Skip to main content
PLOS One logoLink to PLOS One
. 2022 Mar 24;17(3):e0259610. doi: 10.1371/journal.pone.0259610

Profiling RT-LAMP tolerance of sequence variation for SARS-CoV-2 RNA detection

Esta Tamanaha 1, Yinhua Zhang 1, Nathan A Tanner 1,*
Editor: Grzegorz Woźniakowski2
PMCID: PMC8947081  PMID: 35324900

Abstract

The ongoing SARS-CoV-2 pandemic has necessitated a dramatic increase in our ability to conduct molecular diagnostic tests, as accurate detection of the virus is critical in preventing its spread. However, SARS-CoV-2 variants continue to emerge, with each new variant potentially affecting widely-used nucleic acid amplification diagnostic tests. RT-LAMP has been adopted as a quick, inexpensive diagnostic alternative to RT-qPCR, but as a newer method, has not been studied as thoroughly. Here we interrogate the effect of SARS-CoV-2 sequence mutations on RT-LAMP amplification, creating 523 single point mutation “variants” covering every position of the LAMP primers in 3 SARS-CoV-2 assays and analyzing their effects with over 4,500 RT-LAMP reactions. Remarkably, we observed only minimal effects on amplification speed and no effect on detection sensitivity at positions equivalent to those that significantly impact RT-qPCR assays. We also created primer sets targeting a specific short deletion and observed that LAMP is able to amplify even with a primer containing multiple consecutive mismatched bases, albeit with reduced speed and sensitivity. This highlights RT-LAMP as a robust technique for viral RNA detection that can tolerate most mutations in the primer regions. Additionally, where variant discrimination is desired, we describe the use of molecular beacons to sensitively distinguish and identify variant RNA sequences carrying short deletions. Together these data add to the growing body of knowledge on the utility of RT-LAMP and increase its potential to further our ability to conduct molecular diagnostic tests outside of the traditional clinical laboratory environment.

Introduction

Molecular diagnostic techniques are able to provide definitive identification of infectious agents through specific detection of DNA or RNA sequences of interest. However, target pathogens, and particularly RNA viruses, naturally accumulate mutations and changes in their genomic sequences that can impact the sensitivity and accuracy of the molecular diagnostic tests when the mutations occur in the regions targeted by the oligonucleotide primers and/or probes. The ongoing SARS-CoV-2 pandemic has seen the emergence of numerous viral variants from different regions of the world, with prominent effects on detection using molecular assays [17]. For example, the B.1.1.7 “alpha” variant notably featured a 6-base deletion (removing 2 amino acids of the spike protein, Δ69–70) which causes a failure of the S Gene assay in the widely used TaqPath® COVID-19 multiplex RT-qPCR test [8]. The other targets in this assay are unaffected, resulting in the ability to provide preliminary identification of variant RNA during detection, identifying a sample for further sequencing analysis and variant determination. In this particular case the other targets can be used for diagnostic detection, but the sensitivity of RT-qPCR to variant mutations is a significant concern to diagnostic testing given the worldwide reliance on the method. Early in 2021 the United States Food and Drug Administration (FDA) issued guidance to molecular test developers [9] calling for evaluation of variant sequences in development of any molecular test, emphasizing the significance of understanding assay performance in the presence of targeted region mutations.

The effects of mutations on qPCR assays are well-studied, with even single-base mutations having generally deleterious effect [18, 10, 11]. Likewise, single-base changes from SARS-CoV-2 mutations have been demonstrated to have significant impact on RT-qPCR assays. One N gene mutation (G29140U) falling in a Forward PCR primer resulted in a 5–6 Cq increase with an estimated 67-fold drop in assay sensitivity [12]. Another N gene single base change (G29179U) in the CDC N2 Forward primer produced a ~4 Cq increase in PCR and a ~5-fold decrease in sensitivity [13]. A study of 14 SARS-CoV-2 RT-qPCR assays with mismatches identified several primer positions as particularly sensitive to mutation, with up to a 7.6 Cq increase compared to fully base-paired templates [7].

In contrast, loop-mediated isothermal amplification (LAMP) diagnostic assays are a more recent technology and accordingly we have comparatively less information on mutation effects. RT-LAMP has played a role in point-of-care and fieldable diagnostics, but during the SARS-CoV-2 pandemic RT-LAMP has emerged as a prominent and widely-used molecular diagnostic method [14]. Isothermal amplification can be performed with much simpler instrumentation than PCR, and detection of RT-LAMP can be conducted directly by visual color change [15, 16], fluorescence [17], sequence-specific probes such as DARQ [18] and molecular beacons [19], or coupled to secondary molecular analysis platforms such as CRISPR [20, 21] and next generation sequencing (e.g. LamPORE and LAMP-Seq) [22, 23]. Several SARS-CoV-2 diagnostic protocols based on RT-LAMP are currently being used for large-scale tests [20, 21, 24, 25] and can utilize crude or unpurified samples, saving time and cost while increasing testing flexibility and portability, exemplified by the utilization of RT-LAMP as the first molecular diagnostic for at-home use granted EUA in November 2020 [25].

As with qPCR, LAMP relies on oligonucleotide primers and mutations in the targeted regions may affect amplification efficiency. However, there is significantly more complexity in LAMP, as it utilizes 6 primers derived from 8 regions in the target sequence, with each of these regions similar in length to a PCR primer [26, 27]. These 6 primers perform different roles during the amplification: F3 and B3 are located outside of the targeted region to aid in release of initial amplicons via strand displacement and are not incorporated into the amplification products. FIP and BIP are composed of two distinct target sequences and are the core primers responsible for the generation of the LAMP hairpin “dumbbell structure” and subsequent exponential amplification. LoopF and LoopB initiate from regions formed by “looping” from FIP and BIP and serve to further increase the speed of amplification.

Previous LAMP assays have been designed specifically to target single nucleotide polymorphisms (SNPs) in a sequence by placing the mutation directly at the 3′ or 5′ terminal base of both the FIP and BIP primers [28]. However, this arrangement is intended to target a known mutation and would not occur in a standard LAMP diagnostic assay. Natural mutations would most frequently consist of single base changes at any location along the LAMP primers, or more rarely, multi-base deletions. For example, the B.1.1.7 Alpha variant, in addition to the 6-base deletion in the S gene described above, contains a 9-base deletion removing 3 amino acids in Orf1a (3675–3677, the “SGF” deletion), and also >18 characteristic single base change mutations. The B.1.617.2 Delta variant contains an additional >20 different point mutations and 2 deletions while Omicron (B.1.1.529) contains >30 point mutations and 4 deletions unique from both the Alpha and Delta variants [29].

Emerging SARS-CoV-2 sequence changes can be monitored for potential overlap with amplification assay primers through the New England Biolabs Primer Monitor tool. Using this tool, mapping common RT-LAMP primers onto SARS-CoV-2 sequences from GISAID shows numerous locations of mutation in small numbers of isolates worldwide. Of higher concern are mutations seen with significant prevalence, (>10% of sequences, deposited from at least 2 geographic locations, independent from any of the well-known variants of interest or concern; see Materials and methods). In each case, only a single base change occurred within any of the primer set regions. In this study, we sought to comprehensively characterize the impact of mutations on RT-LAMP primers, and transferred the prevalent mutations to each position of all 18 oligonucleotide primers making up 3 SARS-CoV-2 RT-LAMP assays. As shown below, RT-LAMP displayed consistent performance in speed and sensitivity across all 523 mutational positions tested.

While this robustness is valuable for a reliable, variant-tolerant molecular diagnostic assay, there is additional value in assays that can distinguish and specifically identify particular variants with the amplification reaction. Sequencing of positive samples will remain the most powerful and sensitive method for variant identification, but molecular diagnostic assays can present a significantly faster and cheaper approach, if appropriately designed. The widely-used TaqMan probes rely on specific hybridization to targeted sequences and may display greater sensitivity to mutations than when they occur in primer regions; the Δ69–70 deletion occurs in the TaqPath probe region and completely prevents detection of RNA with that deletion. While only Alpha and Omicron carry the Δ69–70 deletion, all but Delta carry a 3-amino acid deletion at positions 3675–3677 (3674–3676 in Omicron) in the Orf1a sequence. This relatively large deletion provides a reliable means for designing molecular diagnostic assays that can distinguish between strains differing at this sequence location [8], and we sought to target that region with deletion-specific LAMP primers. While there was some impact on speed and sensitivity, even this significant stretch of mismatches did not inhibit LAMP completely and showed little effect at high copy numbers. Instead, we show below a molecular beacon strategy is needed for variant targeting using RT-LAMP.

Materials and methods

Single point mutation LAMP primers

Three previously described SARS-CoV-2 LAMP primer sets for SARS-CoV-2 were chosen to profile mutational position effects: As1e [30], E1, and N2 [16] (Table 1). Four point mutations in regions targeted by these primers were identified on some of these LAMP primers in GISAID sequences as monitored by NEB Primer Monitor (https://primer-montor.neb.com) in >10% of deposited sequences from >1 reporting location. These mutations were: C2395T, in the As1e BIP primer; G2416T, in the As1e LoopB primer; T29148C, in the N2 F3 primer; and G29179T, in the N2 LoopF primer (locations noted in Table 1 below). We then modeled these known mismatches (G:T, C:T, T:G, G:A) by introducing a mismatch at every base position for each of the primers, changing: C→T, T→C, G→T, or A→C. The resulting 541 primers, including wild-type primers for consistency, were synthesized in 96-well plates and resuspended at 10x concentration (2 μM F3, B3; 16 μM FIP, BIP; 4 μM LoopF, LoopB) by Integrated DNA Technologies (IDT) and spot-checked for concentration accuracy using 90 of the provided oligos.

Table 1. LAMP primers.

Assay Primer Sequence
As1e F3 CGGTGGACAAATTGTCAC
B3 CTTCTCTGGATTTAACACACTT
FIP TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG
BIP TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG
Mutation: C2395U, EU/Alberta
LF TTACAAGCTTAAAGAATGTCTGAACACT
LB TTGAATTTAGGTGAAACATTTGTCACG
Mutation: G2416U, California
E1 F3 TGAGTACGAACTTATGTACTCAT
B3 TTCAGATTTTTAACACGAGAGT
FIP ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG
BIP TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT
LF CGCTATTAACTATTAACG
LB GCGCTTCGATTGTGTGCGT
N2 F3 ACCAGGAACTAATCAGACAAG
Mutation: U29148C, Brazil
B3 GACTTGATCTTTGAAATTTGGATCT
FIP TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC
BIP GCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA
LF GGGGGCAAATTGTGCAATTTG
Mutation: G29179U, Mexico
LB CTTCGGGAACGTGGTTGACC
SGF-del F3 TTCTCTTGCCACTGTAGC
B3 AGTGTCCACACTCTCCTAG
wt-FIP CCAGACAAACTAGTATCAACCATTCTATATGCCTGCTAGTTGG
Del-FIP CTTCAAACTAGTATCAACCATTCTATATGCCTGCTAGTTGG
Mutation: del3675-3677
BIP GTTTTAAGCTAAAAGACTGTGTTATGGTTCTTGCTGTCATAAGGATT
LF CCAACCATGTCATAATACGCATC
LB ATGCATCAGCTGTAGTGTTACT
SGF-MB F3 GCTTTTGCAATGATGTTTGTC
B3 AGTGTCCACACTCTCCTAG
FIP CCAACTAGCAGGCATATAGACCATACATTTCTCTGTTTGTTTTTGTTACC
BIP ATGACATGGTTGGATATGGTTGGTTCTTGCTGTCATAAGGATT
LF AAGCTACAGTGGCAAGAGAA
LB ATGCATCAGCTGTAGTGTTACT
MB-WT /5Cy3/GGAGCTT+T+GT+CTGGTTT+TA+AG+CTCC/3IAbRQSp/
MB-DEL /56-FAM/CGCAGTT+T+GAAG+CTAAA+A+GA+CTGCG/3IABkFQ/

Deletion LAMP primers and molecular beacons

Two primer sets were designed targeting the SGF deletion. The first set (SGF-del) placed 3 deletion-specific bases at the 5’ end of the FIP and compared to the FIP matching the wild-type sequence. The second set (SGF-MB) was designed to amplify both wild-type and SGF deletion for detection by molecular beacons. This set was designed with the SGF deletion located between B1c and LB using the NEB LAMP Primer Design Tool (https://lamp.neb.com) and with enough length between B1c and LB to accommodate the location of molecular beacons in this region. Molecular beacons targeting either wild-type or the SGF deletion sequence were designed using principles according to [19]. As the deletion is located in a relatively AT-rich region, the annealing temperatures for these locked nucleic acid (LNA) beacons are lower: the calculated Tm of the annealed beacon-target for wt MB and SGFdel MB is 63.9 and 62.5°C, and the stem is 55.1 and 54.7°C, respectively. These beacons were synthesized as Affinity Plus qPCR Probes by IDT with sequences shown in Table 1.

RT-LAMP reactions

RT-LAMP reactions were performed using WarmStart® LAMP Kit (DNA & RNA) (E1700) with standard primer concentrations (0.2 μM F3, 0.2 μM B3, 1.6 μM FIP, 1.6 μM BIP, 0.4 μM Loop F, 0.4 μM Loop B) in the presence of 40 mM guanidine hydrochloride [16] in 25 μL on 96-well plates at 65°C in a Bio-Rad CFX96 instrument. LAMP amplification was measured by including 1X NEB LAMP Dye (B1700) or 1 μM SYTO™-9 (ThermoFisher S34854), 0.5 μM SGFdel or 1.0 μM wt beacon, and fluorescent signal was acquired at 15 second intervals. Synthetic SARS-CoV-2 RNAs were obtained from Twist Bioscience (Control 2 for WT MN908947.3; Control 14 for B.1.1.7; Control 16 for B.1.351; and Control 17 for P.1) and diluted in 10 ng/μL Jurkat total RNA based on the copy number provided by the manufacturer.

Results

Positional mutation effects

To mimic the effect of a potential SARS-CoV-2 variant in an RT-LAMP assay, we focused on single point mutations at each primer base position and the SGF deletion that is found in several variants of concern. For the single point mutation primers, each of the 523 variant primers from the 3 assays (As1e, N2, E1) was tested in RT-LAMP reactions with three different SARS-CoV-2 RNA copy number concentrations: 100, 200, and 10,000 copies in order to gain a sense of the mutation effect on reaction speed and sensitivity. Both lower concentrations allowed for amplification effects to be confidently determined outside of stochastic performance when close to the limit of detection (LOD ~50 copies) in the 100 copy reactions, particularly for the As1e primer set which displays slightly lower sensitivity in our testing (S1 and S2 Figs). The reaction output speed was measured relative to the fully-complementary wild-type primer and plotted along the position in the primer sequence (Fig 1). Overall, the ~4,500 RT-LAMP assays containing single point mutations within any of the six primers resulted in minimal to no effect on the ability to amplify the target at any of the copy numbers used, regardless of primer and gene target. The most common result observed was a 5–10% reduction in amplification speed in the presence of a mismatch.

Fig 1. Mutation position effects on RT-LAMP amplification.

Fig 1

Plots of the effects on amplification speed relative to the WT primer set for all 3 assays explored, As1e (blue circle), E1 (red square), N2 (green triangle). (A) F3 primer, (B) B3 primer, (C) FIP primer, (D) BIP primer, (E) Loop F primer, (F) Loop B primer.

Evaluating the effects across the different primers revealed some minor differences based on position and role of the primer. The B3 primers showed remarkably little impact in any of the 69 variant primer sets for the 3 amplicons, though the F3 primer did see some slowing when mismatches were present away from the 5′ end in the E1 and As1e sets (Fig 1A and 1B). These primers are the least critical to the reaction, but the functional difference between the two may suggest differential mismatch tolerance during the reaction initiation step (B3 annealing to single-stranded RNA and extension by RTx reverse transcriptase) versus the strand invasion and displacement via Bst 2.0 polymerase that occurs for the F3 primer. With the more critical FIP and BIP primers, the 3′ half of the primer (F2/B2) serves to invade and prime double-stranded DNA, with the 5′ half annealing to displaced product strands to form the ‘loop’ dumbbell shapes for amplification. As shown in Fig 1C and 1D, more of the variant primer sets caused amplification delays relative to the fully base-paired control when the mutations were located toward the 3′ end of the FIP and BIP (F2/B2 regions) in all 3 LAMP assays. The extreme 5′ end displayed an increased mismatch effect on reaction speed, likely indicating an impact on polymerase extension from a mismatch in the looped-back LAMP hairpin structure, but detection sensitivity was not impacted even with those primer sets. Surprisingly, the speed of the N2 assay increased when mutations were present at internal and 3′ positions of the LoopF primer. This was not a consistent effect, and while difficult to anticipate from sequence prediction its underlying mechanism will be investigated further in future LAMP assays. As a summary of the effects, Table 2 lists the number of positions from each primer that resulted in a change of more than 10% in time to detection from the WT primer baseline. Though overall effects on amplification were minimal, the greater impact of 3′ mutations is clear from the trends in Fig 1. And while a significant number of variant primers resulted in decreased reaction speeds, in all 523 variant primers tested no mutation position prevented amplification in the RT-LAMP reaction with SARS-CoV-2 RNA even with lower RNA copy numbers.

Table 2. The effect of single point mutations on RT-LAMP performance.

Primer No. Positions with >10% LAMP Time Change Total Bases Fraction Positions with >10% Effect
F3 22 62 0.35
B3 0 69 0
FIP 27 131 0.21
BIP 21 128 0.16
LF 18 68 0.26
LB 13 66 0.19

Effect of short deletions on RT-LAMP and detection by molecular beacons

We next looked to characterize the effects of short deletions on RT-LAMP, as have occurred in several SARS-CoV-2 assays. Systematically screening positional deletion effects, as done with single-base mutations above, would require the generation of hundreds of RNA templates. Instead, we took the existing, frequently occurring Orf1a SGF deletion and designed primer sets with that mutation at the 5′ end of the FIP (Table 1), the position of highest sensitivity to mismatches, as determined above. At the the early phase of LAMP amplification, this FIP forms a mismatched 3’ end with wild-type target in the dumbbell. This multi-base mismatch would then interfere with the amplification from the dumbbell and also subsequent priming for polymerization. Testing RT-LAMP containing this SGF-Del-FIP with low copy number (~10 copies), amplification with fully matched SGF deletion target (B.1.1.7 RNA) was efficient and sensitive while no amplification was observed with the mismatched wild-type target, indicating that mismatched FIP affected detection (S3 Fig). However, with higher copy numbers (>1000 copies), primer sets with mismatched target sequence were not completely discriminatory, with amplification of B.1.1.7 RNA and wild-type primers (and vice versa), though with reduced speed (S3 Fig). These results indicates that while some degree of LAMP impact was achieved by placing the SGF deletion at the 5′ end of the FIP, the effects on amplification were insufficient for confident and consistent variant identification with this strategy. And while robust to even 9-base deletions at the FIP end with moderate copy numbers, the significant impact in low copy reactions would indicate mutations of this severity at key positions and would affect the performance of a LAMP diagnostics assay.

Toward a more reliable variant discrimination strategy, we designed another primer set and detected the amplification with two molecular beacons targeting either the wild-type or the variant target region (Table 1). We initially evaluated this primer set for specificity and sensitivity using dsDNA binding as a reporter and found it was able to detect both WT and SGF variant RNA with similar sensitivity of approximately 50 copies and with no apparent non-template amplification signal in 40 minute reactions. We then evaluated detection using the molecular beacons with 10-fold dilutions of wild-type or B.1.1.7 synthetic RNA. Both molecular beacons detected their intended targets as designed with robust specificity and even at 10,000 copies of target RNA they recognized only their intended amplification target sequence (Fig 2).

Fig 2. Detection of target RNAs by SGFwt and SGFdel molecular beacons.

Fig 2

(A) Sequence comparison for wt, SGF deletion, SGFwt-MB and SGFdel-MB. Dashes: bases deleted in SGF deletion; Bold: LNA base; Underlined: stem region; Italics: non-target sequence, attached fluorophores and quenchers. LAMP reactions with either WT RNA (left panels) or B.1.1.7 RNA (right panels) in the presence of (B) SYTO-9, (C) SGFdel-MB, or (D) SGFwt-MB. The primer set amplifies both the wt and B.1.1.7 RNA with similar efficiency as detected with SYTO-9 (B). When beacon was added as a reporter, both SGFdel-MB (C) and SGFwt-MB (D) detected only their intended template RNAs from 50–10,000 copies.

Sensitivity of detection with the SGFdel beacon was evaluated with 3 different variant RNAs [B.1.1.7 (alpha), B.1.351 (beta), or P.1 (gamma)]. RT-LAMP reactions were carried out in 24 replicates with ~50 copies of synthestic RNA for each variant, and detected with either molecular beacon or dsDNA binding dye. Both detection approaches were able to detect all the variant RNAs with similar efficiency (Table 3). We further tested combining both SGFwt and SGFdel molecular beacons in the same LAMP reaction to determine the specificity of the molecular beacons for their specific sequence target. Results from these reactions showed that target RNAs were reliably detected with the same level of sensitivity when both beacons were present, and we observed no interference between the two beacons (Table 4) or detection of the incorrect RNA target sequence.

Table 3. Specific detection of variant RNA with LAMP and molecular beacons.

WT B.1.1.7 B.1.351 P1
SYTO-9 21 21 23 24
Beacon 18 17 24 23

Positives from 24 repeats, 50 copies/reaction

Table 4. Dual-beacon RT-LAMP for variant RNA detection.

Single Beacon Duplex
Cy3 (WT) FAM (Del) Cy3 (WT) FAM (Del)
WT RNA 20 - 20 0
P1 RNA - 18 0 22

Positives from 24 repeats, 50 copies/reaction

Discussion

RT-LAMP has become a significant molecular diagnostic tool during the COVID-19 pandemic due to its simplicity and flexibility, expanding the reach of molecular methods beyond the clinical laboratory where RT-qPCR remains the dominant method. Building a greater understanding of how RT-LAMP assays perform will be critical to increasing their utility, and tolerance to mutations is a pressing need for this and any future viral detection effort. Here we established the first comprehensive screen of LAMP primer tolerance to mutation, investigating a single base mutation at every position of every primer in three prominent SARS-CoV-2 RT-LAMP assays. Remarkably, we find very little impact of the single base changes, with only marginal effect on amplification speed in most positions. In comparison, single-base changes in SARS-CoV-2 mutations have been demonstrated to have significant impact on RT-qPCR assays, shifting performance up to 7.6 Cq and reducing detection sensitivity 10–100 fold depending on the mutation and its position [7, 12]. Mutations at equivalent positions in LAMP primers showed minimal impact on speed and sensitivity.

Profiling effects at every LAMP primer position, we observed greater impact near the 3′ end of the FIP and BIP primers. This effect suggests the importance of initiation via the F2 and B2 regions in driving the formation of the LAMP dumbbell structures. However, while the speed decreases were more pronounced at those positions, the effect was minimal as compared to equivalent mutation positioning in PCR, where a 3′ mismatch can cause a >100-fold sensitivity effect and can be used to completely discriminate a SNP due to inefficient mismatch extension [10].

The robustness of RT-LAMP to sequence variation is a significant benefit over RT-qPCR, with reduced worry about deleterious effects and false negative results from the commonly emerging single-base changes that could occur with some frequency in the regions targeted by the LAMP primers. Additionally, many RT-LAMP assays combine primer sets for added speed and sensitivity [16], adding an additional layer of protection against possible sequence variation. Beyond the most common single-base changes, even targeting a 9-base deletion at the most sensitive location of the FIP primer did not result in complete amplification failure, as RT-LAMP was able to amplify from the significantly mismatched primer-template duplex at moderate copy numbers.

The converse of this assay robustness is an inherent difficulty in identifying variants relying on the amplification reaction. While sequencing offers greater confidence and detail for variant calling, the ability to utilize the diagnostic amplification for prospective variant identification as with the TaqPath S-gene dropout can be a valuable feature of potential diagnostic methods. As described above, we observed difficulty targeting the large 9-base SGF deletion by typical LAMP primer design alone. However, by utilizing a molecular beacon approach as first described by [31]. we were able to accurately amplify and identify RNA from the three SARS-CoV-2 variant sequences containing the SGF deletion. By combining the beacons for the wild-type and deletion sequence, we could call wild-type or variant based on the detected sequence, indicating the potential ability for variant calling in the RT-LAMP assay by multiplexed beacon design. Requiring a molecular beacon and fluorescence detection does of course remove some of LAMP’s advantages in portability and simplicity, but in situations where variant calling is desired, LAMP can enable these applications, still with faster reaction times than PCR and on plate readers and simpler detection equipment that does not require thermal cycling.

Taken together these data position RT-LAMP as an attractive diagnostic method with a high level of tolerance to sequence mutations. Recent FDA guidance described a need for understanding this tolerance for any molecular diagnostic test, and use of RT-LAMP could convey increased confidence to developers that a test will maintain performance. In situations where variant identification is desired, the robustness of LAMP primers is a detriment, but use of molecular beacons provides a sensitive addition to specific sequence detection. RT-LAMP remains a promising molecular diagnostic method and by further characterizing its behaviors and increasing its applicability we hope to further enable it to bring diagnostic testing to field and point-of-care settings where its advantages can be more fully utilized.

Supporting information

S1 Fig. Mutation position effects on RT-LAMP amplification at 100 copies of SARS-CoV-2 RNA.

Plots of the effects of change relative to the WT primer set for all three assays explored, As1e (blue circle), E1 (red square), N2 (green triangle) at 100 copies of SARS-CoV-2 RNA. (A) F3 primer, (B) B3 primer, (C) FIP primer, (D) BIP primer, (E) Loop F primer, (F) Loop B primer.

(TIFF)

S2 Fig. Mutation position effects on RT-LAMP amplification at 200 copies of SARS-CoV-2 RNA.

Plots of the effects of change relative to the WT primer set for all three assays explored, As1e (blue circle), E1 (red square), N2 (green triangle) at 200 copies of SARS-CoV-2 RNA. (A) F3 primer, (B) B3 primer, (C) FIP primer, (D) BIP primer, (E) Loop F primer, (F) Loop B primer.

(TIFF)

S3 Fig. Discrimination of SGF deletion with mismatched primers.

(A) Comparison of sequences of the 5’ of the FIP primers for detecting wt or SGF deletion. (B) LAMP amplification with primer set containing SGFdel-FIP. 8x repeats of LAMP reactions were performed with 1000 or 10 copies of RNA from B117 or wt. The speed of LAMP is shown as “# of Cq” with each Cq equal to 24s. Positive amplification threshold is Cq<60.

(TIFF)

S1 Table

(XLSX)

Acknowledgments

The authors thank Eric Hunt (NEB) for assistance designing the variant primer panels and Nicole Nichols (NEB) for inspiration to conduct the full set of variant profiling experiments. We are grateful to New England Biolabs for fostering an environment of scientific discussion and collaboration, without which this work would not have been possible.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

New England Biolabs (www.neb.com) has funded this study. All authors (ET, YZ, NT) are employees and shareholders of New England Biolabs, manufacturer of LAMP reagents described in the manuscript.

References

Decision Letter 0

Grzegorz Woźniakowski

7 Jan 2022

PONE-D-21-33500Profiling RT-LAMP tolerance of sequence variation for SARS-CoV-2 RNA detection

PLOS ONE

Dear Dr. Tanner,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 19 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Grzegorz Woźniakowski, Full professor, PhD, ScD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript: 

"The authors thank Eric Hunt (NEB) for assistance designing the variant primer panels and Nicole Nichols (NEB) for inspiration to conduct the full set of variant profiling experiments. We are grateful to New England Biolabs for funding the work and fostering an environment of scientific discussion and collaboration, without which this work would not have been possible."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. 

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: 

"New England Biolabs (www.neb.com) has funded this study. All authors (ET, YZ, NT) are employees and shareholders of New England Biolabs, manufacturer of LAMP reagents described in the manuscript"

Additionally, because some of your funding information pertains to [commercial funding//patents], we ask you to provide an updated Competing Interests statement, declaring all sources of commercial funding. 

In your Competing Interests statement, please confirm that your commercial funding does not alter your adherence to PLOS ONE Editorial policies and criteria by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” as detailed online in our guide for authors  http://journals.plos.org/plosone/s/competing-interests.  If this statement is not true and your adherence to PLOS policies on sharing data and materials is altered, please explain how. 

Please include the updated Competing Interests Statement and Funding Statement in your cover letter. We will change the online submission form on your behalf

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter

4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

5. Thank you for stating the following in the Competing Interests section: 

"New England Biolabs (www.neb.com) has funded this study. All authors (ET, YZ, NT) are employees and shareholders of New England Biolabs, manufacturer of LAMP reagents described in the manuscript."

We note that you received funding from a commercial source: [Name of Company]

Please provide an amended Competing Interests Statement that explicitly states this commercial funder, along with any other relevant declarations relating to employment, consultancy, patents, products in development, marketed products, etc. 

Within this Competing Interests Statement, please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. 

Please include your amended Competing Interests Statement within your cover letter. We will change the online submission form on your behalf.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript by Tamanaha et al addresses an important aspect of the COVID-19 pandemic namely the tolerance of current molecular diagnostic techniques, in this case RT-LAMP, to emerging variants. However, there are a number of concerns that greatly reduce the potential of this manuscript that should be addressed before publication:

1. It would be much more informative if a comparative study was carried out between LAMP with the current gold standard i.e. qRT-PCR. The only references given for the supposed effect of mutations on qRT-PCR comes for references from 1989 and 2001 which were themselves praising another competing technology i.e. ARMS. The major message of the manuscript is that LAMP is more robust than qRT-PCR, yet there is no comparative evidence presented to prove that this is really the case.

2. Furthermore, the main experimental evidence given in this manuscript is a series single base mutations yet in the introduction it admits that emerging strains contain multiple mutations and frequent deletions although these scenarios were not considered in this manuscript. Mutations in at least 2 or 3 positions and simple deletions should be considered.

3. Whilst the alpha variant deletion was considered experimentally the authors admitted that LAMP was unable detect this deletion and instead used a molecular beacon to identify this deletion. The use of molecular beacon in an assay however greatly reduces the advantage of using LAMP in the first place, however no mention was made of this short-coming.

4. It is not clear why the authors chose to use synthetic SARS-CoV-2 RNA spiked into RNA from Jurkat, a T-cell line with without considering the effect of the experiments on clinical samples or at least nasopharyngeal or saliva samples.

5. Taking in consideration the points mentioned above the conclusions have been drown from an overinterpretation of the data rather than being fully supported by them.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2022 Mar 24;17(3):e0259610. doi: 10.1371/journal.pone.0259610.r002

Author response to Decision Letter 0


1 Feb 2022

Reviewer Comments and Author Responses:

Reviewer: It would be much more informative if a comparative study was carried out between LAMP with the current gold standard i.e. qRT-PCR. The only references given for the supposed effect of mutations on qRT-PCR comes for references from 1989 and 2001 which were themselves praising another competing technology i.e. ARMS. The major message of the manuscript is that LAMP is more robust than qRT-PCR, yet there is no comparative evidence presented to prove that this is really the case.

Authors: We agree with the reviewer that a comparison against PCR would be informative and considered conducting a similar evaluation with a PCR assay. This would of course take significant time and resources, 44 oligonucleotide primers and 24 dual-labeled probe oligos tested in ~1200 reactions for just one of the Gene N primer+probe sets in our SARS-CoV-2 qPCR kit, for example. The older citations we found relevant to the effects of mismatch positioning on qPCR but we did have references to several SARS-CoV-2 qPCR tests where single-base mutations caused significant impact. This was obviously not clear in the original draft, and in the interim months since our submission several others have been published all showing a significant impact of single-base mutations. We have updated the reference list for these papers (now Refs. 1-12) and moved and updated the relevant text in the introduction, which now reads as below. We feel this is a well-established finding from many other groups and is now better presented alongside our RT-LAMP results.

Updated text:

The effects of mutations on qPCR assays are well-studied, with even single-base mutations having generally deleterious effect (1-8, 10, 11). Likewise, single-base changes from SARS-CoV-2 mutations have been demonstrated to have significant impact on RT-qPCR assays. One N gene mutation (G29140U) falling in a Forward PCR primer resulted in a 5–6 Cq increase with an estimated 67-fold drop in assay sensitivity (12). Another N gene single base change (G29179U) in the CDC N2 Forward primer produced a ~4 Cq increase in PCR and a ~5-fold decrease in sensitivity (13). A study of 14 SARS-CoV-2 RT-qPCR assays with mismatches identified several primer positions as particularly sensitive to mutation, with up to a 7.6 Cq increase compared to fully base-paired templates (7).

Reviewer: Furthermore, the main experimental evidence given in this manuscript is a series single base mutations yet in the introduction it admits that emerging strains contain multiple mutations and frequent deletions although these scenarios were not considered in this manuscript. Mutations in at least 2 or 3 positions and simple deletions should be considered.

Authors: The reviewer is certainly correct that our study did not consider all potential mutation patterns. However, the most common occurrence is a single-base mutation affecting the primer binding region, as described in the PCR data above, our monitoring of mutations with the PrimerMonitor tool, and the only to-date variant mutation in a LAMP primer set, found in Gene E with the Omicron variant. Based on the >5M SARS-CoV-2 sequences compared against the primers to date none feature >1 mutation in the primer regions likely due to just the probability of relatively rare mutation frequency occurring >1 time in a short sequence span. And while we would of course like to have data for the effects of 2 or 3 mutations, that becomes extremely difficult to profile comprehensively as we have done here. For example, in just the As1e primer set there are 195 positions represented. To test all combinations of 2 mutations in that set would require 18,195 primer sets with >50,000 LAMP reactions, just for the one primer set.

We do agree that profiling deletions would be useful as well, and have added experimental data to this point. Testing deletions at all positions would require generating RNA templates with deletions at all positions rather than the order of oligos, a difficult and expensive project to undertake, but we rely on the naturally occurring deletion we have already discussed. In earlier unpublished work we had attempted to target the described SGF deletion using primer design alone, placing the 9-base deletion at the very end of the FIP primer. Unfortunately, this resulted in a partially affected assay, reducing sensitivity and speed, but not providing a sufficient design for variant discrimination as we had intended. But now based on this reviewer point we have added this data into the manuscript, showing that RT-LAMP tolerates even large stretches of mismatches in the most sensitive primer position, reflecting a real-world “worst-case scenario” where the assay is affected but still amplifies. This now builds into the last section describing the variant calling using molecular beacons. As a result, this is now a more complete picture of mutation tolerance. Updated and new text for these points is below:

Previous LAMP assays have been designed specifically to target single nucleotide polymorphisms (SNPs) in a sequence by placing the mutation directly at the 3′ or 5′ terminal base of both the FIP and BIP primers (28). However, this arrangement is intended to target a known mutation and would not occur in a standard LAMP diagnostic assay. Natural mutations would most frequently consist of single base changes at any location along the LAMP primers, or more rarely, multi-base deletions. For example, the B.1.1.7 Alpha variant, in addition to the 6-base deletion in the S gene described above, contains a 9-base deletion removing 3 amino acids in Orf1a (3675–3677, the “SGF” deletion), and also >18 characteristic single base change mutations. The B.1.617.2 Delta variant contains an additional >20 different point mutations and 2 deletions whileOmicron (B.1.1.529) contains >30 point mutations and 4 deletions unique from both the Alpha and Delta variants (29).

Emerging SARS-CoV-2 sequence changes can be monitored for potential overlap with amplification assay primers through New England Biolabs Primer Monitor tool. Using this tool, mapping common RT-LAMP primers onto SARS-CoV-2 sequences from GISAID shows numerous locations of mutation in small numbers of isolates worldwide. Of higher concern are mutations seen with significant prevalence, (>10% of sequences, deposited from at least 2 geographic locations, independent from any of the well-known variants of interest or concern; see Materials and Methods). In each case, only a single base change occurred within any of the primer set regions. In this study, we sought to comprehensively characterize the impact of mutations on RT-LAMP primers, and transferred the prevalent mutations to each position of all 18 oligonucleotide primers making up 3 SARS-CoV-2 RT-LAMP assays. As shown below, RT-LAMP displayed consistent performance in speed and sensitivity across all 523 mutational positions tested.

While this robustness is valuable for a reliable, variant-tolerant molecular diagnostic assay, there is additional value in assays that can distinguish and specifically identify particular variants with the amplification reaction. Sequencing of positive samples will remain the most powerful and sensitive method for variant identification, but molecular diagnostic assays can present a significantly faster and cheaper approach, if appropriately designed. The widely-used TaqMan probes rely on specific hybridization to targeted sequences and may display greater sensitivity to mutations than when they occur in primer regions; the Δ69-70 deletion occurs in the TaqPath probe region and completely prevents detection of RNA with that deletion. While only Alpha and Omicron carry the Δ69-70 deletion, all but Delta carry a 3-amino acid deletion at positions 3675–3677 (3674–3676 in Omicron) in the Orf1a sequence. This relatively large deletion provides a reliable means for designing molecular diagnostic assays that can distinguish between strains differing at this sequence location (8), and we sought to target that region with deletion-specific LAMP primers. While there was some impact on speed and sensitivity, even this significant stretch of mismatches did not inhibit LAMP completely and showed little effect at high copy numbers. Instead, we show below a molecular beacon strategy is needed for variant targeting using RT-LAMP.

Effect of Short Deletions on RT-LAMP and Detection by Molecular Beacons

We next looked to characterize the effects of short deletions on RT-LAMP, as have occurred in several SARS-CoV-2 assays. Systematically screening positional deletion effects, as done with single-base mutations above, would require the generation of hundreds of RNA templates. Instead, we took the existing, frequently occurring Orf1a SGF deletion and designed primer sets with that mutation at the 5′ end of the FIP (Table 1), the position of highest sensitivity to mismatches, as determined above. At the the early phase of LAMP amplification, this FIP forms a mismatched 3’ end with wild-type target in the dumbbell. This multi-base mismatch would then interfere with the amplification from the dumbbell and also subsequent priming for polymerization. Testing RT-LAMP containing this SGF-Del-FIP with low copy number (~10 copies), amplification with fully matched SGF deletion target (B.1.1.7 RNA) was efficient and sensitive while no amplification was observed with the mismatched wild-type target, indicating that mismatched FIP affected detection (S3 Fig). However, with higher copy numbers (~1000 copies), primer sets with mismatched target sequence were not completely discriminatory, with amplification of B.1.1.7 RNA and wild-type primers (and vice versa), though with reduced speed (S3 Fig). These results indicates that while some degree of LAMP impact was achieved by placing the SGF deletion at the 5′ end of the FIP, the effects on amplification were insufficient for confident and consistent variant identification with this strategy. And while robust to even 9-base deletions at the FIP end with moderate copy numbers, the significant impact in low copy reactions would indicate mutations of this severity at key positions and would affect the performance of a LAMP diagnostics assay.

Reviewer: Whilst the alpha variant deletion was considered experimentally the authors admitted that LAMP was unable detect this deletion and instead used a molecular beacon to identify this deletion. The use of molecular beacon in an assay however greatly reduces the advantage of using LAMP in the first place, however no mention was made of this short-coming.

Authors: The reviewer is correct that using fluorescence detection with the molecular beacon does indeed detract a bit from the simplicity advantages of LAMP. However, we only use the beacon for variant identification, a specific use case that we wanted to show was indeed possible with the otherwise variant-tolerant LAMP method. To make this clearer we have added the text below to the Discussion:

Requiring a molecular beacon and fluorescence detection does, of course, remove some of LAMP’s advantages in portability and simplicity, but in situations where variant calling is desired, LAMP can enable these applications, still with faster reaction times than PCR and on plate readers and simpler detection equipment that does not require thermal cycling.

Reviewer: It is not clear why the authors chose to use synthetic SARS-CoV-2 RNA spiked into RNA from Jurkat, a T-cell line with without considering the effect of the experiments on clinical samples or at least nasopharyngeal or saliva samples.

Authors: Use of clinical material would certainly be good and is, of course, necessary for validating a potential clinical assay, but obtaining consistent sample material for the 5,000 LAMP reactions we show here would have been very challenging especially as we wanted to ensure quantitation and equivalence across the various experiments. We store the low-concentration SARS-CoV-2 RNA in a background of Jurkat RNA simply for stabilization as is a common practice for low-copy nucleic acids. Scores of papers and studies have now looked at extracted RNA from clinical samples without any reason to suspect that material would behave differently in examining the effects of specific sequence changes on primer efficiency.

Reviewer: Taking in consideration the points mentioned above the conclusions have been drown from an overinterpretation of the data rather than being fully supported by them.

Authors: We have extensively edited the manuscript to address the above concerns, added additional context and data to the study, and accordingly feel our conclusions are now more solidly supported by the data we show. We hope the reviewer agrees with this in our updated and revised manuscript.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Grzegorz Woźniakowski

1 Mar 2022

Profiling RT-LAMP tolerance of sequence variation for SARS-CoV-2 RNA detection

PONE-D-21-33500R1

Dear Dr. Tanner,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Grzegorz Woźniakowski, Full professor, PhD, ScD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Grzegorz Woźniakowski

15 Mar 2022

PONE-D-21-33500R1

Profiling RT-LAMP tolerance of sequence variation for SARS-CoV-2 RNA detection

Dear Dr. Tanner:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Grzegorz Woźniakowski

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Mutation position effects on RT-LAMP amplification at 100 copies of SARS-CoV-2 RNA.

    Plots of the effects of change relative to the WT primer set for all three assays explored, As1e (blue circle), E1 (red square), N2 (green triangle) at 100 copies of SARS-CoV-2 RNA. (A) F3 primer, (B) B3 primer, (C) FIP primer, (D) BIP primer, (E) Loop F primer, (F) Loop B primer.

    (TIFF)

    S2 Fig. Mutation position effects on RT-LAMP amplification at 200 copies of SARS-CoV-2 RNA.

    Plots of the effects of change relative to the WT primer set for all three assays explored, As1e (blue circle), E1 (red square), N2 (green triangle) at 200 copies of SARS-CoV-2 RNA. (A) F3 primer, (B) B3 primer, (C) FIP primer, (D) BIP primer, (E) Loop F primer, (F) Loop B primer.

    (TIFF)

    S3 Fig. Discrimination of SGF deletion with mismatched primers.

    (A) Comparison of sequences of the 5’ of the FIP primers for detecting wt or SGF deletion. (B) LAMP amplification with primer set containing SGFdel-FIP. 8x repeats of LAMP reactions were performed with 1000 or 10 copies of RNA from B117 or wt. The speed of LAMP is shown as “# of Cq” with each Cq equal to 24s. Positive amplification threshold is Cq<60.

    (TIFF)

    S1 Table

    (XLSX)

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES