Skip to main content
NCBI home page
Reports of Biochemistry & Molecular Biology logoLink to Reports of Biochemistry & Molecular Biology
. 2023 Apr;12(1):1–12. doi: 10.52547/rbmb.12.1.1

Protective Effects of Cinnamic Acid Against Hyperglycemia Induced Oxidative Stress and Inflammation in HepG2 Cells

Mohammad Yazdi 1,2, Amirhossein Nafari 3,4, Mojgan Azadpour 2, Mahdi Alaee 1, Forouzan Hadipour Moradi 2, Razieh Choghakhori 2, Maryam Hormozi 1,2, Hassan Ahmadvand 1,5,*
PMCID: PMC10505459  PMID: 37724158

Abstract

Background:

Cinnamic acid, a phenylpropanoid acid, has been investigated as a potential alternative therapy for diabetes and its complications in some studies.

Methods:

In the first stage, the viability of HepG2 cells at different concentrations of glucose and CA was assessed by MTT assay. Oxidative stress markers) CAT, GPx, GSH, and MDA) were measured spectrophotometrically. After RNA extraction, the effect of different concentrations of CA on the expression of DPP4 and inflammatory factors (IL-6, NF- κB) in HepG2 cells was assessed using real-time PCR.

Results:

In HepG2 cells, CA increased catalase and glutathione peroxidase activity and GSH production in a dose-dependent manner in the presence of high glucose concentrations, with the greatest effect seen at a concentration of 75 mg/ml. Also, it reduced the amount of MDA in high-glucose HepG2 cells. Furthermore, CA decreased the expression of DPP4, NF- κB, and IL-6 genes in HepG2 cells in the presence of high glucose levels.

Conclusions

The results of our study indicated that CA reduced hyperglycemia-induced complications in HepG2 cells by decreasing inflammatory gene expression, including IL-6 and NF- κB and inhibiting the expression of DPP4, and limiting oxidative stress.

Key Words: Cinnamic acid, Diabetes, HepG2 cells, Hyperglycemia ss, Oxidative stre

Introduction

Cinnamic acid, a naturally occurring aromatic fatty acid, is considered a plant hormone, regulating cell growth and differentiation (Auxins). Cinnamic acid is the product of phenylalanine deamination utilized by the phenylalanine ammonia-lyase enzyme (1). This compound is reported to have multiple biological activities including antioxidant, anti-inflammatory, hepatoprotective, antityrosinase, antidiabetic activities, anti-malarial and anti-cancer properties (2-8).

Diabetes is a metabolic disorder of the endocrine system with multisystem complications, which is known as a leading cause of morbidity worldwide. The prevalence of diabetes mellitus is considered to extend over the following decades, which presents this disease as a significant public health concern; thus, searching for better treatment is vital (9).

A higher risk of atherosclerosis, kidney, and nerve damage has been noted in diabetic patients(10). Autoxidation reactions of glucose adducts to protein, unsaturated lipids in plasma and membrane proteins that undergo autoxidation, hypertension, and impaired free radical scavenger and inhibitory systems induce free radicals, which then provoke various complications in diabetic patients (11). Enzymatic antioxidant defenses such as catalase (CAT) and glutathione peroxidase (GPx) counteract these effects. Reactive oxygen species lead to the peroxidation of membrane lipids and the production of malondialdehyde (MDA), and tissue damage (12).

Glucose-dependent insulinotropic peptide (GIP) and glucagon-like peptide 1 (1-GLP) are both incretins released after eating, which can increase insulin secretion. Dipeptidyl peptidase-4 is a membrane-bound peptidase from the family of prolyl oligopeptidase enzymes that degrades GLP-1 and GIP, which can pose a concern in diabetic patients; therefore, researchers aim to find DPP-4 inhibitors (13).

Inflammatory response contributes to insulin resistance in diabetic patients. Several pro-inflammatory factors, such as tumor necrosis factor α (TNF-α) and interleukin-6 (IL-6), are produced in adipose tissue macrophages (14). TNF-α reduces insulin resistance by decreasing tyrosine kinase activity. In addition, TNF-α inhibits insulin signaling and disrupts its (15,16). secretion However, the tyrosine phosphorylation of IR substrate (IRS)-1 is reduced by IL-6 (17). NF- κB is associated with the transcription of most pro-inflammatory molecules, including TNF-α; IL-6, Homocysteine, which eventually leads to beta-cell dysfunction and apoptosis during diabetes (18,19).

Hyperglycemia contributes to the development of insulin resistance by producing reactive oxygen species (ROS) and upregulating chronic inflammation factors (20). The HepG2 cells have been defined as a cell line for in vitro investigation of hyperglycemia (21).

In recent years, there have been multiple studies investigating the role of cinnamic acid in the prevention, control and treatment of diabetes and its complications. However, the mechanism of effectiveness of this natural substance has not yet been entirely determined (22).

Despite numerous studies on cinnamic acid's anti-inflammatory and antioxidant properties, the efficiency of these properties in hyperglycemic conditions is still unclear (23-25). To the best of our knowledge, this is the first research to explore the mechanism of effectiveness of cinnamic acid as a possible anti-diabetic agent in the HepG2 cell line under hyperglycemic conditions.

Hence, the present study was designed to investigate the effects of cinnamic acid as a therapeutic potential on reducing oxidative stress, expression of inflammatory factors, and inhibition of DPP-4 in HepG2 cell line in the presence of high glucose concentration.

Materials and Methods

Cell culture and treatment

Human hepatoma cell line, HepG2, packaging cells were purchased from the Pasteur Institute of Iran. HepG2 cells were cultured in Roswell Park Memorial Institute (RPMI) medium, which included 10% fetal bovine serum (FBS) and 1.5% penicillin-streptomycin. Afterwards, the cells were incubated at 37 °C in a humidified environment of 5% CO2.

HepG2 cells were divided into eight groups:

i. Control cells,

ii. Control cells +25 mg/ml Cinnamic acid,

iii. Control cells +50 mg/ml Cinnamic acid,

iv. Control cells +75 mg/ml Cinnamic acid,

v. Cells treated with 60 mM D- glucose (high glucose),

vi. Cells treated with 60 mM D- glucose (high glucose) + 25 mg/ml Cinnamic acid,

vii. Cells treated with 60 mM D- glucose (high glucose) + 50 mg/ml Cinnamic acid,

viii. Cells treated with 60 mM D- glucose (high glucose) + 75 mg/ml Cinnamic acid.

Cell viability assay

The3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to determine the effect of glucose and cinnamic acid (Merck) on HepG2 cell viability. In brief, 3×104 cells/well were seeded onto 96-well plates and treated with different glucose or cinnamic acid doses. The plates were incubated for 24, 48, and 72 hours at 37 °C with 5% CO2. Subsequently, MTT (0.5 mg/mL PBS) was added to each well and incubated for 3 hours at 37 °C. Finally, each plate absorbance was measured at 570 nm (26).

Biochemical Analysis

Measurement of CAT activity

Catalase activity was measured in accordance with previous study by measuring the decomposition rate for hydrogen peroxide (H2O2) at 240 nm (27).

Measurement of MDA

malondialdehyde (MDA) levels were measured in accordance with previous study, by assessment of Thiobarbituric acid reactive substances. The spectrophotometric measurements of absorbance were taken at 532 μm. MDA concentrations were represented as μmol/ mg-pr (28).

Measurement of GPx activity

Glutathione peroxidase activity was measured using commercial kits (Aryagen Sobhan Azma Novin (ASAN), Iran).

Measurement of GSH

Glutathione level was measured using commercial kits (Aryagen Sobhan Azma Novin (ASAN), Iran).

RNA extraction and real-time PCR

Total RNA extraction from HepG2 cell lines was performed according to the instructions of previous studies (29). The absorption of the extracted solution was then measured at 260 and 280 using NanoDrop. The purification of the RNA extraction product was investigated using agarose gel electrophoresis, and the appearance of clear 18s and 28s RNA bands was an indication of high-quality RNA. To convert RNA into cDNA, commercial kits (YTA, Yekta Tajhiz Azma, Iran) were used according to the manufacturer's instructions. For real-time PCR assessment, 2 x SYBR Green qPCR Mix (1 X), 0.2 microliters of targeted gene primers (Table 1), one microliter of cDNA template, and 8.2 microliters of RNAse-free water comprise the reaction mixture. Under the following conditions, the final reaction solution (20 L) was evaluated for proliferation: Initial denaturation stage at 95 °C for 3 minutes; then 40 cycles of denaturation for 5 seconds at 95 °C and annealing for 30 seconds at 60 °C in a Real-Time PCR System thermocycler, proceeded with a 5-minute final extension step at 50-99 °C. The products were placed onto a 1% agarose gel in 1X TBE solution, and the PCR bands were detected using an ultraviolet transilluminator.

Table 1.

List of primers used in this study.

Gene Forward (5' -3) Reverse (5' -3) Product size (bp)
GAPDH CGACCACTTTGTCAAGCTCA AGGGGTCTACATGGCAACTG 228
DPP-4 AAGATGGAACTGCTTAGTGG TAGAGCTTCTATCCCGATGAC 226
IL-6 GGTACATCCTCGACGGCATCT GTGCCTCTTTGCTGCTTTCAC 81
NF-κB AACAGAGAGGATTTCGTTTCC G TTTGACCTGAGGGTAAGACTTCT 104
Open in a new tab

Statistical analysis

After confirming the normality of biochemical data by the Shapirovilk test, the final data were analyzed by one-way ANOVA, and then the means were compared by Tukey post hoc test at 5% significance. The analysis of the gene expression results was normalized by the expression of the GAPDH gene as a reference gene. Samples were performed in triplicate replication. The raw data (Ct) generated by the real-time was converted to Fold change. Finally, after normalization, the final data were analyzed by one-way ANOVA and means were compared by Tukey post hoc test at 5% significance. Data analysis was performed using SPSS software (version 24).

Results

Effect of D-glucose and Cinnamic acid on the viability of HepG2 cells

The HepG2 cells viability were not harmed by 10 mM glucose replicating normoglycemic conditions at 24 or 48 hours (97–98 percent viability) (Fig. 1). After a 24 or 48-hour incubation time, 20, 40, or 60-mM glucose did not cause toxicity in the HepG2 cells (86–99% viability). Although incubation of HepG2 cells with 70 mM glucose did not cause toxicity in 24 hours (92%), after 48 hours, it demonstrated a decrease in viability (73%) (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Impact of glucose on the viability of HepG2 cells after 24- and 48-hours treatment and at different concentrations. The findings are presented as a percentage relative to control and are calculated as the mean (standard deviation) of three separate measurements.

Furthermore, HepG2 cell viability was not affected after incubation for 48 hours with 25, 50, 75 µg/ml of cinnamic acid at the presence or absence of 60 mM glucose (81–94% viability) (Fig. 2). The above concentration and time span were employed in future assessments to reproduce hyperglycemia-induced effects in HepG2 cells based on the reported results.

Fig. 2.

Fig. 2

Open in a new tab

Impact of different concentrations of cinnamic acid on the viability of HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as a percentage relative to control and are calculated as the mean (standard deviation) of three separate measurements.

Catalase activity in high/normal glucose treated HepG2 cells

The catalase activity was significantly reduced by 51.4% in HepG2 cells, which received 60 mM glucose (Table 2 and Fig. 3). Although 25 and 50 µg/ml Cinnamic acid reduced catalase activity in HepG2 cells (176.29±10.33 and 160.51±4.16, respectively), 75 µg/ml CA significantly increased catalase activity by 44.21% in normal glucose cells (P< 0.05). The HEPG cells adjacent to 25 µg/ml Cinnamic acid, presented lower catalase activity compared to HEPG2 cells. However, cells receiving 50 µg/ml had a higher catalase activity compared to HEPG2 cells. The HEPG2 cells which received 75 µg/ml Cinnamic acid possessed a significantly higher catalase activity compared to HEPG2 cells (P< 0.05).

Table 2.

Effect of cinnamic acid on oxidative stress markers in HepG2 cells. Different letters in each row indicate a significant difference between groups.

Parameter Protein concentration ± SD P Value
Control Glucose cin 25 cin 25+GLC cin 50 cin 50+ GLC cin 75 cin 75+ GLC
Catalase 244.85 ± 18.23e 118.975 ± 0.952ef 176.29 ± 10.3d 83.27 ± 2.10f 160.51 ± 4.16d 121.94 ± 10.82e 353.1 ± 30.1a 284.15 ± 6.81b <0.0001
(unit/mg of protein)
GPX 560.7 ± 60.9de 510.98 ± 18.64e 616.8 ± 37.6cd 552.6 ± 20.7de 628.57 ± 15.71cd 646.1 ± 58.2bc 872.41 ± 10.37a 719.50 ± 17.2b <0.0001
(unit/mg of protein)
GSH 1.88 ± 0.0756ab 1.622 ± 0.00789c 1.51 ± 0.0425c 1.58 ± 0.01259c 1.58 ± 0.0642c 1.78 ± 0.0934b 2.01 ± 0.0295a 1.870 ± 0.0907b <0.0001
(µmole/mg of protein)
MDA 120.79 ± 7.75d 285.74 ± 1.87a 123.77 ± 7.2d 196.6 ± 4.83b 116.63 ± 6.108d 180.81 ± 14.7b 112.36 ± 5.32d 158.51 ± 1.048c <0.0001
(µmole/mg of protein)
Open in a new tab

Fig. 3.

Fig. 3

Open in a new tab

Impact of different concentrations of cinnamic acid on the CAT activity in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as U/mg protein and are calculated as the mean (standard deviation) of three separate measurements. Different letters in each column indicate a significant difference between groups.

The GPx activity was reduced in high glucose cells by 8.9% (Fig. 4). In the NG cells which received 75 µg/ml Cinnamic acid, GPx activity was induced to 872.41±10.37, which was significantly higher than control and NG cells with 25 and 50 µg/ml CA (P< 0.05) (560.7±60.9,616.8±37.6, and 628.57±15.71 respectively). The high glucose cells which received CA showed the same pattern as NG cells. The GPX activity was induced dose-dependently in HEPG2 cells which received CA (552.6±20.7, 646.1±58.2 and 719.50±17.25 respectively) and CA at 50 and 75 µg/ml showed significantly higher GPX activity by 26.4% and 40.8% compared to the HEPG2 group (P< 0.05).

Fig. 4.

Fig. 4

Open in a new tab

Impact of different concentrations of cinnamic acid on the GPX activity in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as U/mg protein and are calculated as the mean (standard deviation) of three separate measurements. Different letters in each column indicate a significant difference between groups.

The HepG2 cells had a significantly lower amount of GSH (1.62±0.01) compared to the control group (1.88±0.07) (Fig. 5). No significant increase was observed in the level of GSH in the NG cells, which received cinnamic acid. The quantity of GSH in HEPG2 cells increased dose-dependently with cinnamic acid (1.58±0.01, 1.78±0.09, and 1.87±0.09 respectively). The GSH content of HEPG2 cells treated with cinnamic acid at 50 and 75 µg/ml was significantly higher than HEPG2 cells which received no treatments (P< 0.05).

Fig. 5.

Fig. 5

Open in a new tab

Impact of different concentrations of cinnamic acid on the GSH protein in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as µM/mg protein and are calculated as the mean (standard deviation) of three separate measurements. Different letters in each column indicate a significant difference between groups.

After 48 hr treatment, malondialdehyde level as a marker of lipid peroxidation was significantly elevated in HepG2 cells (285.74±1.87) compared to the control group (120.79±7.75) (P< 0.05) (Fig. 6). Cinnamic acid exhibited no significant increase or decrease in the level of MDA in NG cells. However, in HepG2 cells treated with 60 mM D - glucose, cinnamic acid presented a significant dose-dependent decrease in the MDA level compared to HEPG cells with no cinnamic supplement (P< 0.05) (196.6±4.83, 180.81±14.76, and 158.51±1.04, respectively). Cinnamic acid at 75 µg/ml demonstrates the highest activity with a 44.5% lower MDA level compared to the glucose group.

Fig. 6.

Fig. 6

Open in a new tab

Impact of different concentrations of cinnamic acid on the MDA protein in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as µM/mg protein and are calculated as the mean (standard deviation) of three separate measurements. Different letters in each column indicate a significant difference between groups.

Table 3.

Effect of cinnamic acid on the expression of DPP4 and inflammatory cytokines in HepG2 cells. Different letters in each row indicate a significant difference between groups.

Gene Group P Value
Control Glucose cin 25 cin 25+GLC cin 50 cin 50+ GLC cin 75 cin 75+ GLC
DPP4 1b 1.686a 0.1282c 0.3312c 0.1070c 0.0091c 0.0754c 0.8267b <0.0001
NF- κB 1b 2.3623a 0.6676bc 0.6899bc 0.4026c 0.6017bc 0.2415c 0.5101bc <0.0001
IL-6 1d 3.281a 0.4256e 2.257b 0.6470de 1.536c 0.5387e 0.6200e <0.0001
Open in a new tab

DPP4 expression was substantially increased by 1.686-fold in HepG2 cells in companies with a high level of glucose compared with control (Fig. 7) (P< 0.05). Compared to the control group, CA have significantly reduced DPP4 expression in normal glucose HepG2 cells (P< 0.05). Cells that received high amounts of glucose alongside cinnamic acids have shown to reduce DPP4 expression compared to cells which only received glucose. Cinnamic acid at 25 and 50 µg/ml had a significantly greater effect in DPP4 reduction in HepG2 cells, which received a high level of glucose (P< 0.05).

Fig. 7.

Fig. 7

Open in a new tab

Impact of different concentrations of cinnamic acid on the DPP4 gene expression in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as Fold change 2-ΔΔCt compared to the control group. Different letters in each column indicate a significant difference between groups.

The NF- κB pathway has been activated in the presence of a high level of glucose in the cells, which causes the upregulation of inflammatory cytokines. After being exposed to high glucose levels, the NF- κB expression was significantly elevated by 2.3623-fold compared to the NG HepG2 cell line (P< 0.05) (Fig. 8). Although cells that were only exposed to cinnamic 25 µg/ml did not show a significant decrease, CA in 50 and 75 µg/ml showed a significant decrease in expression of NF- κB compared to HepG2 cell line, which had not received any supplement (P< 0.05). High glucose HepG2 cells that received cinnamic acid had significantly lower expression of NF- κB compared to cells that only received a high level of glucose (P< 0.05) (Fig. 8).

Fig. 8.

Fig. 8

Open in a new tab

Impact of different concentrations of cinnamic acid on the NF- κB gene expression in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as Fold change 2-ΔΔCt compared to the control group. Different letters in each column indicate a significant difference between groups.

IL-6 expression was significantly 3.281-fold higher in HepG2 cells treated with a high level of glucose compared to control (P< 0.05). The CA significantly reduced normal glucose cells IL-6 expression at 25 and 75 µg/ml (P< 0.05). Cinnamic acid significantly reduced IL- 6 expression in high glucose cells at 50 µg/ml compared to cells that received 25 µg/ml CA (P< 0.05). Moreover, CA at 75 µg/ml showed the best effect on reducing IL-6 expression in HepG2 cells and was significantly greater than CA at 50 µg/ml (P< 0.05) (Fig. 9).

Fig. 9.

Fig. 9

Open in a new tab

Impact of different concentrations of cinnamic acid on the IL-6 gene expression in HepG2 cells after 48 hours treatment in the presence or absence of 60 mM of glucose. The findings are presented as Fold change 2-ΔΔCt compared to the control group. Different letters in each column indicate a significant difference between groups.

Discussion

In recent years, dipeptidyl peptidase-IV inhibition has emerged as a promising novel therapeutic approach for diabetes management (30). Our results demonstrated a reduction in DPP4 expression in both normal and high glucose HepG2 cells treated with cinnamic acid at all concentrations. In the hyperglycemic cells, cinnamic acid at 50 mg/ml showed the highest activity. Our lab conditions may be responsible for the lack of dose-dependent activity of cinnamic acid in HEPG cells. In an in vitro assays by Adolpho et al.'s 2013 study, cinnamic acid showed 4.4% inhibitory activity against DPP-IV at the concentration of 500 μM (31). Cinnamic acid also demonstrated −5.5 kcal/mol Docking score interaction with DPP-4 in a 2017 study (32). These results are compatible with the results of our study. The activation of the nuclear factor kappa B gene leads to the transcription of several proinflammatory genes, and it is one of the target therapies for diabetes and its complications (18).

According to a 2018 report by Ghodratollah Panahi et al., a high level of glucose induces inflammation in HepG2 cells through oxidative stress and activation of the NF-kB pathway (33). We explored NF- kB and IL-6 expressions in HepG2 cells to determine the possible molecular mechanism underlying cinnamic acid's anti-inflammatory properties. There are many studies that showed the role of cinnamic acid and others natural compounds from herbal medicins in the prevention, control and treatment of diabetes and its complications (34,35).Our research showed that cinnamic acid has the ability to significantly reduced the upregulated NF- κB gene to reduce the hyperglycemic induced inflammation. The cinnamic acid also showed the ability to reduce the NF- kB expression at 50 and 75mg/ml in NG cells. According to a 2006 report, cinnamic acid inhibits NF- kB expression in human umbilical endothelium-derived cell lines, consistent with the findings of our investigation in HepG2 cells (36).

Interleukin-6, a pro-inflammatory cytokine, has been shown to play a key role in insulin resistance in HepG2 cells (17). Cinnamic acid has been shown to inhibit LPS-induced IL-6 expression in microglia (37). In our study, IL-6 expression was elevated in HEPG cells; however, cinnamic acid effectively reduced IL-6 expression dose-dependently.NG cells treated with cinnamic acid also showed lower IL-6 express ion compared to the control group. In Song F et al. study, Cinnamic acid reduced serum levels of TNF-α and IL-6 in isoproterenol-induced acute myocardial ischemia rats, which is consistent with our results (23).

Our findings, which were compatible with previous results, revealed that the oxidative stress induced by hyperglycemia in HepG2 cells reduced the activity of antioxidant enzymes (catalase and glutathione peroxidase), and glutathione level. Hyperglycemia also increased the level of malondialdehyde as an oxidative stress marker (38). In a study by Hatice Gül ANLAR et al., the CAT and GPX activity diabetic rats which received 50mg/kg cinnamic acid were significantly higher than diabetic rats with no treatments, which is in the same line of our study in hyperglycemic HepG2 cells. However, the results of our study demonstrated that cinnamic acid at 75 mg/ml could significantly induce the CAT activity and CA at 50 and 75 mg/ml showed an increased GPx activity compared to HEPG cells. However, the Gül ANLAR study demonstrated no significant alteration in CAT and GPx activity in CA treated rats compared to control; this may be due to a difference in the amount of cinnamic acid used.

The GSH level was also significantly higher in the diabetic rats which had received cinnamic acid compared to diabetic rats with no treatments; however, cinnamic acid did not show a significant increase in the level of GSH in rats which only received cinnamic acid compared to control, which is consistent with the result of our study in HEPG cells.

The MDA level was also significantly lowered in CA-treated diabetic rats compared to diabetic rats with no treatments, and no significant difference was observed in normal rats, which also consisted of our results (39).

Our research's major limitation is that it was conducted as an in vitro assay, and the CA antidiabetic mechanism must be further investigated in human body circumstances and compared to the results of this study. However, our findings in HepG2 cells demonstrated that cinnamic acid could ameliorate hyperglycemic-induced complications by lowering inflammation by inhibiting the expression of IL-6, NF- κB and DPP4, and reducing oxidative stress.

Conflict of Interest

The authors declare no conflict of interest, financial or otherwise.

Funding

None.

Acknowledgements

This study was approved by the ethical committee of Lorestan University of Medical Sciences (IR.LUMS.REC.1400.135).

References

  • 1.De P, Baltas M, Bedos-Belval F. Cinnamic acid derivatives as anticancer agents-a review. Curr Med Chem. 2011;18(11):1672–703. doi: 10.2174/092986711795471347. [DOI] [PubMed] [Google Scholar]
  • 2.Akao Y, Maruyama H, Matsumoto K, Ohguchi K, Nishizawa K, Sakamoto T, et al. Cell growth inhibitory effect of cinnamic acid derivatives from propolis on human tumor cell lines. Biol Pharm Bull. 2003;26(7):1057–9. doi: 10.1248/bpb.26.1057. [DOI] [PubMed] [Google Scholar]
  • 3.Lee EJ, Kim SR, Kim J, Kim YC. Hepatoprotective phenylpropanoids from Scrophularia buergeriana roots against CCl4-induced toxicity: action mechanism and structure-activity relationship. Planta Med. 2002;68(05):407–11. doi: 10.1055/s-2002-32081. [DOI] [PubMed] [Google Scholar]
  • 4.Lee H-S. Tyrosinase inhibitors of Pulsatilla cernua root-derived materials. J Agric Food Chem. 2002;50(6):1400–3. doi: 10.1021/jf011230f. [DOI] [PubMed] [Google Scholar]
  • 5.Liu IM, Hsu FL, Chen CF, Cheng JT. Antihyperglycemic action of isoferulic acid in streptozotocin‐induced diabetic rats. Br J Pharmacol. 2000;129(4):631–6. doi: 10.1038/sj.bjp.0703082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sova M. Antioxidant and antimicrobial activities of cinnamic acid derivatives. Mini Rev Med Chem. 2012;12(8):749–67. doi: 10.2174/138955712801264792. [DOI] [PubMed] [Google Scholar]
  • 7.Wiesner J, Mitsch A, Wiβner P, Jomaa H, Schlitzer M. Structure–activity relationships of novel anti-malarial agents. Part 2: Cinnamic acid derivatives. Bioorg Med Chem Lett. 2001;11(3):423–4. doi: 10.1016/s0960-894x(00)00684-3. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang L, Ji Z. Synthesis, antiinflammatory and anticancer activity of cinnamic acids, their derivatives and analogues. Yao xue xue bao= Acta pharmaceutica Sinica. 1992;27(11):817–23. [PubMed] [Google Scholar]
  • 9.Buse JB, Wexler DJ, Tsapas A, Rossing P, Mingrone G, Mathieu C, et al. 2019 update to: management of hyperglycemia in type 2 diabetes, 2018.A consensus report by the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes care. 2020;43(2):487–93. doi: 10.2337/dci19-0066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wolff S. Diabetes mellitus and free radicals: free radicals, transition metals and oxidative stress in the aetiology of diabetes mellitus and complications. Br Med Bull. 1993;49(3):642–52. doi: 10.1093/oxfordjournals.bmb.a072637. [DOI] [PubMed] [Google Scholar]
  • 11.Wei W, Liu Q, Tan Y, Liu L, Li X, Cai L. Oxidative stress, diabetes, and diabetic complications. Hemoglobin. 2009;33(5):370–7. doi: 10.3109/03630260903212175. [DOI] [PubMed] [Google Scholar]
  • 12.Kwiecien S, Jasnos K, Magierowski M, Sliwowski Z, Pajdo R, Brzozowski B, et al. Lipid peroxidation, reactive oxygen species and antioxidative factors in the pathogenesis of gastric mucosal lesions and mechanism of protection against oxidative stress-induced gastric injury. J Physiol Pharmacol. 2014;65(5):613–22. [PubMed] [Google Scholar]
  • 13.Kazakos K. Incretin Effect: Glp-1, Gip, Dpp4. D Diabetes Res Clin Pract. 2011;93:S32–S6. doi: 10.1016/S0168-8227(11)70011-0. [DOI] [PubMed] [Google Scholar]
  • 14.Goyal R, Faizy AF, Siddiqui SS, Singhai M. Evaluation of TNF-α and IL-6 levels in obese and non-obese diabetics: pre-and postinsulin effects. N Am J Med Sci. 2012;4(4):180. doi: 10.4103/1947-2714.94944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Borst SE. The role of TNF-α in insulin resistance. Endocrine. 2004;23(2):177–82. doi: 10.1385/ENDO:23:2-3:177. [DOI] [PubMed] [Google Scholar]
  • 16.Mohammadi M, Gozashti MH, Aghadavood M, Mehdizadeh MR, Hayatbakhsh MM. Clinical Significance of Serum IL-6 and TNF-α Levels in Patients with Metabolic Syndrome. Rep Biochem Mol Biol. 2017;6(1):74–79. [PMC free article] [PubMed] [Google Scholar]
  • 17.Senn JJ, Klover PJ, Nowak IA, Mooney RA. Interleukin-6 induces cellular insulin resistance in hepatocytes. Diabetes. 2002;51(12):3391–9. doi: 10.2337/diabetes.51.12.3391. [DOI] [PubMed] [Google Scholar]
  • 18.Patel S, Santani D. Role of NF-κB in the pathogenesis of diabetes and its associated complications. Pharmacol Rep. 2009;61(4):595–603. doi: 10.1016/s1734-1140(09)70111-2. [DOI] [PubMed] [Google Scholar]
  • 19.Khosrowbeygi A, Ahmadvand H. Circulating levels of homocysteine in preeclamptic women. Bangladesh Med Res Counc Bull. 2011;37(3):106–9. doi: 10.3329/bmrcb.v37i3.6196. [DOI] [PubMed] [Google Scholar]
  • 20.Luc K, Schramm-Luc A, Guzik T, Mikolajczyk T. Oxidative stress and inflammatory markers in prediabetes and diabetes. J Physiol Pharmacol. 2019;70(6):809–24. doi: 10.26402/jpp.2019.6.01. [DOI] [PubMed] [Google Scholar]
  • 21.Kumar SM, Haridoss M, Swaminathan K, Gopal RK, Clemens D, Dey A. The effects of changes in glutathione levels through exogenous agents on intracellular cysteine content and protein adduct formation in chronic alcohol-treated VL17A cells. Toxicol Mech Methods. 2017;27(2):128–35. doi: 10.1080/15376516.2016.1268229. [DOI] [PubMed] [Google Scholar]
  • 22.Adisakwattana S. Cinnamic acid and its derivatives: mechanisms for prevention and management of diabetes and its complications. Nutrients. 2017;9(2):163. doi: 10.3390/nu9020163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Song F, Li H, Sun J, Wang S. Protective effects of cinnamic acid and cinnamic aldehyde on isoproterenol-induced acute myocardial ischemia in rats. J Ethnopharmacol. 2013;150(1):125–30. doi: 10.1016/j.jep.2013.08.019. [DOI] [PubMed] [Google Scholar]
  • 24.Liao J-C, Deng J-S, Chiu C-S, Hou W-C, Huang S-S, Shie P-H, Huang G-J. Anti-inflammatory activities of Cinnamomum cassia constituents in vitro and in vivo. Evidence-Based Complementary and Alternative Medicine. 2012;2012 doi: 10.1155/2012/429320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pontiki E, Hadjipavlou-Litina D. Multi-Target Cinnamic Acids for Oxidative Stress and Inflammation: Design, Synthesis, Biological Evaluation and Modeling Studies. Molecules. 2018;24(1):12. doi: 10.3390/molecules24010012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J immunol methods. 1983;65(1-2):55–63. doi: 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
  • 27.Cheraghi M, Ahmadvand H, Maleki A, Babaeenezhad E, Shakiba S, Hassanzadeh F. Oxidative Stress Status and Liver Markers in Coronary Heart Disease. Rep Biochem Mol Biol. 2019;8(1):49–55. [PMC free article] [PubMed] [Google Scholar]
  • 28.Ani M, Moshtaghie AA, Ahmadvand H. Comparative effects of copper, iron, vanadium and titanium on low density lipoprotein oxidation in vitro. Iran Biomed J. 2007;11(2):113–118. [PubMed] [Google Scholar]
  • 29.Reck-Peterson SL, Derr ND, Stuurman N. Imaging single molecular motor motility with total internal reflection fluorescence microscopy (TIRFM). Cold Spring Harb Protoc. 2010;2010(3):pdb.prot5399. doi: 10.1101/pdb.prot5399. [DOI] [PubMed] [Google Scholar]
  • 30.Röhrborn D, Wronkowitz N, Eckel J. DPP4 in diabetes. Frontiers in immunology. 2015;6:386. doi: 10.3389/fimmu.2015.00386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Adolpho LO, Marin D, Puigpinos A, Mendieta L, Tarragó T, Morel AF, et al. In vitro evaluation of caffeoyl and cinnamoyl derivatives as potential prolyl oligopeptidase inhibitors. Planta medica. 2013;79(16):1531–5. doi: 10.1055/s-0033-1350897. [DOI] [PubMed] [Google Scholar]
  • 32.Mehta V, Verma p, Sharma N, Sharma A, Thakur A, Malairaman U. Quercetin, ascorbic acid, caffeine and ellagic acid are more efficient than rosiglitazone, metformin and glimepiride in interfering with pathways leading to the development of neurological complications associated with diabetes: A comparative in-vitro study. Bulletin of Faculty of Pharmacy, Cairo University. 2017;55(1):115–21. [Google Scholar]
  • 33.Panahi G, Pasalar p, Zare M, Rizzuto R, Meshkani R. High glucose induces inflammatory responses in HepG2 cells via the oxidative stress-mediated activation of NF-κB, and MAPK pathways in HepG2 cells. Arch Physiol Biochem. 2018;124(5):468–74. doi: 10.1080/13813455.2018.1427764. [DOI] [PubMed] [Google Scholar]
  • 34.Gabriele E, Brambilla D, Ricci C, Regazzoni L, Taguchi K, Ferri N, et al. New sulfurated derivatives of cinnamic acids and rosmaricine as inhibitors of STAT3 and NF-κB transcription factors. J Enzyme Inhib Med Chem. 2017;32(1):1012–28. doi: 10.1080/14756366.2017.1350658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ahmadvand H, Amiri H, Elmi ZD, Bagheri S. Chemical composition and antioxidant properties of Ferula-assa-foetida leaves essential oil. Iran J Pharmacol Ther. 2013;12(2):52–57. [Google Scholar]
  • 36.Li X, Wen Z, He X, He S. Effects of cinnamic acid on expression of tissue factor induced by TNFα in endothelial cells and its mechanisms. J Chin Med Assoc. 2006;69(5):207–12. doi: 10.1016/S1726-4901(09)70220-5. [DOI] [PubMed] [Google Scholar]
  • 37.Chakrabarti S, Jana M, Roy A, Pahan K. Upregulation of suppressor of cytokine signaling 3 in microglia by cinnamic acid. Curr Alzheimer Res. 2018;15(10):894–904. doi: 10.2174/1567205015666180507104755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Subramaniyan SD, kumar Natarajan A. Citral, a monoterpene protect against high glucose induced oxidative injury in HepG2 cell in vitro-an experimental study. J Clin Diagn Res. 2017;11(8):BC10. doi: 10.7860/JCDR/2017/28470.10377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Anlar HG, Bacanli M, Çal T, Aydin S, Ari N, Bucurgat ÜÜ, et al. Effects of cinnamic acid on complications of diabetes. Turk J Med Sci. 2018;48(1):168–77. doi: 10.3906/sag-1708-8. [DOI] [PubMed] [Google Scholar]

Articles from Reports of Biochemistry & Molecular Biology are provided here courtesy of Varastegan Institute for Medical Sciences

RESOURCES