Organic zinc glycine chelate is better than inorganic zinc in improving growth performance of cherry valley ducks by regulating intestinal morphology, barrier function, and the gut microbiome

Abstract

Zinc (Zn) is an essential trace element that has physiological and nutritional functions. However, excessive use of Zn can lead to waste of resources. In this study, we compared the effects of inorganic (ZnSO₄) and organic Zn glycine chelate (Zn-Gly) on the growth performance, intestinal morphology, immune function, barrier integrity, and gut microbiome of Cherry Valley ducks. We randomly divided 180 one-day-old male meat ducks into three groups, each with six replicates of 10 birds: basal diet group (CON), basal diet with 70 mg Zn/kg from ZnSO₄ (ZnSO₄ group), and basal diet with 70 mg Zn/kg from Zn-Gly (Zn-Gly group). After 14 and 35 d of feeding, birds in the Zn groups had significantly increased body weight and average daily gain (ADG), decreased intestinal permeability indicator d-lactate, improved intestinal morphology and barrier function-related tight junction protein levels, and upregulated mucin 2 and secretory immunoglobulin A levels compared to the control (P < 0.05). Additionally, compared to the ZnSO₄ group, we found that supplementation with Zn-Gly at 70 mg/kg Zn resulted in the significant increase of body weight at 35 d, 1 to 35 d ADG and average daily feed intake, villus height at 14 and 35 d, secretory immunoglobulin A and immunoglobulin G at 14 d, and mucin 2 mRNA level at 14 d (P < 0.05). Compared with the control group, dietary Zn had a significant effect on the gene expression of metallothionein at 14 and 35 d (P < 0.05). 16S rRNA sequencing showed that Zn significantly increased alpha diversity (P < 0.05), whereas no differences in beta diversity were observed among groups (P > 0.05). Dietary Zn significantly altered the cecal microbiota composition by increasing the abundances of Firmicutes, Blautia, Lactobacillus, Prevotellaceae NK3B31, and [Ruminococcus] torques group and reducing that of Bacteroides (P < 0.05). Spearman correlation analysis revealed that the changes in microbiota were highly correlated (P < 0.05) with growth performance, intestinal morphology, and immune function-related parameters. Taken together, our data show that, under the condition of adding 70 mg/kg Zn, supplementation with Zn-Gly promoted growth performance by regulating intestinal morphology, immune function, barrier integrity, and gut microbiota of Cherry Valley ducks compared with the use of ZnSO₄ in feed.

This study shows that zinc glycine chelate supplementation at 70 mg/kg zinc could significantly improve the growth performance by providing positive changes in intestinal morphology, intestinal barrier function, and the gut microbiome compared to the use of zinc sulfate at 70 mg/kg zinc.

Introduction

Since the early 2000s, poultry has become a mainstream meat source worldwide. However, duck farming faces many challenges, including the intensive breeding mode and pathogenic microorganisms and mycotoxins in duck feed, which can have serious negative effects on gut homeostasis and growth performance. Thus, understanding how intestinal barrier function is regulated in ducks is important for improving growth performance.

Zinc (Zn) is an essential trace element that has physiological and nutritional functions in poultry, including maintaining growth (Macdonald, 2000), immunity (Jarosz et al., 2017), reproduction (Chen et al., 2017), and intestinal development (Xie et al., 2021) and regulating appetite and antioxidant ability (Chang et al., 2021a). Hence, it is important to improve the efficiency of Zn absorption in poultry.

Two forms of Zn (inorganic and organic) are used in the feed industry. Inorganic Zn, such as Zn sulfate (ZnSO₄), is cheaper than organic Zn, but organic Zn is more easily absorbed, which means that lower concentrations of organic Zn added to the diet can provide the required amounts of this trace element (Chang et al., 2021a). Previous studies showed that Zn glycine chelate (Zn-Gly) enhanced growth performance by improving carcass characteristics (Kwiecień et al., 2016) and intestinal morphology and by alleviating liver injury (Zhang et al., 2019). In addition, Jarosz et al. (2017) demonstrated that Zn-Gly contributed to modulating intestinal immunoglobulin (Ig) gene expression, which may alleviate intestinal inflammation.

As the largest immune organ, the gut is at the forefront of the body’s defense, and it has evolved a complete defense mechanism. The intestinal barrier consists of epithelial cells, intestinal mucus, immune components, and gut microbes (Abraham et al., 2022). Goblet cells spread across the intestinal epithelium monolayer and produce mucus, and plasma cells within the lamina propria secrete dimer IgA, which may play an immune role in the intestine. A single layer of intestinal epithelial cells participates in the maintenance of fundamental functions (Odenwald and Turner, 2017). Additionally, the microbiome is becoming recognized as an essential component of intestinal immune regulation.

Numerous studies have focused on how Zn sources with different bioavailability affect poultry, but little is known about the effects of different dietary Zn sources on growth performance, intestinal morphology, and intestinal barrier function of meat ducks. Therefore, we investigated the effects of ZnSO₄ and Zn-Gly on gut homeostasis of Cherry Valley ducks by assessing changes in physical and chemical barriers, modulation of intestinal immune responses, and alterations in microbiota diversity and composition that improve gut health.

Materials and Methods

Ethics statement

Animals, diets, and sampling procedures were approved by the Animal Welfare Committee of Sichuan Agricultural University (No. 20,180,718), Sichuan, China.

Animals, diets, and experimental design

One hundred and eighty 1-d-old male Cherry Valley ducks (Sichuan Mianying Breeding Duck Co., Ltd., Mianyang, China) were selected and randomly allocated into three dietary treatments, with six pens/treatment and 10 birds/pen. The three treatments were a basal diet without Zn (CON) and the basal diet with 70 mg Zn/kg from 202 mg/kg ZnSO₄ or 338 mg/kg Zn-Gly. The 70 mg/kg Zn dose was selected based on our previous study (Chang et al., 2021b). Specifically, we used the growth performance indicators to apply the quadratic regression mathematical model and found that 70 mg/kg Zn was the optimal dosage. Diets were formulated according to the NRC Poultry 1994 recommendation. The feed composition, nutrient levels, and the measured values of Zn in diets are shown in Tables 1 and 2, respectively. The addition of Zn-Gly resulted in a different content of glycine in the feed, and we corrected for it in the control and ZnSO₄ groups by adding 263 mg/kg glycine in the premixes. Bird and feed weights were recorded on days 14 and 35 for calculation of body weight (BW), average daily gain (ADG), average daily feed intake (ADFI), and feed to gain ratio (F/G). All birds were feed in a room with suitable temperature and humidity. The purity of Zn-Gly was 98.5%, and it contained 21% Zn (Chelota Group, Guanghan, China).

Table 1.

Ingredients and compositions of the basic diets (%, dry matter)

Item	1 to 14 d	15 to 35 d
Ingredients, %
Corn	62.63	70
Soybean meal	28.3	23.12
Expanded soybean	5	3
Calcium carbonate	0.90	1
Dicalcium phosphate	1.9	1.86
NaCl	0.34	0.34
Choline chloride	0.15	0.15
Vitamin premix1	0.03	0.03
Mineral premix2	0.30	0.30
dl-Methionine	0.220	0.118
l-Lysine HCl	0.121	0.065
l-Threonine	0.072	0.017
l-Tryptophan	0.037	0
Total	100.00	100.00
Calculated nutrients, %
Metabolizable energy, MJ/kg	12.32	12.35
Crude protein, %	20.06	17.52
Calcium, %	0.91	0.917
Nonphytate phosphorus, %	0.429	0.418
Digestible lysine, %	1.02	0.82
Digestible methionine, %	0.50	0.37
Zn, mg/kg	28.39	26.72

¹Provided per kilogram of diet: vitamin A, 6,875 IU; vitamin D3, 1,640 IU; vitamin E, 30.01 mg; thiamin, 1 mg; riboflavin, 3.9 mg; pyridoxine, 3.375 mg; vitamin B12, 0.01 mg; calcium pantothenate, 8.85 mg; folate, 0.5 mg; biotin, 0.1 mg; niacin, 49.25 mg.

²Provided per kilogram of diet: Cu (CuSO₄ ∙ 5H₂O), 8 mg; Fe (FeSO₄ ∙ 7H₂O), 80 mg; Mn (MnSO₄ ∙ H₂O), 70 mg; Se (NaSeO₃), 0.3 mg; I (KI), 0.4 mg.

Table 2.

Analyzed Zn¹ content of diets² fed to ducks (as-feed basis)

Items (mg/kg)	Starter (days 1 to 14)	Grower (days 15 to 35)
CON group	29.08 ± 1.16	27.03 ± 0.81
ZnSO4 group	98.35 ± 0.91	97.56 ± 1.12
Zn-Gly group	99.32 ± 0.96	97.39 ± 0.88

¹Values are based on chemical analysis of triplicate samples of diets.

²Dietary treatments were as follow: (1) control group (CON): basal diet; (2) ZnSO₄: CON + 70 mg Zn/kg from ZnSO₄; (3) Zn-Gly: CON + 70 mg Zn/kg from Zn-Gly.

Sample collection

After 14 and 35 d of feeding, one duck with weight closest to the pen average weight was selected, anesthetized with sodium pentobarbital, and slaughtered via exsanguination. Blood samples were collected and separated by centrifugation at 3,500 rpm at 4 °C for 20 min, and the serum samples were stored at −20 °C until used for analysis. Part of the jejunum was collected from each duck and fixed in 4% paraformaldehyde. Another part of the jejunum was dissected from the mid-jejunum, opened lengthwise, and gently flushed twice with physiological saline, and the cecal chyme of ducks on day 35 was aseptically sampled. All samples were stored at −80 °C.

Measurements

Zinc concentration

We assessed the Zn concentration of the diets according to our previous study (Chang et al., 2021b). First, a 0.5-g feed sample was weighed into a digestive tube, to which 10 mL of concentrated nitric acid were added, and the mixture was allowed to soak for 2 h. After digestion for about 90 min on a microwave digestion instrument, the Zn content in the feed was measured using a ContrAA-700 high-resolution continuum source atomic absorption spectrometer equipped with flame (HR-CS FAAS, Analytik Jena, Germany) at 213.857 nm wavelength.

Morphological analysis

After fixation in 4% paraformaldehyde, the jejunum samples were dehydrated using serial dilutions (70% to 95%) of alcohol, embedded in paraffin, sliced into sections, placed on slides, and stained with hematoxylin and eosin (H&E). Goblet cells of the jejunum were stained with periodic acid-Schiff (PAS) stain. The villus height, crypt depth, and the number of PAS⁺ cells in the jejunum were measured and analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA). Three regions were measured per duck and the mean was calculated (Liang et al., 2022).

Intestinal permeability analysis

Serum d-lactic acid (d-LA) content, which is an indicator of intestinal permeability, was measured by an enzyme-linked immunosorbent assay (ELISA) (Jiangsu Meimian Industrial Co., Ltd, Jiangsu, China).

Concentration of mucin 2 and Igs in the jejunum

The concentrations of Ig, IgG, secretory IgA (sIgA), and mucin 2 (MUC2) in the jejunum were measured using ELISA kits (Jiangsu Meimian Industrial Co., Ltd).

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

The expression of tight junction (TJ) protein genes [claudin1 (CLDN-1), CLDN-2, occluding (OCLN), zonula occludens-1 (ZO-1), zonula occludens-2 (ZO-2), and junctional adhesion molecule 3 (JAM-3)], genes associated with chemical barriers [MUC2 and trefoil factor 2 (TFF2)], and immune barrier-related genes [IgA and lysozyme (LYZ)] in the jejunum were analyzed using qRT-PCR according to Wen et al. (Wen et al., 2018). Expression levels of ZIP (SLC39) family- and ZnT (SLC30) family-related genes were also measured. Table 3 shows the sequence, product length, and accession number of the primers used in this analysis. The gene expression levels were calculated based on the 2^−ΔΔCt method (Livak and Schmittgen, 2001).

Table 3.

Primer sequences for qRT-PCR

Gene	Primer sequence (5ʹ—3ʹ)	Size (bp)	Accession No.
ZO-1	Forward: ACGCTGGTGAAATCAAGGAAGAA Reverse: AGGGACATTCAACAGCGTGGC	255	XM_013093747.1
ZO-2	Forward: ACAGTGAAAGAAGCTGGCGTAG Reverse: GCTGTATTCCCTGCTACGGTC	131	XM_005019888.2
OCLN	Forward: CAGGATGTGGCAGAGGAATACAA Reverse: CCTTGTCGTAGTCGCTCACCAT	160	XM 013109403.1
CLDN-1	Forward: TCATGGTATGGCAACAGAGTGG Reverse: CGGGTGGGTGGATAGGAAGT	179	XM_013108556.1
CLDN-2	Forward: CTCCTCCTTGTTCACCCTCATC Reverse: GAACTCGCTCTTGGGTTTGTG	160	XM_005009661.2
JAM3	Forward: TGCATAGCAACAAACGACGC Reverse: GTAGCCCCTTCTGTAGGCAC	159	XM_027444289.2
MUC2	Forward: GGGCGCTCAATTCAACATAAGTA Reverse: TAAACTGATGGCTTCTTATGCGG	150	XM_005024513.2
TFF2	Forward: CTGTCATCCTTGTTGTAGCCCTCA Reverse: GATTCCTGGGTGACCACAGTTCTT	113	XM_005030468.2
IgA	Forward: TCGCTCAAGGAACCCATCGT Reverse: GCGGGACCACGAGAACTTCA	174	U27222.1
LYZ	Forward: TAACACGCAGGCTACAAACCG Reverse: TTCCATCGCTGACAATCCTCTT	194	XM_005008880.2
MT1	Forward: GACTCCCAGGACTGCCCTT Reverse: ACGACGTGCATTTGCAGTTT	85	XM_027466320.2
ZIP3	Forward: CGCCCTCTGCAATTCCTTCG Reverse: TCTCAGCCACCGGGTAGTCC	134	XM_027471837.2
ZIP6	Forward: CAAGTCGGTTGCTCGGTTAG Reverse: GTCAACAGAGCCTGAGTGCC	231	XM_013107243.4
ZIP8	Forward: ACACAAACCACCATCATCCAG Reverse: TGGGTTACTTCCTCCTGTGC	123	XM_038177855.1
ZIP9	Forward: AGTGAGTGAGATGCAGCACG Reverse: AGGACAAGGGAAACACCAAT	117	XM_027457903.2
ZIP10	Forward: GCGACGGCTTAGCAATAGGA Reverse: GACCGCAAAGATCCACAAGG	251	XM_038182345.1
ZIP12	Forward: GCTGATGGCTTGGTAATAGG Reverse: ATGGGTCAGTTGAAACAGAAA	223	XM_013093603.4
ZIP14	Forward: AGGAGTTCCCGCACGAGTTG Reverse: ACGATGCCGAAAGCCAAGC	127	XM_038166959.1
ZnT1	Forward: TGGAGATGCCTTAGGTTCGG Reverse: GTGGTTATTGACGCAGGGATTA	112	XM_027453027.2
ZnT4	Forward: GTGGATCGCATTAAGGAAGACT Reverse: CCTTGAACTGAACTTCCTCCC	157	XM_005019478.4
ZnT6	Forward: ACTCCAGACAACTCCACCTCAT Reverse: CAATGCGTATAATCGGTTAGTGA	208	XM_027453882.2
ZnT7	Forward: ATAGGCGTAAGCATTGTTCCAC Reverse: GCTACCAGTAATTTCAAAGTCCCT	197	XM_027462589.2
ZnT9	Forward: TTCCTCAAAGACCCAATCCA Reverse: TGCCTCTACATCCGACCTCA	219	XM_038178939.1
ZnT10	Forward: AGATGGCACAAGGCAAACAC Reverse: CGATCCCAACAATGAGGACA	172	XM_013105385.4
β-actin	Forward: AGAAATTGTGCGTGACATCAA Reverse: GGACTCCATACCCAAGAAAGAT	227	XM_013108556.1

ZO-1, zonula occludens-1; ZO-2, zonula occludens-2; OCLN, occluding; CLDN1, claudin 1; CLDN2, claudin 2; JAM3, junctional adhesion molecule 3; MUC2, mucin 2; TFF2, trefoil factor 2; IgA, immunoglobulin A; LYZ, lysozyme; MT1, metallothionein; ZIP3, zinc transporter SLC39A3; ZIP6, zinc transporter SLC39A6; ZIP8, zinc transporter SLC39A8; ZIP9, zinc transporter SLC39A9; ZIP10, zinc transporter SLC39A10; ZIP12, zinc transporter SLC39A12; ZIP14, zinc transporter SLC39A14; ZnT1, zinc transporter SLC30A1; ZnT4, zinc transporter SLC30A4; ZnT6, zinc transporter SLC30A6; ZnT7, zinc transporter SLC30A7; ZnT9, zinc transporter SLC30A9; ZnT10, zinc transporter SLC30A10.

Gut microbial community analysis

The cecal chyme samples were sent to Shanghai Applied Protein Technology (Shanghai, China) for analysis of the gut microbial community. Briefly, the total DNA from duck cecal contents was extracted using the QIAamp PowerFecal Pro DNA Kit (Qiagen, Hilden, Germany) and purified. The hypervariable region primers of the V3 to V4 region of 16S rDNA were amplified by PCR (Zhang et al., 2020). Alpha diversity indices (Chao1, ACE, Shannon, and Simpson) were calculated using QIIME2 v.2018.6 (https://Qiime2.org) (Caporaso et al., 2010). Beta diversity was analyzed based on weighted Unifrac distance and visualized using principal co-ordinates analysis (PCoA). Linear discriminant analysis (LDA) effect size (LEfSe) analysis (Segata et al., 2011) was used to identify biomarkers of microbial taxa based on an LDA score > 2.0.

Statistical analysis

Data were analyzed using one-way analysis of variance with Tukey’s multiple comparisons test in SPSS 24.0 for Windows (IBM, Armonk, NY, USA). Data are presented as the mean ± SEM. Correlation analysis was conducted for significant gut microbes at the genus level, growth performance (BW, ADG, ADFI, and F/G), gut permeability (d-LA), intestinal morphology, and immune parameters, which were analyzed using SPSS 24.0 to calculate the correlation coefficients based on Spearman’s correlation distance. Figures were prepared using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). In the analysis, P-values < 0.05 were considered to be significantly different.

Results

Growth performance

Table 4 shows the impact of different Zn sources on growth performance of meat ducks. There was no significant difference (P = 0.688) in the initial average BW of meat ducks among the three groups. Compared with the CON group, the BW of the Zn-Gly group was significantly higher at both 14 and 35 d (P < 0.05), while the BW of the ZnSO₄ group was significantly higher only at 35 d (P < 0.05). The ADG for days 1 to 14, 15 to 35, and 1 to 35 d was greater in the Zn-Gly group compared to the control (P < 0.05), as was the ADFI of the grower phase (15 to 35 d) and the entire phase (1 to 35 d). Compared with the CON group, both the ZnSO₄ and Zn-Gly groups exhibited a significantly lower (P < 0.05) F/G during the 1 to 14 d period. Compared with the ZnSO₄ group, the BW of the Zn-Gly ducks was significantly higher (P < 0.05) on day 35, and the ADG and ADFI values were greater (P < 0.05) during the 15 to 35 d period. However, there were no differences (P > 0.05) in F/G during the periods of 15 to 35 and 1 to 35 d.

Table 4.

Effects of Zn sources on growth performance of meat ducks

Items	Dietary treatment1			P-value
	CON	ZnSO4	Zn-Gly
BW, g
1 d	55.94 ± 0.21	56.17 ± 0.19	56.15 ± 0.22	0.688
14 d	743.96 ± 11.16b	793.33 ± 13.22a	819.58 ± 8.50a	<0.001
35 d	2,523.33 ± 42.78b	2,643.33 ± 40.87b	2,827.26 ± 45.13a	<0.001
ADG, g
1 to 14 d	49.14 ± 0.79b	52.66 ± 0.94a	54.53 ± 0.61a	<0.001
15 to 35 d	79.67 ± 1.92b	82.70 ± 1.69b	89.96 ± 2.31a	0.008
1 to 35 d	71.87 ± 1.22b	75.29 ± 1.17b	80.55 ± 1.29a	<0.001
ADFI, g
1 to 14 d	72.69 ± 1.60	71.72 ± 1.04	74.98 ± 0.78	0.174
15 to 35 d	162.56 ± 2.50b	170.52 ± 2.17b	179.59 ± 2.55a	<0.001
1 to 35 d	139.37 ± 2.37b	145.73 ± 1.89a	151.00 ± 3.29a	0.021
F/G, (g/g)
1 to 14 d	1.48 ± 0.04a	1.36 ± 0.03b	1.38 ± 0.02b	0.014
15 to 35 d	2.04 ± 0.03	2.06 ± 0.04	1.98 ± 0.04	0.283
1 to 35 d	1.94 ± 0.01	1.94 ± 0.01	1.91 ± 0.02	0.304

¹Dietary treatments were as follow: (1) control group (CON): basal diet; (2) ZnSO₄ group (ZnSO₄): CON + 70 mg Zn/kg form Zn-Gly; (3) Zn-Gly group (Zn-Gly): CON + 70 mg Zn/kg from Zn-Gly.

^a,bMeans in the same row with different superscripts differ significantly (P < 0.05).

Data represent mean values of six ducks per treatment.

BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed to gain ratio.

Intestinal morphology and goblet cell count

Figure 1 shows results of H&E staining of jejunum samples from meat ducks on days 14 and 35 of the feeding experiment. Compared to the CON group, the tissues from the Zn-Gly group on day 14 had significantly higher (P < 0.05) villus height, lower (P < 0.05) crypt depth, and improved (P < 0.05) villus height/crypt depth in (Figure 1A and B). At day 35, the villus height of the jejunum was higher in the Zn-Gly group compared to the CON and ZnSO₄ groups (Figure 1C and D). The number of goblet cells stained with PAS staining in the villus increased after the ducks consumed feed containing Zn-Gly (Figure 1E and F). No differences (P > 0.05) in crypt depth and villus height/crypt depth among the groups were detected on day 35 (Figure 1D).

Figure 1.

Effects of Zn sources on intestinal morphology and goblet cells of meat ducks visualized by H&E and PAS staining. (A) The jejunum on day 14, 40×. (B) Villus length and crypt depth were calculated for each group on day 14. (C) Structure of the jejunum on day 14, 40×. (D) Villus length and crypt depth were calculated for each group on day 35. (E) Number of goblet cells per villus of the jejunum on day 35. (F) Quantification of goblet cells based on PAS-stained sections. Data are means ± SEM (n = 6). * P < 0.05. H&E, hematoxylin and eosin; PAS, periodic acid-Schiff.

Intestinal permeability, and MUC2 and Ig contents in the jejunum

Compared with ducks in the CON group, birds in both the Zn-Gly and ZnSO₄ groups had lower (P < 0.05) plasma d-LA levels (Table 5). No significant difference (P > 0.05) was observed in plasma d-LA level between the ZnSO₄ and Zn-Gly groups.

Table 5.

Effects of Zn sources on the content of d-LA in plasma, the content of MUC2 and Igs in the jejunum of meat ducks

Items	Dietary treatment1			P-value
	CON	ZnSO4	Zn-Gly
14 d
MUC2, μg/mg prot	19.48 ± 0.25b	19.75 ± 0.20b	20.58 ± 0.16a	0.007
sIgA, μg/mg prot	18.97 ± 0.10c	20.66 ± 0.42b	24.10 ± 0.49a	<0.0001
IgG, μg/mg prot	84.04 ± 3.23c	104.83 ± 1.83b	113.00 ± 3.23a	<0.0001
35 d
MUC2, μg/mg prot	20.94 ± 0.12	20.00 ± 0.30	20.10 ± 0.54	0.176
sIgA, μg/mg prot	19.98 ± 0.26b	21.61 ± 0.36a	21.30 ± 0.37a	0.011
IgG, μg/mg prot	95.52 ± 2.37b	99.65 ± 1.66ab	103.92 ± 1.11a	0.02
d-LA, μg/L	506.80 ± 9.61a	467.63 ± 7.31b	460.35 ± 7.82b	0.004

¹Dietary treatments were as follow: (1) control group (CON): basal diet; (2) ZnSO₄ group (ZnSO₄): CON + 70 mg Zn/kg form Zn-Gly; (3) Zn-Gly group (Zn-Gly): CON + 70 mg Zn/kg from Zn-Gly.

^a,b,cMeans in the same row with different superscripts differ significantly (P < 0.05).

Data represent mean values of six ducks per treatment.

As shown in Table 5, compared with the CON group, the Zn-Gly group contained significantly more (P < 0.05) MUC2 in the jejunum on day 14, but no significant difference (P > 0.05) was detected on day 35. Both the ZnSO₄ and Zn-Gly groups had a significantly higher (P < 0.05) sIgA content on days 14 and 35 compared to the CON group, and on day 14 the value was significantly higher (P < 0.05) in the Zn-Gly group compared to the ZnSO₄ group. However, the sIgA content did not differ between the two Zn groups (P > 0.05) on day 35. The ZnSO₄ and Zn-Gly groups had a significantly higher (P < 0.05) IgG content on day 14 compared to the CON group, and the content was significantly higher (P < 0.05) in the Zn-Gly group compared to the ZnSO₄ group. However, no significant difference (P > 0.05) in IgG content was detected among the CON, ZnSO₄, and Zn-Gly groups on day 35.

mRNA expression of intestinal barrier-related genes in the jejunum

Physical barrier function

qRT-PCR was used to investigate the expression of TJ protein genes in the intestinal epithelium. Compared to the control, jejunum samples from the ZnSO₄ and Zn-Gly groups had higher (P < 0.05) expression of ZO-1 and ZO-2 but decreased CLDIN-2 expression on day 14 (Figure 2A, B, and E), whereas no significant changes (P > 0.05) in the expression of OCLD, CLDIN-1, or JAM3 were detected (Figure 2C, D, and F). A significant increase (P < 0.05) of the expression of ZO-1 and ZO-2 and a significant decrease (P < 0.05) of CLDIN-2 mRNA levels were detected on day 35 (Figure 2G, H, and K). However, no significant differences (P > 0.05) were observed in the expression of OCLD, CLDIN-1, and JAM3 in jejunum samples collected on day 35 (Figure 2I, J, and L). These results indicate that dietary Zn improved the physical structure of the intestinal barrier.

Figure 2.

Effects of Zn sources on the physical barrier-related gene expression in the jejunum of meat ducks. Data are means ± SEM (n = 6). * P < 0.05. ZO-1, zonula occludens-1; ZO-2, zonula occludens-2; OCLN, occludin; CLDN1, claudin 1; CLDN2, claudin 2; JAM3, junctional adhesion molecule 3.

Chemical barrier function

Figure 3 shows the expression levels of chemical barrier-related genes in the jejunum samples from the three groups of ducks. Compared with the CON group, the mRNA expression of MUC2 was upregulated (P < 0.05) by both Zn treatments on days 14 and 35, and no effect (P > 0.05) on the expression of TFF2 at was detected on day 14. However, compared with the CON group, the Zn-Gly group had significantly higher (P < 0.05) mRNA levels of TFF2 in the jejunum on day 35. Collectively, these results show that dietary Zn facilitated the intestinal chemical barrier function of Cherry Valley ducks.

Figure 3.

Effects of Zn sources on the chemical and immune barrier-related gene expression in the jejunum of meat ducks. Data are means ± SEM (n = 6). * P < 0.05. MUC2, mucin 2; TFF2, trefoil factor 2; IgA, immunoglobulin A; LYZ, lysozyme.

Immune barrier function

Compared with the CON group, expression of the immune barrier-related gene IgA was markedly higher (P < 0.05) in the jejunum of ducks in the Zn-Gly group on days 14 and 35, while there were no significant differences (P > 0.05) between the CON and ZnSO₄ groups (Figure 3A and B). The expression level of LYZ did not differ significantly (P > 0.05) among the groups at either 14 or 35 d.

Expression of Zn transport-related genes

It is well known that Zn homeostasis is mainly controlled by 24 Zn transporters and 4 metallothioneins (MTs), which play a coordinating role in Zn distribution, transport, and maintenance. MT is thought to play a central role in maintaining Zn homeostasis by transporting Zn through the cell and releasing it into proteins that require Zn. Figure 4 shows the mRNA expression of jejunal Zn transporters of meat ducks fed dietary Zn-Gly or ZnSO₄. Compared with the CON group, both Zn sources had a significant upregulation effect on the gene expression of MT on days 14 and 35 (P < 0.05), whereas there were no differences for ZnTs and ZIPs among the groups (P > 0.05).

Figure 4.

Effects of Zn sources on the expression of zinc transport-related genes in the jejunum of meat ducks. Data are means ± SEM (n = 6). * P < 0.05. MT1, metallothionein; ZIP3, zinc transporter SLC39A3; ZIP6, zinc transporter SLC39A6; ZIP8, zinc transporter SLC39A8; ZIP9, zinc transporter SLC39A9; ZIP10, zinc transporter SLC39A10; ZIP12, zinc transporter SLC39A12; ZIP14, zinc transporter SLC39A14; ZnT1, zinc transporter SLC30A1; ZnT4, zinc transporter SLC30A4; ZnT6, zinc transporter SLC30A6; ZnT7, zinc transporter SLC30A7; ZnT9, zinc transporter SLC30A9; ZnT10, zinc transporter SLC30A10.

Intestinal microflora of Cherry Valley ducks

Microbial diversity in response to dietary Zn treatment

The cecal microbial community in ducks from the ZnSO₄ and Zn-Gly groups exhibited significantly increased ­species ­richness and evenness (P < 0.05) compared to the CON group (Figure 5A to D) as indicated by the Shannon, Simpson, ACE, and Chao1 index values. The values of these indices did not differ significantly (P > 0.05) between the ZnSO₄ and Zn-Gly groups on day 35 (Figure 5A to D).

Figure 5.

Effects of Zn sources on alpha diversity of cecal flora of meat ducks on day 35. (A) Shannon index. (B) Simpson index. (C) ACE index. (D) Chao1 index. * P < 0.05.

In contrast, no significant difference (P > 0.05) in the β diversity of the cecal microbiota was detected among the groups on day 35 (Figure 6A). The lack of significant separation among groups in the PCoA diagrams indicated no significant difference (P > 0.05) in the β diversity of cecal microflora in meat ducks with fed a Zn-supplemented diet (Figure 6B).

Figure 6.

Effects of Zn sources on beta diversity of cecal flora of meat ducks on day 35. (A) Box plot of differences in beta diversity between groups. (B) PCoA of cecal flora. * P < 0.05. PCoA, principal co-ordinates analysis.

Structural composition of cecal microflora and their modulation by Zn treatment

Figure 7 shows the 10 most abundant phyla and 30 most abundant genera in the intestinal flora of the meat ducks in each group. Firmicutes and Bacteroidetes were the first and second most dominant phyla, respectively. Analysis of the differences in the composition of the intestinal flora at the phylum level among the different treatments revealed that Zn-Gly significantly increased (P < 0.05) the relative abundance of Firmicutes but decreased (P < 0.05) that of Bacteroidetes compared with the CON group (Figure 8B and C).

Figure 7.

Microbiome compositions at the (A) phylum and (B) genus levels for 16S rRNA sequences in cecal digesta of ducks fed the control diet or diets with Zn from different sources. * P < 0.05.

Figure 8.

Relative abundances of the predominant phyla in the two dietary Zn groups. (A) Heat map of relative abundance of phyla. (B) Average abundance of predominant phyla in the groups. * P < 0.05.

Heat maps show the bacterial abundance at the phylum (Figure 8A) and genus (Figure 9A) levels after ZnSO₄ and Zn-Gly treatment. At the phylum level, the bacteria aggregated in the CON group were Verrucomicrobia, Actinobacteria, and Bacteroidetes; those aggregated in the ZnSO₄ group were Cyanobacteria, Epsilonbacteraeota, Proteobacteria, Patescibacteria, and Thaumarchaeota; and the bacteria aggregated in the Zn-Gly group were Tenericutes, Deferribacteres, and Firmicutes.

Figure 9.

Relative abundance of the predominant genera in the two dietary Zn groups. (A) Heat map of relative abundance of genera. (B) Average abundance of predominant genera in the groups. * P < 0.05.

At the genus level, the bacteria aggregated in the Zn-Gly group were more than those aggregated in the CON and ZnSO₄ groups. The relative abundance of Blautia was higher (P < 0.05) in the Zn-Gly group than that in the CON and ZnSO₄ groups, whereas that of Lactobacillus was higher (P < 0.05) in the ZnSO₄ group than that in the CON group. The average abundance of Prevotellaceae NK3B31 group and [Ruminococcus] torques group in the ZnSO₄ and Zn-Gly groups was significantly higher than that in the CON group (P < 0.05) (Figure 9B to E).

The phylogenetic clade maps based on LEfSe and LDA analyses of different species revealed the abundance and clade relationships of different species at different levels (Figure 10A). Species with an LDA score > 2.0 are shown in Figure 10B. The abundances of >30 bacterial species differed among the three treatments. LEfSe analysis revealed 7, 12, and 18 bacteria as potential biomarkers in the CON, ZnSO₄, and Zn-Gly groups, respectively, for a distinction among groups. In the CON group, the significantly different species were members of the Bacteroidales, Bacteroidia, and Bacteroidetes. The significantly different species in the ZnSO₄ group included members of the Prevotellaceae, Lactobacillus, and Alloprevotella, and those in the Zn-Gly group included members of the Firmicutes, Enterococcaceae, and Enterococcus.

Figure 10.

LEfSe analysis revealed the most abundant taxa in the CON, ZnSO₄, and Zn-Gly groups. (A) A taxonomic cladogram from the LEfSe analysis. (B) Red: CON group-enriched taxa; Green: ZnSO₄ group-enriched taxa; Blue: Zn-Gly group-enriched taxa. LEfSe, linear discriminant analysis (LDA) effect size

Correlation analysis

Pearson correlation analysis of the interactions between cecal microbiota and growth performance, intestinal morphology, intestinal permeability, and the content of sIgA in the jejunum revealed that the [Ruminococcus] torques group was significantly positively correlated (P < 0.05) with villus height of the jejunum on day 35 (Figure 11). Positive correlations (P < 0.05) between Lactobacillus and 15 to 35 d ADFI as well as day 35 sIgA and a negative correlation (P < 0.05) between d-LA and Prevotellaceae NK3B31 group were found.

Figure 11.

Correlations between predominant genera and growth performance, intestinal permeability, immune function, and intestinal morphology of meat ducks in the three groups. * P < 0.05.

Discussion

The gut is a vital organ that plays an important role in the barrier functions of the body (Martel et al., 2022). Mucins, TJ proteins, Igs, and microbiota of the intestine collaborate to ensure the intestinal and body health of animals (Makki et al., 2018). To date, little is known about the effects of different Zn sources on growth performance and intestinal health. Results of this study suggested that ZnSO₄ and Zn-Gly in the diet improved BW, ADG, and ADFI in Cherry Valley ducks, as indicated by the decreased F/G of ducks at 1 to 14 d during the feeding experiment. Similarly, Theros et al. (2022) reported that 120 mg/kg Zn improved growth performance of chicken. Hu et al. (2016) suggested that such results might be due to an increase in appetite, resulting in improved weight gain. Our data also showed that the positive changes in growth performance of the ducks could be because Zn-Gly supplementation can improve the Zn absorption through the intestinal wall (Yue et al., 2015).

Intestinal permeability is associated with increased gut leakage, which causes bacterial translocation in animals (Stewart et al., 2017). In the present study, the gut permeability, jejunal morphological parameters, and the number of goblet cell of meat ducks were measured. We found that feeding ducks a diet containing Zn-Gly considerably improved the villus height but decreased crypt depth of the jejunum on day 14. Additionally, the d-LA content in plasma was decreased by the supplementary Zn, regardless of the Zn source. Ma et al. (2011) also found that supplementing the diet of broilers with Zn-Gly increased the villus height of the jejunum, and Sun et al. (2020) reported that organic Zn supplementation alleviated Clostridium perfringens-induced changes in intestinal permeability. Li et al. (2015) showed that Zn could promote MUC2 production, which is strongly associated with goblet cells. In our study, the number of goblet cells in the villus increased after the ducks consumed feed containing Zn-Gly. Compared with the ZnSO₄ group, supplementation with 70 mg/kg Zn from Zn-Gly resulted in higher villus height on days 14 and 35 and higher d-LA content and number of goblet cells on day 35. Therefore, 70 mg/kg Zn from Zn-Gly helped maintain the intestinal morphology and decrease gut permeability.

Strong TJ structure maintains the integrity and permeability of the intestinal epithelium, which could maintain the intestinal barrier function of poultry. The ameliorated growth performance of birds observed in our study may be associated with the alterations of TJ proteins, mucins, gut immunity, and microbiota. We found that dietary Zn-Gly considerably increased ZO-1 and ZO-2 gene expression but decreased the expression of CLDIN-2. Pearce et al. (2015) also observed that Zn supplementation enhanced the expression of TJ-related proteins. MUC2 is the major macromolecular constituent of intestinal mucus, which is vital to the chemical barrier (Heazlewood et al., 2008). We found that dietary Zn-Gly facilitated intestinal chemical barrier function and that it was more effective than dietary ZnSO₄. Levkut et al. (2017) reported that MUC2 gene expression was substantially increased in chickens fed with Zn-Gly, and we also found that Zn-Gly increased the mRNA expression of MUC2 and the production of MUC2 in the jejunum of Cherry Valley Ducks.

In our study, dietary Zn also promoted the production of sIgA and IgG in the jejunum, and the expression of sIgA was significantly higher in the Zn-Gly group compared with the ZnSO₄ group on day 14. The expression of the immune barrier-related gene IgA was significantly higher in the Zn-Gly group compared to the control group, but this was not the case for the ZnSO₄ group. The improved IgA mRNA expression in the jejunum of the meat ducks in this study did not differ significantly between the two dietary Zn sources. In short, the two Zn sources used in this study can provoke mucosal immunity, but Zn-Gly supplementation could be an alternative to the same dosage use of ZnSO₄ in the feeds for improved intestinal immune barrier function of ducks.

The intestine is the site of excretion and absorption of Zn. Members of two families of Zn transporter protein, the ZIP (SLC39) family and the ZnT (SLC30) family, play a coordinating role in Zn distribution, transport, and maintenance. ZnT transporters promote extracellular Zn efflux or isolation of Zn in organelles. In contrast, ZIP transporters promote the flow of Zn into the cytoplasm either outside the cell or inside the organelle (Gammoh and Rink, 2017; Wessels et al., 2017). Additionally, Zn is distributed among specific Zn storage vesicles, the nucleus, the cytoplasm, and other organelles (Beyersmann and Haase, 2001). In the cytoplasm, Zn mainly binds to MTs, which play an important role in Zn homeostasis by complexing about 20% of the intracellular Zn. Therefore, the expression of MT in the jejunum can reflect the ability to absorb and transport Zn. In our study, ducks fed the diet supplemented with Zn-Gly or ZnSO₄ showed increased MT expression on days 14 and 35, and its expression was higher in the Zn-Gly group than in the ZnSO₄ group. These results illustrated that dietary Zn-Gly elevated jejunal MT mRNA expression, which indicates that organic Zn provided more available Zn than ZnSO₄. Masaki et al. (2007) also reported that Zn-Gly improved the expression of MT. However, we did not detect statistically significant differences in the ZIP (SLC39) family- and ZnT (SLC30) family-related indicators between inorganic and organic Zn at the concentration of 70 mg Zn/kg.

The gastrointestinal tract of animals is colonized by a complex and diverse microbial community, which directly affects the physiological function, endocrine processes, substance metabolism, and immune function of the host (Round and Mazmanian, 2009). Smith et al. (1972) showed that Zn is essential for intestinal flora. To the best of our knowledge, our study is the first to assess the effect of different Zn sources on the microbial diversity and composition in the cecum of meat ducks. In our study, the addition of Zn-Gly resulted in a different content of glycine in the diet, and we corrected for it in the control and ZnSO₄ groups by adding 263 mg/kg glycine in the premixes. Hence, all groups received the same level of glycine. We found that dietary Zn supplementation enhanced alpha diversity regardless of the Zn form, whereas no differences in beta diversity were observed among groups. Similarly, Mayneris-Perxachs et al. (2016) showed that Zn deficiency changed the composition of the gut bacterial populations in broilers, as indicated by altered Chao1 index and observed species richness values. In our study, compared with the CON group, organic Zn increased the relative abundance of Firmicutes and decreased that of Bacteroidetes. Ley et al. (2006) reported that the Firmicutes/Bacteroidetes ratio has an effect on the BW of humans, with high values in obese people and low values in lean people. This result may explain the high growth performance in the Zn-Gly group in our study, although host species are different.

At the genus level, the relative abundance of Blautia increased in duck fed the diet supplemented with 70 mg/kg Zn from Zn-Gly. Blautia is a common acetic acid producer that helps maintain intestinal homeostasis by regulating gut immune cells and producing short chain fatty acids (Kim et al., 2014). ZnSO₄ supplementation increased the relative abundance of Lactobacillus compared with the CON group, which was consistent with the finding that chitosan-chelated Zn increased the relative abundance of Lactobacillus (Feng et al., 2020). Lehri et al. (2017) reported that Lactobacillus promotes intestinal homeostasis of the host and inhibits the growth of pathogenic bacteria. We also found that both Zn sources increased the relative abundance of Prevotellaceae NK3B31 group and [Ruminococcus] torques group compared to the CON group. Prevotellaceae NK3B31 group can help the host utilize proteins and carbohydrates, and it can also act as a conditioned pathogen. However, in this study we observed only the nutritional function of Zn under physiological conditions. Our results indicate that Prevotellaceae NK3B31 group may play a role in the health of meat ducks. Other researchers reported that Prevotellaceae was positively associated with the production of acetic acid and propionic acid, which have anti-inflammatory effects and health-promoting functions in the host, and it is one of the predominant fiber-degrading bacterial species in the intestinal tract of hosts (Wu et al., 2011; Jiang et al., 2020). Salyers et al. (1977) showed that [Ruminococcus] torques group, which ferments gastric mucins, plays an important role in the digestion of resistant starch, and it is a butyrate-producing bacterium.

Conclusions

Collectively, Zn supplied in feed as Zn-Gly significantly enhanced growth performance in Cherry Valley ducks. Our results also indicated that Zn-Gly supplementation at 70 mg/kg Zn had positive effects on intestinal morphology, and gut health of ducks when compared with the same dosage use of ZnSO₄ in feed. These results can be applied to future studies of the effect of Zn-Gly supplementation on intestinal barrier function of ducks under challenging conditions.

Glossary

Abbreviations:

ADFI

average daily feed intake

ADG

average daily gain

BW

body weight

CLDN-1

claudin1

d-LA

d-lactic acid

ELISA

enzyme-linked immunosorbent assay

F/G

feed to gain ratio

H&E

hematoxylin and eosin

Ig

immunoglobulin

JAM-3

junctional adhesion molecule 3

LDA

Linear discriminant analysis

LYZ

lysozyme

MTs

metallothioneins

MUC2

mucin 2

OCLN

occludin

PAS

periodic acid-Schiff

PCoA

principal co-ordinates analysis

qRT-PCR

quantitative real-time polymerase chain reaction

sIgA

secretory IgA

TFF2

trefoil factor 2

TJ

tight junction

Zn

Zinc

ZnSO₄

Zn sulfate

Zn-Gly

Zn glycine chelate

ZO-1

zonula occludens-1

ZO-2

zonula occludens-2

Conflict of interest statement

All authors declare no other competing interests.