NEC (Fig. 6(G), p<0.01). No significant changes in 3’-NT staining or NOX2 expession were identified among non-NEC control mice (Fig. 6(A–C)i–ii, (F) and)G)). Based upon these findings, we next sought to explore whether a reduction in ROS could reduce lung injury, in order to gain greater insights into the protective mechanisms of PDF diet on NEC-induced lung injury.
Fig 6. Administration of formula containing predigested fat prevents prevents NEC-induced nitrosylation in the lung.

(A-E)i-ii representative confocal images of 3’-nitrotyrosine (3’-NT, green staining, white arrows) in lungs of non-nec control (A-C)i-ii and NEC (D-E)i-ii mice. (F) quantification of 3’-NT immunofluorescence intestity measured using ImageJ software (each dot represents a diffenent area under focus, 1–2 areas/section/mice, n≥4 mice/group). (G) qRT-PCR of superoxide radical i.e., ROS generation enzyme NADPH oxidase 2 (Nox2) (each dot represents data from an individual mouse, n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software. Scale bars: 25um.
Administration of the reactive oxygen species (ROS) scavenger N-acetylcysteine (NAC) preserves the morphology of lung epithelial cells and reduces NEC-induced lung injury
We next sought to evaluate whether inhibition of ROS directly could achieve lung protection in the setting of NEC. To do so, we treated the neonatal mice induced to develop NEC using the ‘standard fat’ formula with the redox scavenger N-acetylcysteine (NAC) via direct nasal instillation. NAC treatment to the lungs did not protect against NEC development, as evident from NEC histology (Fig. 7(A)i–ii) and pro-inflammatory cytokine Tnf-α expression (Fig. 7(A)iii). However, the lungs of NAC treated NEC mice were protected against NEC-induced lung injury, as revealed by a lack of inflammation on lung histology (Fig. 7(B)i–ii), reduced expression of pro-inflammatory cytokine Tnf-a (Fig. 7(B)iii), reduced PMN influx (Fig. 7(C)i–ii) and expression of neutrophil elastase (Fig. 7(C)iii), reduced apoptosis (Fig. 7(D)i–iii), reduced 3’-NT (Fig. 7(E)i–iii) and restored levels of SP-A(Fig. 7(F)i–iii), SP-D (Fig 7(G)i–iii), and ZO-1 (Fig. 7(Hi)–iii). Taken together, these results indicate that NEC-induced lung injury can be prevented by ROS inhibition, and provide insights into the mechanisms by which PDF reduce NEC-induced lung injury.
Fig 7. Intranasal administration of the reactive oxygen species (ROS) scavenger N-acetylcysteine (NAC) prevents NEC and NEC-induced lung injury.

(A-B)i-iii, assessment of NEC histology as shown by representative photomicrographs of H&E stainied histological sections of small intestine (ileum) (Ai-ii), lung (Bi-ii), and qRT-PCR expression of pro-inflammatory cytokine Tnf-a in the small intestine (Aiii) and lung (Biii) in NEC mice either given intranasl saline (NEC) or NAC (NEC+NAC). (Ci-iii) assesement of PMNs infilteration lungs as shown by representative images of myeloperoxidase (MPO) staining (DAB stained brown cells) (Ci-ii) and qRT-PCR expression of neutrophils marker ELANE (Ciii). (Di-Dii) assessments of apoptosis as shown by representative confocal images of TUNEL staining (Di-ii) and TUNEL quatificaion (Diii). (Ei-iii) assesement of oxidative injury as shown by representative confocal images of 3’-NT staining (Ei-ii) and quantification using image J software (Eiii). (F-G)i-ii assesment of surfactant protein levels as shown by representative confocal images of surfactant proteins SP-A (Fi-ii) and SP-D (Gi-ii) along with immunofluorescence intestity quantification of SP-A (Fiii) and SP-D (Giii) using image J software. (Hi-iii) assesement of tight junction proteins as measured by representative confocal images Zona-Occludin (ZO-1) staining (Hi-ii) and qRT-PCR expression of Zo-1 (Hiii). Each bar on the bar graphs represents data from 6–8 mice±SEM. Statistical significance was determined by students;s t-test using GraphPad prism 9 software. Scale bars: Ai-Bi 100μm Ci-Hii, 25μm.
Administration of modified fat formula containing ‘predigested fat’ protects against LPS-induced lung injury
We next studied if the mice reared on the PDF system are resistant to LPS induced lung injury. To do so, we exposed the lungs to LPS via either the systemic route, i.e., intraperitoneal administration of LPS or by direct exposure using intranasal inhalation. The administration of LPS resulted in a significant induction in pro-inflammatory cytokines Il-6 and Lcn-2, and neutrophil elastase in mice that were reared on ‘standard fat’ formula when LPS was administered either systemically (Fig. 8(A–C)) or via direct intranasal inhalation (Fig. 8(D–F), while the mice reared on the ‘PDF system’ were significantly protected (Fig. 8(A–F)) from LPS-induced inflammation. These findings further support the notion that that mice’s lungs reared on the ‘PDF system’ are more resilient to injury and inflammation.
Fig 8. Administration of formula containing predigested fat prevents protects against LPS-induced lung injury.

Dot plot charts of qRT-PCR expressions of Pro-inflammtory cytokines Il-6 (A, D), Lcn2 (B, E), and neutrophils enzyme ELANE (C-F), in the lungs of mice reared on the ‘standard fat’ (std fat) and the ‘predigested fat system’(PDF), and treated with LPS via interaperitoneal route (A-C) and intranasal route (D-F). Each dot in scatter-dot plots represents data from an individual mouse (n≥5 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software.
Administration of ‘standard fat’ containing formula induces mild lung edema versus’predigested fat system’
In the final series of studies, we assessed the wet to dry lung ratio, an indicator of lung edema. To do so, we first measured the total body weight, following four days of formula feedings, and found no statistical difference between the ‘standard fat’ and the ′‘PDF system’ groups (Fig. 9(A)). Similarly, the absolute measurements of the wet lungs were not different between the ‘standard fat’ and the ‘PDF system’ groups (Fig. 9(B)). However, the dry lung weight was significantly increased in mice reared on the ‘PDF system (Fig. 9(C), P<0.05), which corresponded with a significantly reduced wet to dry lung weight ratio in mice reared on the ‘PDF system’ as compared with mice reared on the ‘standard fat formula (Fig. 9(D), P<0.01),. These data strongly suggest that even at baseline, in the absence of NEC induction, mice that were reared on the ‘PDF system’ had significantly reduced predisposition to the development of edema as compared with mice fed a standard formula. Taken in aggregate, these findings reveal that the administration of a formula that is enriched in PDF offers lung protective properties.
Fig 9. The effects of formula administration on wet/dry lung weights in neonatal mice.

Dot plot charts of total body weight (A), wet lung weight (B), dry lung weight (C), and wet/dry lung weight ratio (D), in mice reared on the ‘standard fat or the ‘predigested fat system’ over a period of 4 days from postnatal 7 to p11. Each dot in scatter-dot plots represents data from an individual mouse (n≥7 mice/group). Statistical significance was determined by one-way ANOVA, followed by Tukey’s multiple comparisons tests using GraphPad prism 9 software.
DISCUSSION
Prematurity is defined as a birth that occurs before 37 completed weeks of gestation(30). Approximately 10% of births in the USA are premature, resulting in approximately 500,000 premature infants born in the USA each year(31). Globally, there are over 15 million babies born prematurely every year, 60% of whom are born in Africa and South Asia, with over 3.5 million premature babies born in India and 1.1 million premature babies born in China (32). The survival rate of a premature infant is largely determined by the degree of prematurity, such that infants born before 22 weeks gestation have a mortality rate of over 90%, while the survival increases to over 90% for infants born at 27 weeks gestational age(33). The incidence of long term complications of prematurity include retinopathy of prematurity, bronchopulmonary dysplasia, necrotizing enterocolitis, intraventricular hemorrhage, and periventricular leukomalacia resulting in long-term health problems that include vision impairment, lung dysfunction, intestinal disability and neurological dysfunction(34; 35). The degree of morbidity of each of these complications of prematurity is particularly severe when NEC co-exists, especially in the case of lung dysfunction (36).
The current study focuses on strategies to prevent the development of NEC-induced lung injury, which remains a major cause of morbidity and mortality in patients with NEC, and for which there are few effective treatment strategies (37). Prior investigators have shown that the development of lung injury in NEC involves a coordinated proinflammatory response within the lung parenchyma that results in impaired healing within the pulmonary epithelium (38). We have previously shown that NEC-induced lung injury results in part from activation of the bacterial receptor toll-like receptor 4 (TLR4) on the pulmonary epithelium which results in an influx of inflammatory neutrophils and a destruction of the alveolar membrane (14). In a follow up study, we found that the adoptive transfer of CD4 T cells from lungs of mice with NEC could induce lung injury in immune incompetent mice, indicating the importance of T cells in the pathogenesis of NEC-induced lung injury (23). We further showed that TLR4 signaling on the surfactant associated protein C-1 (Sftpc1) positive pulmonary epithelial cells resulted in the induction of pro-inflammatory Th17 lymphocytes into the lung, and that aerosolized inhibition of either TLR4 or the Th17 recruiting chemokine CCL25 significantly protected the lungs in the setting of NEC (23). Taken in aggregate, these findings illustrate that strategies that can directly inhibit either the pro-inflammatory response in the lung, or the ability of pro-inflammatory cells to reach the lung, can reduce the development of NEC-induced lung injury. The current studies extend those prior findings by now revealing that by modifying the fat components of the infant diet, we can also directly reduce the extent of NEC-induced lung injury. These findings therefore have potential translational significance, by providing the possibility of lung protection in infants at risk for lung injury in the setting of NEC through the use of dietary modifications alone.
Standard of care for NEC-induced lung injury involves supporting the infant’s requirements for gas exchange (i.e. delivering oxygen to the tissues and removing carbon dioxide) including the use of advanced ventilatory strategies(39), the selective administration of medical therapies including corticosteroids(40), nitric oxide and vitamin A(41; 42), and minimization of ventilator-induced lung damage (43). These fundamental therapeutic principles are similar to those applied in the management of bronchopulmonary dysplasia which is a major pulmonary condition that affects premature infants, except that NEC-induced lung injury is more severe and takes longer to treat than other forms of neonatal lung disease(44). There is no specific treatment for NEC-induced lung injury, and so the current approach of instituting a diet that can reduce lung injury in the setting of NEC offers the potential for new avenues for care.
We now offer additional insights into the mechanisms by which a diet reach in pre-digested fats can protect the lung. Specifically, we reveal that mice fed a diet rich in predigested triglycerides (free fatty acids and monoglycerides) displayed greater overall lung differentiation, as revealed by increased surfactant protein A and D expression, increased tight junction zo-1 expression, and reduced lung-weight ratio at baseline. It stands to reason that a more differentiated lung would be less prone to inflammatory-mediated injury than a relatively undifferentiated lung, thus perhaps explaining why effects on lung differentiation may be positively associated with reduced injury. Moreover, the finding that the administration of a diet rich in predigested trigylcerides is protective against injury in the setting of increased surfactant expression in the lung is consistent with clinical strategies in which surfactant administration effectively treats lung injury in premature infants (45). While the precise mechanisms by which dietary factors could modulate lung development in the newborn remain unclear, prior studies in other models support this conclusion. For instance, a diet rich in eicosapentaenoic acid and gamma-linolenic acid has been shown to be beneficial in patients with acute lung injury (46), although more recent pooled meta analyses have questioned the efficacy of this approach (47). The potential beneficial effects of dietary modulation for the prevention of lung injury have been evaluated in mothers who have been administered decosahexaenoic acide (DHA) supplementation (48), and in infants who have been administered omega-3 long chain pulunsaturated fatty acids, especially docosahexaenoic acid by meta-analysis (49), and have failed to show a significant benefit to mothers significantly. These findings suggest that additional strategies to protect the lung are warranted, in particular those that focus on enhancing lung development, as in the current approach.
One of the important features of the current studies relates to the mouse model used, and its potential relevance to the population of premature infants in which NEC-induced lung injury develops. The neonatal mouse model of NEC has been clinically validated by many laboratories, and replicates many of the clinical and physiological features of the intestinal manifestations of the disease(50). In particular, the model induces the development of patchy intestinal necrosis and the expression of pro-inflammatory cytokines that are seen in the human disease (51). The model begins in mice on day 7, as this time point is reflective of the physiological and anatomic characteristics of premature infants, with respect to the elevated expression of TLR4, a relative lack of Paneth cells, an enrichment of proinflammatory lymphocytes in the intestinal mucosa and a relative paucity of goblet cells (19; 52; 53). Moreover, the model also replicates the key features of human NEC-induced lung disease, including alveolar injury, leukocyte infiltration and epithelial damage (14; 23). That said, the mouse model of NEC also has several limitations. First, it is virtually impossible to recreate the unique environment of the neonatal intensive care unit, the natural site at which premature infants receive care and also develop NEC, in the animal facility. Environmental microbes and other stressors may have important roles in NEC pathogenesis that are simply not accounted for in animals. To this end, Peng et al have provided evidence linking environmental stressors in the NICU to biobehavioral responses in preterm infants (54). Further, differences between the intestinal microbiota of mouse and humans could have unanticipated physiological relevance to the presence of inflammation in both the gut and the lung in the current model(26), despite our attempts to reduce this varible through the administration of human intestinal microbiota in the current model. Finally, as with all mouse models, there are limitations regarding body size, weight, litter size and additional genomic differences that together can limit the applicability of the current model. Other models of premature lung development have been developed in piglets(55), rabbits(56), babboons(57), and lambs (58), and each offers relative advantages and disadvantages in balancing cost, translatability and ease of model development, and each could potentially be adapted to the study of NEC-induced lung injury. Taken in aggregate, the current mouse NEC model has been widely adopted by many laboratories around the world, and is now a standard research tool for the study of this complex disease.
One of the possible interpretations of the current studies is that because protection against NEC-induced lung injury is a natural benefit of preventing NEC, perhaps the best way to protect the lungs is to prevent NEC development in the first place. While the current data do not refute this conclusion outright, we submit that such a conclusion provides an incomplete assessment of the current findings. Indeed, there are many patients who develop and then recover from NEC, only to go on to develop significant morbidity from lung injury; in these patients, the presence of persistent lung injury can be the major limiting factor in their ultimate recovery, and a significant number of patients who survive NEC have limited exercise tolerance (59), as well as ongoing lung disease (60). These observations suggest that the lungs of premature infants, which are particularly susceptible to the development of bronchopulmonary dysplasia, are at additional risk of lung injury in the setting of NEC, which can persist long after NEC is resolved. These findings support a strategy of dietary modification in order to procted the lungs, in a way that may confer additional benefits to that obtained through simple NEC prevention alone.
Further studies are required to understand how the predigested fat is metabolized during the neonatal period, and what metabolic pathways if any are altered in the presence of fatty acid administration, and how the gut-lung axis could impact neonatal development in general. It should be noted that the oil composition was enriched in soybean oil. This oil was chosen as it is widely used in infant formula along with other plant oils such as coconut and high oleic safflower oils. Moreover, the fatty acid profile of soybean oil is favorable in designing infant formula so as to mimic human milk’s fatty acid profile, as it contains fatty acids such as palmitic, oleic, linoleic and alpha linolenic acids(61; 62), and was thus selected in order to maintain these important fatty acids within the formula at physiologically relevant levels. Additional studies could be performed in order to address whether other predigested oils could be more or less beneficial in preventing NEC-associated lung injury.
All aspects of the study design have been designed to maximize the translatability of the results to humans. The underlying pathophysiology between the mouse model and the human disease are similar, and the biomarkers that are used to measure disease severity are also similar between humans and mice. That said, differences between mouse pathophysiology and human heterogeneity will impact the degree of translatability. We therefore assessed the degree of translatability according to the criteria of Wendler et al (63). Based upon the strong in vitro and in vivo evidence for the role of exaggerated immunity in the pathogenesis of NEC, the validity of the current animal disease model, past data from both mouse and piglets in NEC reduction, as well as the effect on biomarkers (IL-6) that we used to predict disease severity after the administration of the predigested fat containing diet, the estimated degree of translatability of the current studies is estimated to be high (63).
In summary, we have shown that a formula containing pre-digested fat can protect the lungs in the setting of NEC, through a mechanism that involves a reduction in inflammation and an increase in lung differentiation. These findings indicate that nutritional therapies may have previously unrecognized roles in the prevention of NEC, and the mitigation of its long-term complications, including the development of NEC-associated lung injury.
Acknowledgement:
The authors acknowledge Mr. Raheel Ahmad for his help with the NEC models.
Disclosure:
This work was supported in part by a sponsored research grant from Abbott Nutrition to DJH. No author has any financial relationship or conflict of interest with the current work.
Financial support:
D. J. H. is supported by grants (RO1 DK117186, RO1DK121824, and R35GM141956) from the National Institutes of Health and this research was funded in part by a Sponsored Research Grant from Abbott Nutrition. There was no role by Abbott Nutrition in the design of the study, collation and analysis of data or decision to publish.
Abbreviations:
- Elane
Elastase neutrophil expressed
- NAC
N-acetylcysteine
- NEC
necrotizing enterocolitis
- 3’-NT
3’-Nitrotyrosine
- Nox-2
NADPH oxidase 2
- PFA
paraformaldehyde
- Std fat
standard fat
- Lcn-2
Lipocalin-2
- Il-6
Interleukin-6
- Mpo
myeloperoxidase
pre-digested fat
- Puma
p53 upregulated modulator of apoptosis
- PMNs
polymorphonuclear neutrophils
- ROS
reactive oxygen species
- SP-A
Surfanctant protein-A
- SP-D
Surfactant protein-D
- TUNEL
Terminal deoxynucleotidyl transferase dUTP nick end labeling
- Tnf-α
Tumor necrosis factor-alpha
- Zo-1
Zona occludin-1
Footnotes
Conflicts of Interest: None of the authors has any conflicts of interest to declare.
The amount of all nutrients used in animal studies could reasonably be expected to be achieved in the human population as they are derived from ready to feed infant formulas.
There are no in vitro studies, so the statement as requested by the British Journal of Nutrition that the “molecular form of the nutrient or nutrients used in in vitro studies is the same as that which the cell type in which the test was performed would encounter in vivo” does not apply.
This work does not involve any probiotics.
References
- 1.Alganabi M, Lee C, Bindi E et al. (2019) Recent advances in understanding necrotizing enterocolitis. F1000Res 8, 1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Seeman SM, Mehal JM, Haberling DL et al. (2016) Infant and maternal risk factors related to necrotising enterocolitis-associated infant death in the United States. Acta Paediatrica, International Journal of Paediatrics 105, e240–e246. [DOI] [PubMed] [Google Scholar]
- 3.Alsaied A, Islam N, Thalib L (2020) Global incidence of Necrotizing Enterocolitis: a systematic review and Meta-analysis. BMC Pediatrics 20, 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Patel RM, Denning PW (2015) Intestinal microbiota and its relationship with necrotizing enterocolitis. Pediatr Res 78, 232–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Laughon M, O’Shea MT, Allred EN et al. (2009) Chronic lung disease and developmental delay at 2 years of age in children born before 28 weeks’ gestation. Pediatrics 124, 637–648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ganapathy V, Hay JW, Kim JH et al. (2013) Long term healthcare costs of infants who survived neonatal necrotizing enterocolitis: a retrospective longitudinal study among infants enrolled in Texas Medicaid. BMC Pediatr 13, 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hackam D (2021) Necrotizing Enterocolitis | Taylor & Francis Group. 1 ed. vol. 1: CRC Press. [Google Scholar]
- 8.Neu J (2020) Necrotizing Enterocolitis: A Multi-omic Approach and the Role of the Microbiome. In Digestive Diseases and Sciences, vol. 65, pp. 789–796: Springer US. [DOI] [PubMed] [Google Scholar]
- 9.Eaton S, Rees CM, Hall NJ (2017) Current Research on the Epidemiology, Pathogenesis, and Management of Necrotizing Enterocolitis. Neonatology 111, 423–430. [DOI] [PubMed] [Google Scholar]
- 10.Nino DF, Sodhi CP, Hackam DJ (2016) Necrotizing enterocolitis: new insights into pathogenesis and mechanisms. Nat Rev Gastroenterol Hepatol 13, 590–600. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hackam DJ, Sodhi CP, Good M (2019) New insights into necrotizing enterocolitis: From laboratory observation to personalized prevention and treatment. J Pediatr Surg 54, 398–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kovler ML, Sodhi CP, Hackam DJ (2020) Precision-based modeling approaches for necrotizing enterocolitis. [DOI] [PMC free article] [PubMed]
- 13.Sodhi CP, Fulton WB, Good M et al. (2018) Fat composition in infant formula contributes to the severity of necrotising enterocolitis. Br J Nutr 120, 665–680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jia H, Sodhi CP, Yamaguchi Y et al. (2016) Pulmonary Epithelial TLR4 Activation Leads to Lung Injury in Neonatal Necrotizing Enterocolitis. J Immunol 197, 859–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Bæk O, Cilieborg MS, Nguyen DN et al. (2021) Sex-Specific Survival, Growth, Immunity and Organ Development in Preterm Pigs as Models for Immature Newborns. Frontiers in Pediatrics 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Drucker NA, Jensen AR, te Winkel JP et al. (2018) Loss of endothelial nitric oxide synthase exacerbates intestinal and lung injury in experimental necrotizing enterocolitis. In Journal of Pediatric Surgery, vol. 53, pp. 1208–1214: Elsevier Inc. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lu P, Yamaguchi Y, Fulton WB et al. (2021) Maternal aryl hydrocarbon receptor activation protects newborns against necrotizing enterocolitis. Nat Commun 12, 1042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhou Q, Nino DF, Yamaguchi Y et al. (2021) Necrotizing enterocolitis induces T lymphocyte-mediated injury in the developing mammalian brain. Sci Transl Med 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Stanford AH, Gong H, Noonan M et al. (2019) A direct comparison of mouse and human intestinal development using epithelial gene expression patterns. In Pediatric Research, pp. 1: Nature Publishing Group. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Gribar SC, Sodhi CP, Richardson WM et al. (2009) Reciprocal expression and signaling of TLR4 and TLR9 in the pathogenesis and treatment of necrotizing enterocolitis. J Immunol 182, 636–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sodhi CP, Wipf P, Yamaguchi Y et al. (2021) The human milk oligosaccharides 2’-fucosyllactose and 6’-sialyllactose protect against the development of necrotizing enterocolitis by inhibiting toll-like receptor 4 signaling. Pediatr Res 89, 91–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Werts AD, Fulton WB, Ladd MR et al. (2020) A Novel Role for Necroptosis in the Pathogenesis of Necrotizing Enterocolitis. Cellular and Molecular Gastroenterology and Hepatology 9, 403–-423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Jia H, Sodhi CP, Yamaguchi Y et al. (2019) Toll Like Receptor 4 Mediated Lymphocyte Imbalance Induces Nec-Induced Lung Injury. Shock 52, 215–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Werts AD, Fulton WB, Ladd MR et al. (2020) A Novel Role for Necroptosis in the Pathogenesis of Necrotizing Enterocolitis. Cell Mol Gastroenterol Hepatol 9, 403–423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Southam DS, Dolovich M, O’Byrne PM et al. (2002) Distribution of intranasal instillations in mice: effects of volume, time, body position, and anesthesia. Am J Physiol Lung Cell Mol Physiol 282, L833–839. [DOI] [PubMed] [Google Scholar]
- 26.Donovan C, Liu G, Shen S et al. (2020) The role of the microbiome and the NLRP3 inflammasome in the gut and lung. Journal of Leukocyte Biology 108, 925–935. [DOI] [PubMed] [Google Scholar]
- 27.King SD, Chen SY (2020) Recent progress on surfactant protein A: cellular function in lung and kidney disease development. Am J Physiol Cell Physiol 319, C316–C320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Marseglia L, D’Angelo G, Granese R et al. (2019) Role of oxidative stress in neonatal respiratory distress syndrome. Free Radic Biol Med 142, 132–137. [DOI] [PubMed] [Google Scholar]
- 29.Diebold BA, Smith SM, Li Y et al. (2015) NOX2 As a Target for Drug Development: Indications, Possible Complications, and Progress. Antioxid Redox Signal 23, 375–405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Shapiro-Mendoza CK, Barfield WD, Henderson Z et al. (2016) CDC Grand Rounds: Public Health Strategies to Prevent Preterm Birth. MMWR Morb Mortal Wkly Rep 65, 826–830. [DOI] [PubMed] [Google Scholar]
- 31.Blencowe H, Cousens S, Oestergaard MZ et al. (2012) National, regional, and worldwide estimates of preterm birth rates in the year 2010 with time trends since 1990 for selected countries: a systematic analysis and implications. Lancet 379, 2162–2172. [DOI] [PubMed] [Google Scholar]
- 32.WHO (2018) Preterm birth. Home/Newsroom/Fact sheets/Detail/Preterm birth. https://www.who.int/news-room/fact-sheets/detail/preterm-birth2021) [Google Scholar]
- 33.Myrhaug HT, Brurberg KG, Hov L et al. (2019) Survival and Impairment of Extremely Premature Infants: A Meta-analysis. Pediatrics 143. [DOI] [PubMed] [Google Scholar]
- 34.Stoll BJ, Hansen NI, Bell EF et al. (2010) Neonatal outcomes of extremely preterm infants from the NICHD Neonatal Research Network. Pediatrics 126, 443–456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kelly MM, Tobias J (2021) Recommendations to optimize life-long health and wellbeing for people born preterm. Early Hum Dev, 105458. [DOI] [PubMed] [Google Scholar]
- 36.Hintz SR, Kendrick DE, Stoll BJ et al. (2005) Neurodevelopmental and growth outcomes of extremely low birth weight infants after necrotizing enterocolitis. Pediatrics 115, 696–703. [DOI] [PubMed] [Google Scholar]
- 37.Howlett A, Ohlsson A, Plakkal N (2019) Inositol in preterm infants at risk for or having respiratory distress syndrome. Cochrane Database Syst Rev 7, CD000366. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wang FS, Yu ML, Li WZ et al. (2020) Intestinal tract and parenteral multi-organ sequential pathological injury caused by necrotizing enterocolitis. BMC Pediatr 20, 418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Gibbs K, Jensen EA, Alexiou S et al. (2020) Ventilation Strategies in Severe Bronchopulmonary Dysplasia. NeoReviews 21, e226–e237. [DOI] [PubMed] [Google Scholar]
- 40.Cuna A, Lewis T, Dai H et al. (2018) Timing of postnatal corticosteroid treatment for bronchopulmonary dysplasia and its effect on outcomes. Pediatric Pulmonology. [DOI] [PubMed] [Google Scholar]
- 41.Pasha AB, Chen X-Q, Zhou GP (2018) Bronchopulmonary dysplasia: Pathogenesis and treatment (Review). Experimental and Therapeutic Medicine. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kalikkot Thekkeveedu R, Guaman MC, Shivanna B (2017) Bronchopulmonary dysplasia: A review of pathogenesis and pathophysiology. Respiratory Medicine 132, 170–177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hennelly M, Greenberg RG, Aleem S (2021) An Update on the Prevention and Management of Bronchopulmonary Dysplasia. Pediatric Health, Medicine and Therapeutics Volume 12, 405–419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Willis KA, Ambalavanan N (2021) Necrotizing enterocolitis and the gut-lung axis. Seminars in Perinatology, 151454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Venkataraman R, Kamaluddeen M, Hasan SU et al. (2017) Intratracheal Administration of Budesonide-Surfactant in Prevention of Bronchopulmonary Dysplasia in Very Low Birth Weight Infants: A Systematic Review and Meta-Analysis. Pediatric Pulmonology 52, 968–975. [DOI] [PubMed] [Google Scholar]
- 46.Singer P, Theilla M, Fisher H et al. (2006) Benefit of an enteral diet enriched with eicosapentaenoic acid and gamma-linolenic acid in ventilated patients with acute lung injury. Crit Care Med 34, 1033–1038. [DOI] [PubMed] [Google Scholar]
- 47.Li C, Bo L, Liu W et al. (2015) Enteral Immunomodulatory Diet (Omega-3 Fatty Acid, gamma-Linolenic Acid and Antioxidant Supplementation) for Acute Lung Injury and Acute Respiratory Distress Syndrome: An Updated Systematic Review and Meta-Analysis. Nutrients 7, 5572–5585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Marc I, Piedboeuf B, Lacaze-Masmonteil T et al. (2020) Effect of Maternal Docosahexaenoic Acid Supplementation on Bronchopulmonary Dysplasia-Free Survival in Breastfed Preterm Infants: A Randomized Clinical Trial. JAMA 324, 157–167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wang Q, Zhou B, Cui Q et al. (2019) Omega-3 Long-chain Polyunsaturated Fatty Acids for Bronchopulmonary Dysplasia: A Meta-analysis. Pediatrics 144. [DOI] [PubMed] [Google Scholar]
- 50.Kovler AML, Salazar AJG, Fulton WB et al. (2012) Title : Toll-like receptor 4 mediated enteric glia loss is critical for the development of necrotizing enterocolitis, vol. 4, pp. 1–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Sampah MES, Hackam DJ (2021) Prenatal Immunity and Influences on Necrotizing Enterocolitis and Associated Neonatal Disorders. Front Immunol 12, 650709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Lu P, Sodhi CP, Jia H et al. (2014) Animal models of gastrointestinal and liver diseases. Animal models of necrotizing enterocolitis: pathophysiology, translational relevance, and challenges. In Am J Physiol Gastrointest Liver Physiol, 2014/April/26 ed., vol. 306, pp. G917–928. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Cho SX, Rudloff I, Lao JC et al. (2020) Characterization of the pathoimmunology of necrotizing enterocolitis reveals novel therapeutic opportunities. In Nature Communications, vol. 11, pp. 1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Peng N-H, Bachman J, Jenkins R et al. (2009) Relationships Between Environmental Stressors and Stress Biobehavioral Responses of Preterm Infants in NICU. The Journal of Perinatal & Neonatal Nursing 23, 363–371. [DOI] [PubMed] [Google Scholar]
- 55.Chandra S, Davis JM, Drexler S et al. (2003) Safety and Efficacy of Intratracheal Recombinant Human Clara Cell Protein in a Newborn Piglet Model of Acute Lung Injury. Pediatric Research 54, 509–515. [DOI] [PubMed] [Google Scholar]
- 56.Salaets T, Aertgeerts M, Gie A et al. (2020) Preterm birth impairs postnatal lung development in the neonatal rabbit model. Respiratory Research 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Albertine KH (2013) Progress in understanding the pathogenesis of BPD using the baboon and sheep models. Seminars in Perinatology 37, 60–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Kramer BW, Ikegami M, Moss TJM et al. (2005) Endotoxin-induced Chorioamnionitis Modulates Innate Immunity of Monocytes in Preterm Sheep. American Journal of Respiratory and Critical Care Medicine 171, 73–77. [DOI] [PubMed] [Google Scholar]
- 59.Kurscheid T, Holschneider AM (1993) Necrotizing enterocolitis (NEC)--mortality and long-term results. Eur J Pediatr Surg 3, 139–143. [DOI] [PubMed] [Google Scholar]
- 60.Bazacliu C, Neu J (2019) Necrotizing Enterocolitis: Long Term Complications. Curr Pediatr Rev 15, 115–124. [DOI] [PubMed] [Google Scholar]
- 61.Teichert SA, Akoh CC (2011) Modifications of Stearidonic Acid Soybean Oil by Enzymatic Acidolysis for the Production of Human Milk Fat Analogues. Journal of Agricultural and Food Chemistry 59, 13300–13310. [DOI] [PubMed] [Google Scholar]
- 62.Dai Y-J, Sun L-L, Li M-Y et al. (2016) Comparison of Formulas Based on Lipid Emulsions of Olive Oil, Soybean Oil, or Several Oils for Parenteral Nutrition: A Systematic Review and Meta-Analysis. Advances in Nutrition 7, 279–286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Wendler A, Wehling M (2010) The translatability of animal models for clinical development: biomarkers and disease models. Current Opinion in Pharmacology 10, 601–606. [DOI] [PubMed] [Google Scholar]
