Assessing pyrethroid resistance status in the Culex pipiens complex (Diptera: Culicidae) from the northwest suburbs of Chicago, Illinois using Cox regression of bottle bioassays and other detection tools

Edwin R Burgess, IV; Kristina Lopez; Patrick Irwin; Collin P Jaeger; Alden S Estep

doi:10.1371/journal.pone.0268205

. 2022 Jun 29;17(6):e0268205. doi: 10.1371/journal.pone.0268205

Assessing pyrethroid resistance status in the Culex pipiens complex (Diptera: Culicidae) from the northwest suburbs of Chicago, Illinois using Cox regression of bottle bioassays and other detection tools

Edwin R Burgess IV ^1,^*, Kristina Lopez ², Patrick Irwin ², Collin P Jaeger ³, Alden S Estep ^4,^*

Editor: Ahmed Ibrahim Hasaballah⁵

PMCID: PMC9242439 PMID: 35767519

Abstract

Culex pipiens complex is an important vector of epizootic and zoonotic pathogens, including West Nile virus. Chicago, Illinois and its suburbs have suffered high incidence of human West Nile virus infections in the past. This makes abatement programs in and around the Chicago area an essential service. The control of Cx. pipiens is often complicated by rapidly evolving resistance to pyrethroids, which are the most widely used chemical class in US mosquito abatement programs. The present study assessed Sumithrin® resistance in Cx. pipiens collected from five locations around Cook County, Illinois, neighboring the city limits of Chicago. According to CDC guidelines, samples from all five locations demonstrated some resistance to Sumithrin®. When assessed with Anvil®, a formulated product made of Sumithrin® synergized with piperonyl butoxide, susceptibility was rescued in mosquitoes from three out of the five locations, suggesting involvement of mixed-function oxidases and/or carboxylesterases in Sumithrin® resistance at these locations. Not all locations had susceptibility rescued by Anvil®, but these locations had relatively low knockdown resistance allele frequencies, suggesting that mechanisms other than knockdown resistance may be involved. Enzyme activities did not reveal any marked trends that could be related back to mortality in the bottle bioassays, which highlights the need for multiple types of assays to infer enzymatic involvement in resistance. Future directions in pyrethroid resistance management in Chicago area Cx. pipiens are discussed.

Introduction

The Culex pipiens complex (Cx. pipiens) plays a major role in vectoring several epizootic and zoonotic pathogens significant to birds and humans, including West Nile virus (WNV) and St. Louis encephalitis [1, 2]. WNV is considered the most widespread arbovirus in the United States [3]. In the summer of 2002, cases of WNV in Chicago surged, with 884 cases and 66 deaths, followed by another outbreak in 2003 but with only 53 cases [4]. Chicago resides in Cook County, Illinois, and is home to an estimated 5.1 million people. Factors related to geography, housing, population, and abatement strategies around Chicago and the surrounding county makes this a potential high-risk region for WNV cases [5].

Typically thought to feed primarily on birds, Cx. pipiens from the upper Midwest are aggressively anthropophagic [6]. The Cx. pipiens complex is currently comprised of Cx. australicus, Cx. pipiens, and Cx. quinquefasciatus, with various hybridizations and biotypes among the species, two of which are known as form pallens and molestus [7]. Form molestus is present in Chicago [8] but does not appear to be significantly introgressed into these Cx. pipiens populations [9]. The molestus form is important because it appears to be more strongly associated with anthropophagy, increasing its potential to transmit pathogens such as WNV [10, 11]. Mosquitoes from the Cx. pipiens complex are primarily active at night, which makes them particularly good targets for nightly insecticidal control efforts using ultra-low volume (ULV) fogging [12, 13]. ULV fogging remains the most competent tool available for quickly reducing WNV and other mosquito vector populations during times of arboviral disease outbreaks [14].

ULV products typically contain one of two classes of insecticides, either pyrethroids or rarely organophosphates. Pyrethroids are generally safer than organophosphates to vertebrates, as they break down into safe metabolites relatively quickly and they are cheap. But resistance to pyrethroids has been well-documented in Cx. pipiens throughout the United States (reviewed in [15]). Among the likeliest of the proposed physiological mechanisms that confer this resistance are target site mutations in the para region of the voltage-sensitive sodium channel and metabolic detoxification by a few families of enzymes, including mixed-function oxidases (MFO) known as cytochrome P450s, carboxylesterases (CarE), and glutathione S-transferases (GST). How these mechanisms combine to confer resistance is not well-understood but nevertheless should be monitored by mosquito control operations to better understand their relationship to product failure.

In the present study, CDC bottle bioassays were conducted as an initial screening for resistance to Sumithrin® (d-phenothrin), a Type I pyrethroid and Anvil® (Sumithrin® plus piperonyl butoxide, a synergist) in Cx. pipiens from four sites in the northwest suburbs of Cook County, Illinois. These sites were in Wheeling, Arlington Heights, and two sites in Des Plaines. As a post hoc laboratory analysis, organisms from the bottle bioassays were genotyped for single nucleotide polymorphisms in the voltage-sensitive sodium channel that confers knockdown resistance (kdr). Mosquitoes from these samples also were tested for enzymatic activity. Finally, bottle bioassay data was analyzed using clustered Cox regression using time-dependent covariates to account for non-proportional hazards when they occurred [16]. This approach to bottle bioassay data analysis provides additional information on the rate of mortality between start and endpoint. Using Cox regression in this way also is beneficial because non-proportional hazards due to heterogeneity of resistance factors in recently field-derived strains can be accounted for in this type of model.

Methods

Mosquito sources and pyrethroid exposure histories

Five study sites were selected within the Northwest Mosquito Abatement District, located in Cook County, IL, USA (Fig 1 and Table 1). Each site is approximately 2.59 km² and located 0.8 km to 8 km from other sites. Within each site, four homeowners allowed mosquito collections with one CDC gravid trap (John W. Hock Company, Gainesville, FL). Gravid traps were baited with an infusion of 75 g Timothy Complete rabbit food (Kaytee Products Inc., Chilton, WI), 58 g Kentucky bluegrass (Poa pratensis) collected from the district’s property, 2.5 g lactalbumin whey protein (TGS Nutrition, Las Vegas, NV), 0.22 g Altosid® pellets (Central Life Sciences, Schaumburg, IL), and 9.46 L water. Gravid infusion was stored outside for at least one week before use. Cx. pipiens egg rafts were collected from gravid trap basins every other week between the months of July and August in 2020. To ensure the correct species was collected, egg rafts were hatched and reared individually until species could be identified at second instar [17]. Mosquitoes from the same site and collection day were pooled together and reared at 27°C and in a 16:8 hour light:dark cycle. Larvae were fed with ground TetraMin® tropical fish flakes (Spectrum Pet Brands LLC, Blacksburg, VA) and adults were fed a 10% sucrose solution.

Table 1. Sampling collection and analysis information.

Strain Location (Latitude, Longitude)	Abbreviation	Date of Bottle Bioassay (Insecticide Used)	Post Hoc Assays²
Arlington Heights catch Basin (42.054977,– 87.984398)	AHB	August 5 (Sumithrin®)	Genotype, Enzyme
Arlington Heights catch Basin (42.054977,– 87.984398)	AHB	August 7 (Anvil®)	None
Wheeling (42.117205,– 87.936830)	WHE	August 11 (Sumithrin®)	Genotype, Enzyme
		August 13 (AnvilTM)	None
		August 14 (Anvil®)	None
Des Plaines South (42.029653,– 87.930887)	DPS	August 26 (Sumithrin®)	Genotype, Enzyme
Des Plaines South catch basin (42.024806,– 87.925787)	DPSB	August 19 (Sumithrin®)	Genotype
Des Plaines South catch basin (42.024806,– 87.925787)	DPSB	August 21 (AnvilTM, Anvil®)	None
Des Plaines North (42.059309,– 87.912542)	DPN¹	August 5 (Sumithrin®)	None
Des Plaines North (42.059309,– 87.912542)	DPN¹	August 7 (Anvil®)	Genotype
Des Plaines North, first resample	DPN1¹	August 19 (Sumithrin®)	Enzyme
Des Plaines North, first resample	DPN1¹	August 21 (AnvilTM, Anvil®)	None
Des Plaines North, second resample	DPN2¹	September 1 (Sumithrin®)	Enzyme

Open in a new tab

¹ DPN, DPN1, and DPN2 represent different generations of mosquitoes reared from the same sight. DPN2 was collected after DPN1, and DPN1 was collected after DPN.

² Genotyping was for the L982F kdr mutation (Genotype) using mosquitoes from the treatment bottles, and enzyme quantity and activities tested were mixed-function oxidase, α- and β-carboxylesterase, and glutathione S-transferase enzyme activity (Enzyme) using non-treated control mosquitoes run alongside the treated bottles during the bottle bioassays.

Sprays were conducted once a week for 5 weeks in Wheeling, Arlington Heights North, and Des Plaines South in 2019 and 2020, starting in July and ending in August. In 2019, Zenivex® E20 (20% etofenprox) in a 1:1 mix with mineral oil (10% etofenprox) was used and in 2020, Anvil® 10+10 was sprayed at 0.0036 Lb per acre of active ingredient and piperonyl butoxide (PBO). From 2013–2018 Northwest Mosquito Abatement District averaged 1 spray event (etofenprox) per year in these areas. The sites where the mosquitoes were obtained are in residential neighborhoods with numerous parks, schools, and manicured lawns. Numerous residential mosquito/pest control companies operate in these residential areas. Pyrethroids are commonly used by homeowners, park districts, schools, and golf courses [18].

Bottle bioassays

CDC bottle bioassays were completed using three different insecticide solutions on adult Cx. pipiens aged 3–6 days [19] (Table 1). Most bottle bioassays were completed with technical grade Sumithrin® (provided in the CDC bottle bioassay kit) diluted with acetone to 20 μg/bottle, the diagnostic dose used in the bottle bioassay guidelines. The diagnostic time for Sumithrin® in Cx. pipiens adults is 30 minutes. This time and concentration represent empirically determined parameters that are specific for this species to display 100% mortality when fully susceptible ([19], section 3.2). The second solution consisted of Anvil® 10+10 (Clarke® Mosquito Control Products, Inc., Roselle, IL) diluted to 22.2 μg Sumithrin® and 22.2 μg PBO per bottle [20]. This dose of Sumithrin® is similar to the diagnostic dose in the guidelines. The second Anvil® 10+10 solution was made with the same protocol, instead using the 1:1 mineral oil tank mix (abbreviated AnvilTM) diluted with acetone to 11.1 μg Sumithrin® and 11.1 μg PBO per bottle. 250 mL glass Wheaton bottles were treated with 1 mL insecticide solution according to the CDC procedure and allowed to dry for at least four hours. Insecticide solutions were stored at 4°C. Control bottles were treated with 1 mL acetone and allowed to dry for four hours. 15–25 mixed sex Cx. pipiens were aspirated into each bottle and knockdown was recorded every 5 min for 45 min, then every 15 min until 120 min total. At the completion of the bioassay, mosquitoes were killed and stored at –80°C.

Genotyping for knockdown resistance alleles

Genotyping for the 982L and 982F alleles, canonically known as 1014L and 1014F alleles, was conducted using a PCR-based melt curve assay modelled on the assay of Saavedra-Rodriquez et al. [21] but with primers designed for the Cx. pipiens complex (Table 2). Controls for the LL, FF, and the LF genotypes, from mosquitoes that had been previously genotyped by Sanger sequencing, were included to ensure that the assay reliably detected all three genotypes common to the US. No template (negative) controls were also included. Individual organisms collected from the CDC bottle bioassays were loaded into 96-well plates (Omni International, Kennesaw, GA) with 400 μL of nuclease free water and cubic zirconium beads (BioSpec Products, Bartlesville, OK). Plates were sealed with Teflon™ sealing mats and homogenized for 60 seconds at 30 hertz (Omni International, Kennesaw, GA). Samples were centrifuged for 1 min at 805g and then maintained on ice until assay setup. PCR master mix was prepared in sufficient quantity for 400 10 μL reactions (2,000 μL SYBR Select, 1,161.2 μL nuclease free water, 2.4 μL of Cxq_1014L primer, 13.2 μL of Cxq_1014F primer, 10.0 μL of Cxq_1014S primer, and 13.2 μL of Cxq_1014_3’ primer). Eight microliters of mastermix was added to each well of a 384-well plate (Thermo Fisher Scientific, Waltham, MA) followed by 2 μL of centrifuged homogenate using an epMotion 5075 liquid handling system (Eppendorf, Hamburg, Germany) with filtered tips. Amplification and melt curve data were collected on an Applied Biosystems QS6 (Thermo Fisher Scientific, Waltham, MA) using default fast cycling conditions. Determination of alleles present in a sample was assessed by examination of the derivative melt curve for temperature peaks (T_m) as in [21] (Fig 2). In this assay, an LL genotype is characterized by a distinct T_m of 85.3 ± 0.5°C, an FF by a T_m of 82.6 ± 0.5°C, and an LF heterozygote has peaks at both T_ms (Fig 2). Samples that did not amplify or that amplified with a cycle threshold greater than 35 were excluded from analysis.

Table 2. Primers and genomic locations for Cx. pipiens kdr 1014 melt curve assay.

Primer	Genomic location	Sequence
Cxq_1014L	NC51862.1: 22646376–22646398	`GCGGGCAGGGCGGCGGGGGCGGGGTTCACGCTGGAATACTCACGACTA`
Cxq_1014F	NC51862.1: 22646376–22646397	`GGTTCACGCTGGAATACTCACGACA`
Cxq_1014S	NC51862.1: 22646376–22646398	`AGCGCGGAGCGCGGTTCACGCTGGAATACTCACGACTG`
Cxq_1014_3’	NC51862.1: 22646459–22646483	`GGATCGAATCCATGTGGGACTGCAT`

Open in a new tab

Primer sequences in bold are tails added to change melting temperatures following the method of [21].

Fig 2 — Representative melt curve assay results for a 1014L homozygote (LL), a 1014F homozygote (FF), a 1014LF heterozygote (LF), and a nuclease-free water blank (NFW) showing distinct melting temperatures for the L (85.3°C) and F (82.6°C) alleles.

Enzyme activity assays

The content of mixed-function oxidases (MFO), and the activity of α- and β-carboxylesterases (α-, β-CarE), and glutathione S-transferases (GST) were determined using modified methods from [22] using only freeze-killed control mosquitoes from the bottle bioassays (i.e., mosquitoes that were not exposed to any toxicant). Where multiple bottle bioassays were done on the same strain within a week (i.e., the same generation), enzyme content and activities were assessed on only one set of controls from that week. Because sample size for the controls varied between nine and thirty individuals, eight individual mosquitoes were used from each strain. To produce the enzyme source, mosquitoes were placed into 2.0 mL screw cap microcentrifuge tubes loaded with two 2.0 mm zirconium oxide beads and 400 μL of 100 mM sodium phosphate buffer (pH 7.4) with no chelating agents or protease inhibitors. Mosquitoes were homogenized with a bead mill and then centrifuged at 10,000 x g at 4°C for 10 min. The resulting supernatant was used as the enzyme source for all subsequent activity assays as well as for soluble protein determination.

The MFO content in samples was determined using the 3,3’,5,5’-tetramethylbenzidine (TMB) method originally devised by [23]. This assay does not measure the activity of MFOs toward a model substrate. Instead, it measures the heme content in the sample, the majority of which is thought to belong to MFOs [24]. A 0.2% TMB solution was freshly prepared in methanol and then further diluted to 0.05% in 250 mM sodium acetate buffer (pH 5.0). A 20 μL volume of supernatant was added to a 96-well plate in duplicate followed by 200 μL of 0.05% TMB solution. The reaction was started by adding 25 μL of 3% H₂O₂ to each well and then incubating the plate at room temperature for 10 min inside a dark cabinet. Results were compared to a standard curve generated from cytochrome C using the same reagents and volumes as the samples (R² = 0.997). After the incubation period, wells were read at 620 nm in a BioTek Epoch 2 spectrophotometer (BioTek, Santa Clara, CA). Units of activity were thus reported as cytochrome equivalents.

For α- and β-CarE activity, 15 μL of supernatant was incubated with 135 μL of freshly prepared 0.3 mM α- or β-naphthyl acetate (final reaction concentration 0.27 mM in wells) in duplicate in a 96-well plate covered with a lid. Incubation lasted for 15 min at room temperature inside a dark cabinet. The reaction was stopped by adding 50 μL of freshly prepared 0.3% Fast Blue B in 5.0% sodium dodecyl sulphate solution. Color was allowed to develop for 5 min at room temperature in the dark cabinet. The α-naphthyl acetate (α-CarE) samples were read at 600 nm and the β-naphthyl acetate (β-CarE) samples were read at 550 nm. Standard curves of α- and β-naphthol were run in triplicate (both R² = 0.999) and used to quantify the enzymatic conversion of α- and β-naphthyl acetate to α- and β-naphthol, respectively.

For GST activity, 20 μL of supernatant was added in duplicate to wells of a 96-well plate. The substrate mixture consisted of 1 mL of 21 mM 1-chloro-2,4-dinitrobenzene (CDNB) in methanol added to 10 mL of freshly prepared 10 mM of reduced glutathione (GSH) in 100 mM sodium phosphate buffer (pH 6.5) immediately prior to being mixed with the supernatant. A pH of 6.5 was used for the substrate mixture to minimize auto conjugation of GSH with CDNB. 180 μL of substrate mixture was added to each well of supernatant for a final concentration of 0.9 mM CDNB and 0.86 mM GSH. The plate was read at 340 nm in 1 min intervals for 5 min. An experimentally derived extinction coefficient of 0.00580 μM^-1 cm^-1 was used that accounted for the path length through the 200 μL total volume in each well.

Total protein was measured with the Bradford method using bovine serum albumin as a standard (R² = 0.978) [25]. Units for all four enzyme assays were MFO content as μg cytochrome c equivalents/mg protein, and CarE and GST specific activities as nmol substrate/min/mg protein.

Statistical analyses

All analyses were conducted in R version 4.1.1 [26]. Enzyme activities were compared by Kruskal-Wallis tests due to this test being robust to smaller sample sizes. When applicable, a Mann-Whitney-U test was used for pairwise comparisons between the strains. Two analyses were done, one that included DPN1 and another that included DPN2. This was done to simplify the analyses because DPN1 and DPN2 are repeated measures of the same strain, thus not independent, and all other strains were independent. Each enzyme activity assay also was regressed against percent mortality at both 30 min and at 120 min and the slopes were used to determine an effect of enzyme activity on percent mortality. This was done by building general linear models, which were visually assessed for heteroscedasticity and normality of residuals.

For CDC bottle bioassays, a clustered Cox regression was generated on pairwise comparisons of Sumithrin® and Anvil® or Sumithrin® and AnvilTM at the 30 min diagnostic time point used by the CDC to assess resistance [19] using the ‘survival’ package [16]. The clustering effect was assigned to the multiple bottles for each of the treatments. Prior to statistical testing, the Cox models were assessed for proportionality using the ‘cox.zph()’ function. Models that violated the assumption of proportionality had a time-dependent coefficient added to them (i.e., an interaction term between time in minutes and treatment), and these hazard ratios are reported with a time factor change in hazard rate of mortality. For ties in times to death, the Efron approximation was used. A Wald test was used to test the null hypothesis that the beta coefficients = 0 at α = 0.05 and results are reported as fold change in the hazard rate of mortality in the Anvil® or AnvilTM (both Sumithrin® + PBO) treatment compared to the Sumithrin® treatment. Bottle bioassays were analyzed only if at least three replicates of each treatment were done per location. Thus, analyses of AHB, WHE, and DPN were included.

Results

Bottle bioassays

The distribution of observed mortality over 30 min differed in several strains when comparing Sumithrin® technical (20 μg/bottle) against either Anvil® at 22.17 μg Sumithrin® and 22.17 μg PBO or an Anvil® tank mix (AnvilTM) equivalent with 11.09 μg Sumithrin® and 11.09 μg PBO in 1:1 mineral oil (Table 3). Mortality reached 100% in the Anvil® treatment by the diagnostic time of 30 min but was 70% against the technical Sumithrin®. There was a significant difference between Sumithrin® and Anvil® in AHB mosquitoes (Fig 3; HR = 3.85 (2.496–5.949 95% CI), P < 0.001). There was a 3.9-fold change in hazard rate of mortality when mosquitoes were exposed to the Anvil® treatment over the course of 30 min.

Table 3. Percent mortality of five different strains of Culex pipiens complex when exposed to a diagnostic dose of Sumithrin® (20 μg/bottle), Anvil® (22.2 μg/bottle Sumithrin® + 22.2 μg/bottle PBO), or AnvilTM (11.1 μg/bottle Sumithrin® + 11.1 μg/bottle PBO cut 1:1 with mineral oil) from onset of treatment to the diagnostic time point (30 min) and the study end point (120 min).

	% Mortality¹
	After 30 min			After 120 min
Strain	Anvil®	AnvilTM	Sumithrin®	Anvil®	AnvilTM	Sumithrin®
AHB	100	-	70.0	100	-	95.7
WHE	100	88.8	51.4	100	97.2	86.5
DPS	-	-	10.5	-	-	68.4
DPSB	88.2	100	82.6	100	100	100
DPN	82.4	-	72.1	98.8	-	91.8
DPN1	97.8	98.5	76.6	100	100	100
DPN2	-	-	61.1	-	-	100

Open in a new tab

¹ CDC guidelines consider samples with a mortality at the diagnostic time of > 97% are susceptible, 96–90% are building resistance, and < 90% are resistant [19].

Fig 3 — Top panel: common mortality curve. Bottom panel: Kaplan-Meier survival curves and 95% confidence intervals (shaded area). Vertical dotted line at 30 minutes denotes the diagnostic time for Sumithrin®.

Mortality also reached 100% in Anvil® at the diagnostic time in WHE. The hazard ratio was not proportional over time by a factor of 0.91 (Fig 4; HR = 0.91 (0.841–0.992), P = 0.032), and there was a significant difference between Sumithrin® and Anvil® (HR = 36.11 (8.465–154.007 95% CI), P < 0.001). Thus, there was a 36.1-fold change in hazard risk of mortality in the Anvil® treatment at zero min that changed by 0.91 every minute (i.e., 36.1 x 0.91ⁿ, where n = minutes). At 30 min, the hazard rate of mortality in the Anvil® treatment was about a 2.1-fold compared to Sumithrin® alone. The hazard also was not proportional over time between Sumithrin® and AnvilTM at 30 min (HR = 0.91 (0.858–0.970), P = 0.003). The hazard ratio significantly differed between Sumithrin® and AnvilTM (HR = 17.33 (4.707–63.817), P < 0.001). There was a 17.3-fold change in hazard rate of mortality in the AnvilTM treatment starting at zero min and changed by 0.91 every minute for 30 min. By 30 min, the hazard rate of mortality was about double in the Anvil® treatment.

There was no difference in hazard rate of mortality between Sumithrin® and Anvil® in the DPN samples (Fig 5; HR = 1.26 (0.605–2.629), P = 0.537).

Genotyping for knockdown resistance alleles

All five strains tested were positive to varying degrees for the 1014F allele (Table 4). The DPS strain had the highest percent homozygosity for the kdr genotype (FF), as well as the highest frequency for the 1014F allele. No homozygotes for the susceptible genotype (LL) were identified among the tested DPS organisms. The DPN strain that was genotyped was from a collection earlier than those used in the bottle bioassay and enzyme activity assays and had the lowest percent homozygosity of the FF genotype, as well as the lowest 1014F allele frequency. Heterozygosity (genotype LF) was generally high compared to both homozygous genotypes in all five strains.

Table 4. Percent genotype and allele frequency of the leucine-to-phenylalanine (L1014F) knockdown resistance mutation in the voltage-sensitive sodium channel of adult female Culex pipiens complex from some Northwest suburbs of Chicago, Illinois.

		Percent Genotype			Allele Frequency
Strain	n	FF	LF	LL	F	L
AHB	44	25.0	68.2	6.8	0.59	0.41
WHE	46	41.3	54.3	4.3	0.68	0.32
DPS	37	43.2	56.8	0	0.72	0.28
DPSB	38	18.4	65.8	15.8	0.51	0.49
DPN	43	9.3	76.7	14.0	0.48	0.52

Open in a new tab

Enzyme activity assays

The analysis was first done with all strains including DPN1 but not DPN2 and then all strains including DPN2 but not DPN1. Finally, DPN1 and DPN2 were compared. This was done because DPN1 and DPN2 were repeated measures of the DPN strain and thus not independent. Activity of GSTs were only significantly different when DPN2 was included in the group (Fig 6; χ² = 10.59, df = 3, P = 0.014). AHB was significantly different from DPS (W = 54, P = 0.021) and DPN2 (W = 55, P = 0.015) and WHE was significantly different from DPN2 (W = 10, P = 0.021). No other enzyme activities or MFO content were significantly different among the strains. There also was no difference in any of the enzyme activities or MFO content between DPN1 and DPN2 (all P > 0.130). The coefficient of variation for α-CarE and β-CarE in the AHB strain were the two highest among all tested strains and enzyme activities (Table 5). There was no effect of enzyme activity or MFO content that explained the differences in percent mortality at either 30 min or at 120 min (i.e., all regression slopes were statistically equal to zero).

Fig 6 — The lower and upper hinge of boxes represent the 25^th and 75^th quartiles, respectively. The middle line represents the median. The whiskers represent the minimum and maximum range of the data.

Table 5. Coefficient of variation for mixed-function oxidase (MFO), glutathione S-transferase (GST), alpha-carboxylesterase (α-CarE), and beta-carboxylesterase (β-CarE) specific activities in female Culex pipiens complex from four different trapping locations in some Northwest suburbs of Chicago, Illinois, USA.

Larger numbers indicate greater variability relative to their mean.

Strain	MFO	GST	α-CarE	β-CarE
AHB	23.6	19.6	76.5	87.3
WHE	22.7	28.0	23.1	29.0
DPS	30.6	25.6	25.6	23.7
DPN1	13.9	24.6	34.2	35.2
DPN2	22.2	28.4	28.3	33.1

Open in a new tab

Discussion

According to CDC guidelines [19], all five strains in the present study may be resistant to Sumithrin®, and the formulated product Anvil® reclaimed efficacy in three out of five strains. This is not surprising given the frequency of ULV applications in these areas during the time the mosquito collections were made. Previous studies have demonstrated resistance in both adult [27] and larval [28, 29] Cx. pipiens in the suburbs of Chicago. With historically high incidence of WNV in the Chicago area when compared to the rest of the upper Midwest and northeast US where Culex pipiens and Culex restuans are the main vector. [30], monitoring resistance status in Cx. pipiens is of public health importance. Knowing what mechanisms these strains rely on to survive chemical control will help to inform mosquito abatement districts on application timing and product rotation.

Numerous resistance mechanisms have been implicated in Cx. pipiens (reviewed in [15]). Although Culex spp. are known to have a leucine-to-phenylalanine or leucine-to-serine single nucleotide polymorphism (SNP) at the 982^nd amino acid in the para region of the voltage-sensitive sodium channel (structurally the same location as the L1014F/H mutation in house flies), their roles in resistance to pyrethroids is acknowledged but not well-resolved (e.g., [31, 32]). In the case of the leucine-to-serine mutation, there appears to be stronger resistance to DDT than to pyrethroids [33]. The house fly L1014F mutation is only known to confer moderate levels of resistance by itself [34] compared to bi- and tri-allelic kdr combinations [35]. In the case of the Cx. pipiens complex, hybridization rate may also play a role in expression of kdr [31]. In the present study, kdr alone does not appear to explain the relatively large differences in mortality to Sumithrin® at 30 and 120 min but does appear to have some involvement. The DPS strain had the lowest mortality (10.5%) at the diagnostic time of 30 min and had the greatest resistant phenylalanine (F) allele frequency, but WHE had similar allele frequency and resulted in over 40% greater mortality (51.4%) over 30 min. WHE had 100% mortality with Anvil® treatment, suggesting significant involvement of MFOs and/or CarEs.

Tests utilizing synergists in the CDC bottle bioassay can suggest enzymatic detoxification playing a role in resistance [36, 37], especially in the presence of high L982F kdr allele frequencies [38]. That we saw considerable restoration of susceptibility when these strains were tested with Anvil®, a Sumithrin® product that is synergized with PBO, is consistent with previous findings (e.g., [38]). Traditionally, PBO is thought to inhibit cytochrome P450s (aka MFOs), a key enzyme in many oxidative processes, including insecticide metabolism ([39]). But PBO also has been shown to inhibit carboxylesterases [40]. A correlative relationship with enzyme activity and resistance to deltamethrin, permethrin, and DDT in Cx. quinquefasciatus, a close relative to Cx. pipiens, has been previously shown [41]. Xu et al. [42] found over 1,000-fold difference in LC₅₀ in two resistant strains of Cx. quinquefasciatus that were selected with permethrin. PBO contributed significant reduction in LC₅₀ values, down to around 100-fold, of the resistant strains compared to the susceptible strain. Although methodology is different in the present study, the results of the bottle bioassays are consistent with PBO contributing significant restoration of Sumithrin® efficacy, suggesting that either cytochrome P450s and/or carboxylesterases play a role in the resistance phenotype among these strains. Similar restoration of susceptibility was recently demonstrated in populations of Cx. quinquefasciatus from Florida and California [36, 37].

In the case of the MFO activity assay, 3’,3,5’,5’-TMB is a substrate used to measure heme content in a sample, of which most is thought to be attributed to cytochrome P450s [23]. This assay is considered a surrogate assay and does not measure activity directly as in other types of activity assays, such as the CarE and GST assays in the present study. Although regressions of bottle bioassay mortality did not suggest a relationship based on MFO quantity, CarE, or GST activities in the control mosquitoes, it does not rule out altered enzyme activity toward Sumithrin®. It also does not rule out inducible overexpression of these enzymes, especially MFOs, which have been documented in resistant Cx. quinquefasciatus [43]. This is a plausible explanation for the discrepancy between enzyme activities and PBO synergism because induction usually happens shortly after initiation of exposure to a toxicant, and enzyme activities conducted in the present study were done on control mosquitoes (i.e., not exposed to Sumithrin®). Regardless of the dynamics of cytochrome P450 expression, PBO tends to reduce pyrethroid LD₅₀s even in lab-reared, fully susceptible Culex spp. (e.g., [37]), and Musca domestica (e.g., [44]).

Although limited in what they can tell us about enzymatic involvement in resistance, an application of enzyme activity assays that may be useful in describing the dynamics of the enzymatic role in resistance is in an induction experiment. In an induction experiment, the researcher exposes the animals to a sublethal dose of the insecticide and collects individuals over a time series. The researcher then runs activity assays on the specimens and relates the activities back to toxicological response data. The assay in the present study only had the potential to detect constitutively expressed detoxification enzymes. The goal of a future study in Cx. pipiens complex adults from the Chicago area should include an induction experiment with Sumithrin®. That the synergized formulation of Sumithrin® and PBO in Anvil® restored susceptibility in multiple strains suggests that expression of MFOs and/or CarEs may be induced at high levels upon exposure to a toxicant like Sumithrin®, or perhaps even have a target site mutation that confers an advantage in processing Sumithrin®. Another explanation could be that the model substrates used in the present study simply do not interact with the isozymes that may play a role in Cx. pipiens complex resistance to Sumithrin®. This could also be true of any induction experiment undertaken in future studies.

We note that in the AHB strain, there was a high coefficient of variation in the CarE activities relative to the other strains. The inclusion of PBO with Sumithrin® appeared to provide satisfactory control in this strain at the time of data collection and should be considered in future regional control efforts. WHE had notable resistance to Sumithrin® but similarly the addition of PBO in Anvil® provided 100% mortality at the diagnostic time of 30 min. AHB and WHE had the greatest difference in mortality at 30 min diagnostic period between Sumithrin® and Anvil® (30% and 48.6%, respectively). The DPS strain showed the highest resistance according to CDC diagnostic dose and time for Sumithrin®. DPS also showed the highest F allele frequency and the highest percentage of resistant FF homozygotes. DPS was not screened with Anvil® and there was no indication of enzymatic involvement based on the activity assays. A follow up study should focus on the DPS strain and include an Anvil® bottle bioassay to measure an effect, if any, that MFOs and/or CarEs have on its resistance. Interestingly, neither DPSB nor two of the DPN resamples reverted to 100% mortality when treated with Anvil®. By the second resampling (DPN2), resistance to Sumithrin® increased by 11%.

Examined from the perspective of hazard ratios, in the case of AHB and WHE, we saw that treatment with Anvil® resulted in a 3.9-fold and 2.1-fold change in the risk of mortality at 30 min compared to Sumithrin®. In DPN, the raw bottle bioassay mortality data shows only a small increase in mortality in the Anvil® treatment, which statistically conferred no greater risk of mortality than the Sumithrin® treatment. With the inability to calculate informative numbers such as resistance and synergist ratios (e.g., [45, 46]) using diagnostic doses in bottle bioassays, hazard ratios from Cox regression offer the potential to make ratio-based quantitative comparisons among treatments. In the present study, the choice to analyze bottle bioassay data using Cox regression was made after bottle bioassays had already been run and some potentially important factors such as sex and genotypes were not collected. The inclusion of these types of factors would help to explain results like these in future studies. We recommend the use of clustered Cox regression with time-dependent covariates when describing how much risk multiple variables contribute to the rate of mortality across a given diagnostic time period. Typical analyses of bottle bioassays, including binomial generalized linear models and repeated measures ANOVA, violate several important assumptions of these statistical tests, including the independence of observations [47], which seldom allow for the correct grouping variables to account for this fact. This can be accounted for using a clustering effect in Cox regression, which is akin to a random factor in a mixed model. Quite often, studies that utilize Kaplan-Meier survival analysis are not assessed for the assumption of proportional hazards, a key assumption that must be met for model estimates to be deemed accurate [16]. This is evident by the often-seen crossing of survival curves in a figure (e.g., Fig 4). We have provided code for readers to use on future analyses of bottle bioassay data using Cox regression. Cox regression is a benefit to the interpretation of bottle bioassay data because it allows multiple factors to be assessed simultaneously across numerous time points, not just a single endpoint. We liken these two statistical comparisons to taking a picture (end-point analysis) versus watching a movie (Cox regression analysis). For instance, in Fig 3 (WHB) mortality in the Anvil® and AnvilTM treatments were in excess of 75% within the first 10 and 15 min, respectively, at which point an inflection in the rate of mortality can be seen. With downstream molecular and biochemical analyses, this point of inflection could be characterized, with Cox regression as the statistical method to infer risk of mortality due to those types of factors. Future studies on Cx. pipiens resistance in field strains, where topical application of pesticides is not feasible, should incorporate this type of analysis to make clearer distinctions among the numerous resistance mechanisms and their relative impact on operational success.

Supporting information

S1 File. R-script for Cox regression survival analysis of bioassay data.

(PDF)

Click here for additional data file.^{(235.9KB, pdf)}

Acknowledgments

The authors thank Skyler Finucane, Natalia Szklaruk, Jim Downing, Colin Murphy, and Jack Ponterelli for assistance with mosquito rearing and bottle bioassays.

Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the Centers for Disease Control and Prevention or the Department of Health and Human Services or the USDA. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This manuscript was supported in part by Cooperative Agreement Number U01CK000505, funded by the Centers for Disease Control and Prevention to PI and KL. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Gottlieb S. West Nile virus detected in mosquitoes in Central Park. B World Health Organ. 2000;78(9):1168-. PubMed PMID: WOS:000089263900021. [Google Scholar]
2.Tsai TF, Mitchell CJ. St. louis encephalitis. The arboviruses: epidemiology and ecology. 1989;4:113–43. [Google Scholar]
3.Kuehn BM. Shifting Trends in West Nile and Other Arboviral Diseases. JAMA. 2021;326(12):1140. doi: 10.1001/jama.2021.15826 . [DOI] [PubMed] [Google Scholar]
4.Illinois Department of Public Health. WNV Surveillance 2021. Available from: https://dph.illinois.gov/topics-services/diseases-and-conditions/west-nile-virus/surveillance.html].
5.Ruiz MO, Tedesco C, McTighe TJ, Austin C, Kitron U. Environmental and social determinants of human risk during a West Nile virus outbreak in the greater Chicago area, 2002. Int J Health Geogr. 2004;3(1):8. Epub 20040420. doi: 10.1186/1476-072X-3-8 ; PubMed Central PMCID: PMC420251. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Hamer GL, Kitron UD, Brawn JD, Loss SR, Ruiz MO, Goldberg TL, et al. Culex pipiens (Diptera: Culicidae): a bridge vector of West Nile virus to humans. J Med Entomol. 2008;45(1):125–8. doi: 10.1603/0022-2585(2008)45[125:cpdcab]2.0.co;2 . [DOI] [PubMed] [Google Scholar]
7.Harbach RE. Culex pipiens: species versus species complex taxonomic history and perspective. J Am Mosq Control Assoc. 2012;28(4 Suppl):10–23. doi: 10.2987/8756-971X-28.4.10 . [DOI] [PubMed] [Google Scholar]
8.Mutebi JP, Savage HM. Discovery of Culex pipiens pipiens form molestus in Chicago. J Am Mosq Control Assoc. 2009;25(4):500–3. doi: 10.2987/09-5910.1 . [DOI] [PubMed] [Google Scholar]
9.Kothera L, Mutebi JP, Kenney JL, Saxton-Shaw K, Ward MP, Savage HM. Bloodmeal, Host Selection, and Genetic Admixture Analyses of Culex pipiens Complex (Diptera: Culicidae) Mosquitoes in Chicago, IL. J Med Entomol. 2020;57(1):78–87. doi: 10.1093/jme/tjz158 . [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Huang S, Hamer GL, Molaei G, Walker ED, Goldberg TL, Kitron UD, et al. Genetic variation associated with mammalian feeding in Culex pipiens from a West Nile virus epidemic region in Chicago, Illinois. Vector Borne Zoonotic Dis. 2009;9(6):637–42. doi: 10.1089/vbz.2008.0146 . [DOI] [PubMed] [Google Scholar]
11.Kilpatrick AM, Kramer LD, Jones MJ, Marra PP, Daszak P, Fonseca DM. Genetic influences on mosquito feeding behavior and the emergence of zoonotic pathogens. Am J Trop Med Hyg. 2007;77(4):667–71. . [PubMed] [Google Scholar]
12.Hickner PV, Mori A, Rund SSC, Sheppard AD, Cunningham JM, Chadee DD, et al. QTL Determining Diel Flight Activity in Male Culex pipiens Mosquitoes. J Hered. 2019;110(3):310–20. doi: 10.1093/jhered/esz003 ; PubMed Central PMCID: PMC6503456. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Veronesi R, Gentile G, Carrieri M, Maccagnani B, Stermieri L, Bellini R. Seasonal pattern of daily activity of Aedes caspius, Aedes detritus, Culex modestus, and Culex pipiens in the Po Delta of northern Italy and significance for vector-borne disease risk assessment. J Vector Ecol. 2012;37(1):49–61. doi: 10.1111/j.1948-7134.2012.00199.x . [DOI] [PubMed] [Google Scholar]
14.American Mosquito Control Association. Best practices for integrated mosquito management. Sacramento, California, USA. 2021. [Google Scholar]
15.Scott JG, Yoshimizu MH, Kasai S. Pyrethroid resistance in Culex pipiens mosquitoes. Pestic Biochem Physiol. 2015;120:68–76. Epub 20141219. doi: 10.1016/j.pestbp.2014.12.018 . [DOI] [PubMed] [Google Scholar]
16.Therneau T. A package for survival analysis in R-_. R package version 3.2–11 2021. Available from: https://CRAN.R-project.org/package=survival].
17.Darsie RF, Ward RA, Chang CC. Identification and geographical distribution of the mosquitoes of North America, north of Mexico. Fresno, Calif.: American Mosquito Control Association; 1981. 313 p. p. [Google Scholar]
18.Kuivila KM, Hladik ML, Ingersoll CG, Kemble NE, Moran PW, Calhoun DL, et al. Occurrence and potential sources of pyrethroid insecticides in stream sediments from seven US metropolitan areas. Environmental science & technology. 2012;46(8):4297–303. [DOI] [PubMed] [Google Scholar]
19.McAllister J, Scott M, Control CfD, Prevention. CONUS manual for evaluating insecticide resistance in mosquitoes using the CDC bottle bioassay kit. CDC, Atlanta, GA. 2020.
20.Petersen J. Measuring Insecticide Resistance by the Bottle Bioassay. Florida Mosquito Control Handbook. 2004:1–10. [Google Scholar]
21.Saavedra-Rodriguez K, Urdaneta-Marquez L, Rajatileka S, Moulton M, Flores AE, Fernandez-Salas I, et al. A mutation in the voltage-gated sodium channel gene associated with pyrethroid resistance in Latin American Aedes aegypti. Insect Mol Biol. 2007;16(6):785–98. doi: 10.1111/j.1365-2583.2007.00774.x . [DOI] [PubMed] [Google Scholar]
22.Valle D, Montella I, Ribeiro R, Viana-Medeiros P, Martins Jr A, Lima J. Quantification methodology for enzyme activity related to insecticide resistance in Aedes aegypti. Fundação Oswaldo Cruz and Secretaria de Vigilância em Saúde, Ministério da Saúde, Rio de Janeiro and Distrito Federal, Brazil. 2006.
23.Brogdon WG, McAllister JC, Vulule J. Heme peroxidase activity measured in single mosquitoes identifies individuals expressing an elevated oxidase for insecticide resistance. J Am Mosq Control Assoc. 1997;13(3):233–7. . [PubMed] [Google Scholar]
24.Hemingway J, Karunaratne SH. Mosquito carboxylesterases: a review of the molecular biology and biochemistry of a major insecticide resistance mechanism. Med Vet Entomol. 1998;12(1):1–12. doi: 10.1046/j.1365-2915.1998.00082.x . [DOI] [PubMed] [Google Scholar]
25.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54. doi: 10.1006/abio.1976.9999 . [DOI] [PubMed] [Google Scholar]
26.R Core Team. R: A language and environment for statistical computing 2021 [cited Vienna, Austria]. Available from: https://www.R-project.org].
27.Clifton ME, Xamplas CP, Nasci RS, Harbison J. Gravid Culex pipiens Exhibit A Reduced Susceptibility to Ultra-Low Volume Adult Control Treatments Under Field Conditions. J Am Mosq Control Assoc. 2019;35(4):267–78. doi: 10.2987/19-6848.1 . [DOI] [PubMed] [Google Scholar]
28.Harbison JE, Layden JE, Xamplas C, Zazra D, Henry M, Ruiz MO. Observed loss and ineffectiveness of mosquito larvicides applied to catch basins in the northern suburbs of chicago IL, 2014. Environ Health Insights. 2015;9:1–5. Epub 20150421. doi: 10.4137/EHI.S24311 ; PubMed Central PMCID: PMC4406279. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Harbison JE, Sinacore JM, Henry M, Xamplas C, Dugas LR, Ruiz MO. Identification of larvicide-resistant catch basins from three years of larvicide trials in a suburb of chicago, IL. Environ Health Insights. 2014;8(Suppl 2):1–7. Epub 20141013. doi: 10.4137/EHI.S16014 ; PubMed Central PMCID: PMC4216650. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Centers for Disease Control and Prevention (CDC). Average annual incidence of West Nile virus neuroinvasive disease reported to CDC by county, 1999–2020 2020. Available from: https://www.cdc.gov/westnile/statsmaps/cumMapsData.html#five].
31.Bkhache M, Tmimi FZ, Charafeddine O, Faraj C, Failloux AB, Sarih M. First report of L1014F-kdr mutation in Culex pipiens complex from Morocco. Parasit Vectors. 2016;9(1):644. Epub 20161216. doi: 10.1186/s13071-016-1931-5 ; PubMed Central PMCID: PMC5159952. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Zhou L, Lawrence GG, Vineis JH, McAllister JC, Wirtz RA, Brogdon WG. Detection of broadly distributed sodium channel alleles characteristic of insect pyrethroid resistance in West Nile virus vector Culex pipiens complex mosquitoes in the United States. J Med Entomol. 2009;46(2):321–7. doi: 10.1603/033.046.0217 . [DOI] [PubMed] [Google Scholar]
33.Martinez-Torres D, Foster SP, Field LM, Devonshire AL, Williamson MS. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Mol Biol. 1999;8(3):339–46. doi: 10.1046/j.1365-2583.1999.83121.x . [DOI] [PubMed] [Google Scholar]
34.Sun H, Tong KP, Kasai S, Scott JG. Overcoming super-knock down resistance (super-kdr) mediated resistance: multi-halogenated benzyl pyrethroids are more toxic to super-kdr than kdr house flies. Insect Mol Biol. 2016;25(2):126–37. Epub 20151222. doi: 10.1111/imb.12206 . [DOI] [PubMed] [Google Scholar]
35.Sun H, Kasai S, Scott JG. Two novel house fly Vssc mutations, D600N and T929I, give rise to new insecticide resistance alleles. Pestic Biochem Physiol. 2017;143:116–21. Epub 20170824. doi: 10.1016/j.pestbp.2017.08.013 . [DOI] [PubMed] [Google Scholar]
36.Lucas KJ, Bales RB, McCoy K, Weldon C. Oxidase, Esterase, and KDR-Associated Pyrethroid Resistance in Culex quinquefasciatus Field Collections of Collier County, Florida. J Am Mosq Control Assoc. 2020;36(1):22–32. doi: 10.2987/19-6850.1 . [DOI] [PubMed] [Google Scholar]
37.McAbee RD, Kang KD, Stanich MA, Christiansen JA, Wheelock CE, Inman AD, et al. Pyrethroid tolerance in Culex pipiens pipiens var molestus from Marin County, California. Pest Manag Sci. 2004;60(4):359–68. doi: 10.1002/ps.799 . [DOI] [PubMed] [Google Scholar]
38.Lee HJ, Longnecker M, Calkins TL, Renfro AD, Fredregill CL, Debboun M, et al. Detection of the Nav channel kdr-like mutation and modeling of factors affecting survivorship of Culex quinquefasciatus mosquitoes from six areas of Harris County (Houston), Texas, after permethrin field-cage tests. PLoS Negl Trop Dis. 2020;14(11):e0008860. Epub 20201119. doi: 10.1371/journal.pntd.0008860 ; PubMed Central PMCID: PMC7714350. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Sun Y-P, Johnson E. Synergistic and antagonistic actions of insecticide-synergist combinations and their mode of action. Journal of Agricultural and Food Chemistry. 1960;8(4):261–6. [Google Scholar]
40.Khot AC, Bingham G, Field LM, Moores GD. A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Manag Sci. 2008;64(11):1139–42. doi: 10.1002/ps.1603 . [DOI] [PubMed] [Google Scholar]
41.Sarkar M, Bhattacharyya IK, Borkotoki A, Goswami D, Rabha B, Baruah I, et al. Insecticide resistance and detoxifying enzyme activity in the principal bancroftian filariasis vector, Culex quinquefasciatus, in northeastern India. Med Vet Entomol. 2009;23(2):122–31. doi: 10.1111/j.1365-2915.2009.00805.x . [DOI] [PubMed] [Google Scholar]
42.Xu Q, Liu H, Zhang L, Liu N. Resistance in the mosquito, Culex quinquefasciatus, and possible mechanisms for resistance. Pest Manag Sci. 2005;61(11):1096–102. doi: 10.1002/ps.1090 . [DOI] [PubMed] [Google Scholar]
43.Gong Y, Li T, Zhang L, Gao X, Liu N. Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus. Int J Biol Sci. 2013;9(9):863–71. Epub 20130905. doi: 10.7150/ijbs.6744 ; PubMed Central PMCID: PMC3805894. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Kasai S, Scott JG. Overexpression of cytochrome P450 CYP6D1 is associated with monooxygenase-mediated pyrethroid resistance in house flies from Georgia. Pesticide Biochemistry and Physiology. 2000;68(1):34–41. [Google Scholar]
45.Ahmed MA, Vogel CF. Synergistic action of octopamine receptor agonists on the activity of selected novel insecticides for control of dengue vector Aedes aegypti (Diptera: Culicidae) mosquito. Pestic Biochem Physiol. 2015;120:51–6. Epub 20150122. doi: 10.1016/j.pestbp.2015.01.014 . [DOI] [PubMed] [Google Scholar]
46.Estep AS, Sanscrainte ND, Waits CM, Louton JE, Becnel JJ. Resistance Status and Resistance Mechanisms in a Strain of Aedes aegypti (Diptera: Culicidae) From Puerto Rico. J Med Entomol. 2017;54(6):1643–8. Epub 2017/10/06. doi: 10.1093/jme/tjx143 . [DOI] [PubMed] [Google Scholar]
47.Zar JH. Biostatistical analysis. 5th ed. Upper Saddle River, N.J.: Prentice-Hall/Pearson; 2010. xiii, 944 p. p. [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0268205.r001

Decision Letter 0

Ahmed Ibrahim Hasaballah

17 May 2022

PONE-D-22-11736

Assessing pyrethroid resistance status in the Culex pipiens complex (Diptera: Culicidae) from the northwest suburbs of Chicago, Illinois using Cox regression of bottle bioassays and other detection tools

PLOS ONE

Dear Dr. Estep,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jul 01 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ahmed Ibrahim Hasaballah

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.

3. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an ""Other"" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I've made comments on a copy of the manuscript and will upload that.

Overall the paper is very well written and contributes to what is known about resistance in an important vector of West Nile

virus. I made a few comments and suggestions. Nice work.

Reviewer #2: Good study reporting the situation of pyrethroid resistance in some Culex pipiens populations in Chicago Illinois I have few remarks

Methods

In the section “Mosquito sources and pyrethroid exposure histories” the authors should add information on common aquatic habitats for Culex larvae in the different study sites.

Line 123 to 128 “Sprays were conducted once a week for 5 weeks in Wheeling, Arlington Heights North, and Des Plaines South in 2019 and 2020, starting in July and ending in August. In 2019, Zenivex® E20 (20% etofenprox) in a 1:1 mix with mineral oil (10% etofenprox) was used and in 2020, Anvil® 10+10 was sprayed at 0.0036 Lb per acre of active ingredient and piperonyl butoxide (PBO). From 2013 – 2018 Northwest Mosquito Abatement District averaged 1 spray event (etofenprox) per year in these areas.”

What area is sprayed? is it houses? Water collection? What??? Please add information

Results

The authors say they did mosquito identification in the methodology but no information on the identity of species recorded by sites is presented.

The authors also say haven used both male and females for bioassay but no information on the susceptibility of each group to insecticides is provided. I will propose that they add information on males and females susceptibility to insecticide. This data could improve comprehension and interpretation of their findings.

Genotyping for knockdown resistance alleles

The authors should include details of mosquito processed were these mosquitoes survivors to bioassays? were they dead? or mosquitoes not exposed?

Enzyme activity assays

The authors should add the precision whether the expression profile reported is for resistant samples or for samples not exposed to insecticide.

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Linda Kothera

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: PONE-D-22-11736_reviewer2.pdf

Click here for additional data file.^{(1.6MB, pdf)}

PLoS One. 2022 Jun 29;17(6):e0268205. doi: 10.1371/journal.pone.0268205.r002

Author response to Decision Letter 0

6 Jun 2022

A thorough response to both the Editor and Reviewer comments are in the Response to Reviewers

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0268205.r003

Decision Letter 1

Ahmed Ibrahim Hasaballah

10 Jun 2022

Assessing pyrethroid resistance status in the Culex pipiens complex (Diptera: Culicidae) from the northwest suburbs of Chicago, Illinois using Cox regression of bottle bioassays and other detection tools

PONE-D-22-11736R1

Dear Dr. Estep,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ahmed Ibrahim Hasaballah

Academic Editor

PLOS ONE

PLoS One. doi: 10.1371/journal.pone.0268205.r004

Acceptance letter

Ahmed Ibrahim Hasaballah

20 Jun 2022

PONE-D-22-11736R1

Dear Dr. Estep:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Ahmed Ibrahim Hasaballah

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. R-script for Cox regression survival analysis of bioassay data.

(PDF)

Click here for additional data file.^{(235.9KB, pdf)}

Attachment

Submitted filename: PONE-D-22-11736_reviewer2.pdf

Click here for additional data file.^{(1.6MB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.9KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0268205.ref001] 1.Gottlieb S. West Nile virus detected in mosquitoes in Central Park. B World Health Organ. 2000;78(9):1168-. PubMed PMID: WOS:000089263900021. [Google Scholar]

[pone.0268205.ref002] 2.Tsai TF, Mitchell CJ. St. louis encephalitis. The arboviruses: epidemiology and ecology. 1989;4:113–43. [Google Scholar]

[pone.0268205.ref003] 3.Kuehn BM. Shifting Trends in West Nile and Other Arboviral Diseases. JAMA. 2021;326(12):1140. doi: 10.1001/jama.2021.15826 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref004] 4.Illinois Department of Public Health. WNV Surveillance 2021. Available from: https://dph.illinois.gov/topics-services/diseases-and-conditions/west-nile-virus/surveillance.html].

[pone.0268205.ref005] 5.Ruiz MO, Tedesco C, McTighe TJ, Austin C, Kitron U. Environmental and social determinants of human risk during a West Nile virus outbreak in the greater Chicago area, 2002. Int J Health Geogr. 2004;3(1):8. Epub 20040420. doi: 10.1186/1476-072X-3-8 ; PubMed Central PMCID: PMC420251. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref006] 6.Hamer GL, Kitron UD, Brawn JD, Loss SR, Ruiz MO, Goldberg TL, et al. Culex pipiens (Diptera: Culicidae): a bridge vector of West Nile virus to humans. J Med Entomol. 2008;45(1):125–8. doi: 10.1603/0022-2585(2008)45[125:cpdcab]2.0.co;2 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref007] 7.Harbach RE. Culex pipiens: species versus species complex taxonomic history and perspective. J Am Mosq Control Assoc. 2012;28(4 Suppl):10–23. doi: 10.2987/8756-971X-28.4.10 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref008] 8.Mutebi JP, Savage HM. Discovery of Culex pipiens pipiens form molestus in Chicago. J Am Mosq Control Assoc. 2009;25(4):500–3. doi: 10.2987/09-5910.1 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref009] 9.Kothera L, Mutebi JP, Kenney JL, Saxton-Shaw K, Ward MP, Savage HM. Bloodmeal, Host Selection, and Genetic Admixture Analyses of Culex pipiens Complex (Diptera: Culicidae) Mosquitoes in Chicago, IL. J Med Entomol. 2020;57(1):78–87. doi: 10.1093/jme/tjz158 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref010] 10.Huang S, Hamer GL, Molaei G, Walker ED, Goldberg TL, Kitron UD, et al. Genetic variation associated with mammalian feeding in Culex pipiens from a West Nile virus epidemic region in Chicago, Illinois. Vector Borne Zoonotic Dis. 2009;9(6):637–42. doi: 10.1089/vbz.2008.0146 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref011] 11.Kilpatrick AM, Kramer LD, Jones MJ, Marra PP, Daszak P, Fonseca DM. Genetic influences on mosquito feeding behavior and the emergence of zoonotic pathogens. Am J Trop Med Hyg. 2007;77(4):667–71. . [PubMed] [Google Scholar]

[pone.0268205.ref012] 12.Hickner PV, Mori A, Rund SSC, Sheppard AD, Cunningham JM, Chadee DD, et al. QTL Determining Diel Flight Activity in Male Culex pipiens Mosquitoes. J Hered. 2019;110(3):310–20. doi: 10.1093/jhered/esz003 ; PubMed Central PMCID: PMC6503456. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref013] 13.Veronesi R, Gentile G, Carrieri M, Maccagnani B, Stermieri L, Bellini R. Seasonal pattern of daily activity of Aedes caspius, Aedes detritus, Culex modestus, and Culex pipiens in the Po Delta of northern Italy and significance for vector-borne disease risk assessment. J Vector Ecol. 2012;37(1):49–61. doi: 10.1111/j.1948-7134.2012.00199.x . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref014] 14.American Mosquito Control Association. Best practices for integrated mosquito management. Sacramento, California, USA. 2021. [Google Scholar]

[pone.0268205.ref015] 15.Scott JG, Yoshimizu MH, Kasai S. Pyrethroid resistance in Culex pipiens mosquitoes. Pestic Biochem Physiol. 2015;120:68–76. Epub 20141219. doi: 10.1016/j.pestbp.2014.12.018 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref016] 16.Therneau T. A package for survival analysis in R-_. R package version 3.2–11 2021. Available from: https://CRAN.R-project.org/package=survival].

[pone.0268205.ref017] 17.Darsie RF, Ward RA, Chang CC. Identification and geographical distribution of the mosquitoes of North America, north of Mexico. Fresno, Calif.: American Mosquito Control Association; 1981. 313 p. p. [Google Scholar]

[pone.0268205.ref018] 18.Kuivila KM, Hladik ML, Ingersoll CG, Kemble NE, Moran PW, Calhoun DL, et al. Occurrence and potential sources of pyrethroid insecticides in stream sediments from seven US metropolitan areas. Environmental science & technology. 2012;46(8):4297–303. [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref019] 19.McAllister J, Scott M, Control CfD, Prevention. CONUS manual for evaluating insecticide resistance in mosquitoes using the CDC bottle bioassay kit. CDC, Atlanta, GA. 2020.

[pone.0268205.ref020] 20.Petersen J. Measuring Insecticide Resistance by the Bottle Bioassay. Florida Mosquito Control Handbook. 2004:1–10. [Google Scholar]

[pone.0268205.ref021] 21.Saavedra-Rodriguez K, Urdaneta-Marquez L, Rajatileka S, Moulton M, Flores AE, Fernandez-Salas I, et al. A mutation in the voltage-gated sodium channel gene associated with pyrethroid resistance in Latin American Aedes aegypti. Insect Mol Biol. 2007;16(6):785–98. doi: 10.1111/j.1365-2583.2007.00774.x . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref022] 22.Valle D, Montella I, Ribeiro R, Viana-Medeiros P, Martins Jr A, Lima J. Quantification methodology for enzyme activity related to insecticide resistance in Aedes aegypti. Fundação Oswaldo Cruz and Secretaria de Vigilância em Saúde, Ministério da Saúde, Rio de Janeiro and Distrito Federal, Brazil. 2006.

[pone.0268205.ref023] 23.Brogdon WG, McAllister JC, Vulule J. Heme peroxidase activity measured in single mosquitoes identifies individuals expressing an elevated oxidase for insecticide resistance. J Am Mosq Control Assoc. 1997;13(3):233–7. . [PubMed] [Google Scholar]

[pone.0268205.ref024] 24.Hemingway J, Karunaratne SH. Mosquito carboxylesterases: a review of the molecular biology and biochemistry of a major insecticide resistance mechanism. Med Vet Entomol. 1998;12(1):1–12. doi: 10.1046/j.1365-2915.1998.00082.x . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref025] 25.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54. doi: 10.1006/abio.1976.9999 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref026] 26.R Core Team. R: A language and environment for statistical computing 2021 [cited Vienna, Austria]. Available from: https://www.R-project.org].

[pone.0268205.ref027] 27.Clifton ME, Xamplas CP, Nasci RS, Harbison J. Gravid Culex pipiens Exhibit A Reduced Susceptibility to Ultra-Low Volume Adult Control Treatments Under Field Conditions. J Am Mosq Control Assoc. 2019;35(4):267–78. doi: 10.2987/19-6848.1 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref028] 28.Harbison JE, Layden JE, Xamplas C, Zazra D, Henry M, Ruiz MO. Observed loss and ineffectiveness of mosquito larvicides applied to catch basins in the northern suburbs of chicago IL, 2014. Environ Health Insights. 2015;9:1–5. Epub 20150421. doi: 10.4137/EHI.S24311 ; PubMed Central PMCID: PMC4406279. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref029] 29.Harbison JE, Sinacore JM, Henry M, Xamplas C, Dugas LR, Ruiz MO. Identification of larvicide-resistant catch basins from three years of larvicide trials in a suburb of chicago, IL. Environ Health Insights. 2014;8(Suppl 2):1–7. Epub 20141013. doi: 10.4137/EHI.S16014 ; PubMed Central PMCID: PMC4216650. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref030] 30.Centers for Disease Control and Prevention (CDC). Average annual incidence of West Nile virus neuroinvasive disease reported to CDC by county, 1999–2020 2020. Available from: https://www.cdc.gov/westnile/statsmaps/cumMapsData.html#five].

[pone.0268205.ref031] 31.Bkhache M, Tmimi FZ, Charafeddine O, Faraj C, Failloux AB, Sarih M. First report of L1014F-kdr mutation in Culex pipiens complex from Morocco. Parasit Vectors. 2016;9(1):644. Epub 20161216. doi: 10.1186/s13071-016-1931-5 ; PubMed Central PMCID: PMC5159952. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref032] 32.Zhou L, Lawrence GG, Vineis JH, McAllister JC, Wirtz RA, Brogdon WG. Detection of broadly distributed sodium channel alleles characteristic of insect pyrethroid resistance in West Nile virus vector Culex pipiens complex mosquitoes in the United States. J Med Entomol. 2009;46(2):321–7. doi: 10.1603/033.046.0217 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref033] 33.Martinez-Torres D, Foster SP, Field LM, Devonshire AL, Williamson MS. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Mol Biol. 1999;8(3):339–46. doi: 10.1046/j.1365-2583.1999.83121.x . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref034] 34.Sun H, Tong KP, Kasai S, Scott JG. Overcoming super-knock down resistance (super-kdr) mediated resistance: multi-halogenated benzyl pyrethroids are more toxic to super-kdr than kdr house flies. Insect Mol Biol. 2016;25(2):126–37. Epub 20151222. doi: 10.1111/imb.12206 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref035] 35.Sun H, Kasai S, Scott JG. Two novel house fly Vssc mutations, D600N and T929I, give rise to new insecticide resistance alleles. Pestic Biochem Physiol. 2017;143:116–21. Epub 20170824. doi: 10.1016/j.pestbp.2017.08.013 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref036] 36.Lucas KJ, Bales RB, McCoy K, Weldon C. Oxidase, Esterase, and KDR-Associated Pyrethroid Resistance in Culex quinquefasciatus Field Collections of Collier County, Florida. J Am Mosq Control Assoc. 2020;36(1):22–32. doi: 10.2987/19-6850.1 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref037] 37.McAbee RD, Kang KD, Stanich MA, Christiansen JA, Wheelock CE, Inman AD, et al. Pyrethroid tolerance in Culex pipiens pipiens var molestus from Marin County, California. Pest Manag Sci. 2004;60(4):359–68. doi: 10.1002/ps.799 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref038] 38.Lee HJ, Longnecker M, Calkins TL, Renfro AD, Fredregill CL, Debboun M, et al. Detection of the Nav channel kdr-like mutation and modeling of factors affecting survivorship of Culex quinquefasciatus mosquitoes from six areas of Harris County (Houston), Texas, after permethrin field-cage tests. PLoS Negl Trop Dis. 2020;14(11):e0008860. Epub 20201119. doi: 10.1371/journal.pntd.0008860 ; PubMed Central PMCID: PMC7714350. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref039] 39.Sun Y-P, Johnson E. Synergistic and antagonistic actions of insecticide-synergist combinations and their mode of action. Journal of Agricultural and Food Chemistry. 1960;8(4):261–6. [Google Scholar]

[pone.0268205.ref040] 40.Khot AC, Bingham G, Field LM, Moores GD. A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Manag Sci. 2008;64(11):1139–42. doi: 10.1002/ps.1603 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref041] 41.Sarkar M, Bhattacharyya IK, Borkotoki A, Goswami D, Rabha B, Baruah I, et al. Insecticide resistance and detoxifying enzyme activity in the principal bancroftian filariasis vector, Culex quinquefasciatus, in northeastern India. Med Vet Entomol. 2009;23(2):122–31. doi: 10.1111/j.1365-2915.2009.00805.x . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref042] 42.Xu Q, Liu H, Zhang L, Liu N. Resistance in the mosquito, Culex quinquefasciatus, and possible mechanisms for resistance. Pest Manag Sci. 2005;61(11):1096–102. doi: 10.1002/ps.1090 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref043] 43.Gong Y, Li T, Zhang L, Gao X, Liu N. Permethrin induction of multiple cytochrome P450 genes in insecticide resistant mosquitoes, Culex quinquefasciatus. Int J Biol Sci. 2013;9(9):863–71. Epub 20130905. doi: 10.7150/ijbs.6744 ; PubMed Central PMCID: PMC3805894. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0268205.ref044] 44.Kasai S, Scott JG. Overexpression of cytochrome P450 CYP6D1 is associated with monooxygenase-mediated pyrethroid resistance in house flies from Georgia. Pesticide Biochemistry and Physiology. 2000;68(1):34–41. [Google Scholar]

[pone.0268205.ref045] 45.Ahmed MA, Vogel CF. Synergistic action of octopamine receptor agonists on the activity of selected novel insecticides for control of dengue vector Aedes aegypti (Diptera: Culicidae) mosquito. Pestic Biochem Physiol. 2015;120:51–6. Epub 20150122. doi: 10.1016/j.pestbp.2015.01.014 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref046] 46.Estep AS, Sanscrainte ND, Waits CM, Louton JE, Becnel JJ. Resistance Status and Resistance Mechanisms in a Strain of Aedes aegypti (Diptera: Culicidae) From Puerto Rico. J Med Entomol. 2017;54(6):1643–8. Epub 2017/10/06. doi: 10.1093/jme/tjx143 . [DOI] [PubMed] [Google Scholar]

[pone.0268205.ref047] 47.Zar JH. Biostatistical analysis. 5th ed. Upper Saddle River, N.J.: Prentice-Hall/Pearson; 2010. xiii, 944 p. p. [Google Scholar]

PERMALINK

Assessing pyrethroid resistance status in the Culex pipiens complex (Diptera: Culicidae) from the northwest suburbs of Chicago, Illinois using Cox regression of bottle bioassays and other detection tools

Edwin R Burgess IV

Kristina Lopez

Patrick Irwin

Collin P Jaeger

Alden S Estep

Roles

Abstract

Introduction

Methods

Mosquito sources and pyrethroid exposure histories

Fig 1. Trapping locations of the seven strains tested.

Table 1. Sampling collection and analysis information.

Bottle bioassays

Genotyping for knockdown resistance alleles

Table 2. Primers and genomic locations for Cx. pipiens kdr 1014 melt curve assay.

Fig 2. Cx. pipiens kdr 1014 melt curve assay analysis.

Enzyme activity assays

Statistical analyses

Results

Bottle bioassays

Fig 3. Proportion mortality/survival of Arlington Heights catch basin (AHB) adult Culex pipiens complex in CDC bottle bioassays, with either Sumithrin or Anvil, after 120 minutes of continuous exposure.

Fig 4. Proportion mortality/survival of Wheeling (WHE) adult Culex pipiens complex in CDC bottle bioassays, with either Sumithrin, AnvilTM, or Anvil, after 120 minutes of continuous exposure.

Fig 5. Proportion mortality/survival of Des Plaines North (DPN) adult Culex pipiens complex in CDC bottle bioassays, with either Sumithrin or Anvil, after 120 minutes of continuous exposure.

Genotyping for knockdown resistance alleles

Table 4. Percent genotype and allele frequency of the leucine-to-phenylalanine (L1014F) knockdown resistance mutation in the voltage-sensitive sodium channel of adult female Culex pipiens complex from some Northwest suburbs of Chicago, Illinois.

Enzyme activity assays

Fig 6. Distributions of specific activities for mixed-function oxidase (MFO), glutathione S-transferase (GST), alpha-carboxylesterase (α-CarE), and beta-carboxylesterase (β-CarE) in female Culex pipiens complex from four different trapping locations in some Northwest suburbs of Chicago, Illinois.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Ahmed Ibrahim Hasaballah

Roles

Author response to Decision Letter 0

Decision Letter 1

Ahmed Ibrahim Hasaballah

Roles

Acceptance letter

Ahmed Ibrahim Hasaballah

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases