Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish

Clair Chaigne; Dora Sapède; Xavier Cousin; Laurent Sanchou; Patrick Blader; Elise Cau

doi:10.1371/journal.pgen.1011172

. 2024 Feb 26;20(2):e1011172. doi: 10.1371/journal.pgen.1011172

Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish

Clair Chaigne ¹, Dora Sapède ^1,², Xavier Cousin ³, Laurent Sanchou ⁴, Patrick Blader ¹, Elise Cau ^1,^*

Editor: John Ewer⁵

PMCID: PMC10919856 PMID: 38408087

Abstract

The eye is instrumental for controlling circadian rhythms in mice and human. Here, we address the conservation of this function in the zebrafish, a diurnal vertebrate. Using lakritz (lak) mutant larvae, which lack retinal ganglion cells (RGCs), we show that while a functional eye contributes to masking, it is largely dispensable for the establishment of circadian rhythms of locomotor activity. Furthermore, the eye is dispensable for the induction of a phase delay following a pulse of white light at CT 16 but contributes to the induction of a phase advance upon a pulse of white light at CT21. Melanopsin photopigments are important mediators of photoentrainment, as shown in nocturnal mammals. One of the zebrafish melanopsin genes, opn4xa, is expressed in RGCs but also in photosensitive projection neurons in the pineal gland. Pineal opn4xa+ projection neurons function in a LIGHT ON manner in contrast to other projection neurons which function in a LIGHT OFF mode. We generated an opn4xa mutant in which the pineal LIGHT ON response is impaired. This mutation has no effect on masking and circadian rhythms of locomotor activity, or for the induction of phase shifts, but slightly modifies period length when larvae are subjected to constant light. Finally, analysis of opn4xa;lak double mutant larvae did not reveal redundancy between the function of the eye and opn4xa in the pineal for the control of phase shifts after light pulses. Our results support the idea that the eye is not the sole mediator of light influences on circadian rhythms of locomotor activity and highlight differences in the circadian system and photoentrainment of behaviour between different animal models.

Author summary

Experiments performed in mice have established a crucial role for the eye in general and melanopsin expressing cells in particular in the control of circadian rhythms most notably during photoentrainment, by which circadian rhythms adapt to a changing light environment. In marked contrast to this, we show that in zebrafish the eye and photosensitivity dependent on one of the melanopsin genes, opn4xa, which is expressed in both the eye and the pineal gland, are largely dispensable for correct circadian rhythms. These results provide insight that the light sensors orchestrating circadian rhythms of locomotor activity are different between animal models revealing that vertebrates employ different molecular/cellular circuits for photoentrainment of behavior depending on their phylogeny and/or temporal niche.

Introduction

Light has a profound influence on the physiology and behaviour of living organisms. In particular, it controls circadian rhythms that in turn regulate a variety of biological functions. Circadian rhythms are defined by their period of approximately 24 hours. Once established, these rhythms persist in constant conditions, which has fostered the concept of an endogenous time-keeping mechanism known as the circadian system. Nonetheless, external cues are required to synchronize (or ‘entrain’) circadian rhythms with the exogenous environmental conditions. For instance, light entrains the circadian system through a process referred to as photoentrainment (see [1] for a review).

In mouse, photoentrainment depends on a functional retina. Eye enucleated mice or mice lacking retinal ganglion cells (RGCs) do not entrain to LD (Light/Dark) cycles and thus behave as if they were in constant darkness [2–4]. Similarly, in human, fifty percent of blind people exhibit circadian misalignment with the LD cycles [5–7]. In mouse, photoentrainment depends on a specific subtype of RGCs expressing the photopigment melanopsin, which is encoded by the Opn4 gene. These RGCs are sensitive to blue light and are referred to as ipRGCs for “intrinsically photosensitive RGCs”. Mice mutant for Opn4 shows a diminished phase-delay in response to a pulse of light administered at circadian time 16 (CT 16; at the beginning of the subjective night) but entrain normally to LD cycles [8,9]. In contrast, mice with no ipRGCs or with impaired neurotransmission from ipRGCs show no entrainment to LD as well as no phase delay following a light pulse at CT16 [10–12]. The difference between the phenotypes observed when only melanopsin photosensitivity is impaired compared to the models where ipRGCs inputs to the brain are lost is thought to result from the influence of classical rods and cone photoreceptors on ipRGCs. Indeed, both rods and cones have been shown to play a role during photoentrainment and to signal to ipRGCs [13–19]. Thus, ipRGCs function as a hub that integrates and transmits light information to the brain through a direct projection to the core of the suprachiasmatic nucleus (SCN; [20–22]).This hypothalamic nucleus functions as a ‘master clock’ that synchronizes peripheral clocks present everywhere in the body.

In addition to photoentrainment, ipRGCs also control the increase of period length when animals are placed in constant light (LL) [8,9] and are required for a process of maturation of the circadian clock that sets the definitive period of locomotor rhythms in LD and in constant darkness (DD, [23]. Finally, in addition to their crucial influence on the circadian system, murine ipRGCs also control masking, a direct suppressive effect of light on locomotor activity. This activity is thought to involve different ipRGC subtypes than the ones that impact the circadian system [24].

ipRGCs are well established to mediate circadian and direct effects of light on behaviour in nocturnal mammals. Based on the conservation of the nervous system, observations made in human blind people and the description of ipRGC populations in the diurnal rodent Arvicanthis ansorgei as well as in human, ipRGCs are considered to play a similar role in diurnal mammals [25,26]. While the zebrafish has emerged as a powerful non-mammalian diurnal vertebrate model for chronobiology, the neural circuit controlling photoentrainment of behaviors has not been identified in this species. The observation that two species of cavefishes bearing eye degeneration: Astyanax mexicanus and Phreatichthys andruzzii do not show robust light-entrainable circadian locomotor activity rhythms could suggest that eye function is crucial for photoentrainment of locomotor rhythms in fishes [27,28]. However, the observed circadian locomotor phenotypes could result from additional photoreceptive deficits. Indeed, Phreatichthys andruzzii present mutations in several opsin genes that are expressed in extra-ocular locations [28]. While the function of the eye regarding circadian rhythms of behaviors has not been addressed in fishes, in the zebrafish model, an additional level of complexity arises from the observation that all cell types are photosensitive [29–31]. This local photodetection could serve local functions (metabolism, transcription, cell cycle) or participate to the control of behaviors, although some level of central control is expected for orchestrating a complex process such as behavior. As such, the relative importance of central versus peripheral control for the photoentrainment of locomotor activity is still unclear. Finally given the widespread photosensitivity of the larval zebrafish, a central control could be exerted by a photosensitive brain nucleus in this species.

To begin addressing how photoentrainment is controlled in zebrafish we first tested the role of the retina using lakritz (lak) mutants in which all RGCs fail to develop and as such no connection exist between the eye and the CNS [32]. lak mutant larvae entrain to LD cycles and maintain rhythms of locomotor activity with a period similar to their control siblings in constant darkness (DD) and constant light (LL). While we detected no defect in phase shifting in response to a pulse of white light produced in the early subjective night (CT16) in lak -/- larvae, we observed a reduction of the phase shift induced upon a similar pulse of light at CT21 in lak mutants. Interestingly, the induction of the clock gene cry1a upon such a pulse of light is impaired in lak larvae compared to control siblings. The zebrafish possesses five melanopsin genes that are all expressed in the retina, including opn4xa and opn4b in larval RGCs [33,34]. In addition, melanopsin expression is detected in extra-retinal tissues. For instance, opn4xa is expressed in a subpopulation of projection neurons in the pineal gland. Interestingly these opn4xa+ projection neurons function in a LIGHT ON fashion while opn4xa- projection neurons function in a LIGHT OFF manner [35]. We engineered an opn4xa mutant in which the LIGHT ON response of the pineal is impaired; opn4xa -/- larvae successfully entrain to LD cycles and maintain rhythms of locomotor activity in constant conditions albeit with a reduction of period in LL. Pulses of white light at CT16 and CT21 induced similar phase shifts in opn4xa mutant and opn4xa/lak double mutant larvae compared to controls. Our results suggest that the function of the retina and the LIGHT ON response of the pineal gland are not absolutely required for circadian photoentrainment in zebrafish, thus further highlighting differences in the circadian system and circadian photoentrainment between mammals and zebrafish.

Results

The zebrafish eye is dispensable for the establishment of circadian rhythms

Photoentrainment in mouse and human requires a functional eye. We took advantage of lak mutant larvae that lack RGCs to address whether this role for the eye is conserved in the diurnal zebrafish. Homozygous lak mutant larvae lack neuronal connections between the eye and the brain and do not display an optomotor response [32,36,37]. The gene mutated in lak, encoding for the bHLH transcription factor ATOH7 (ATH5) is expressed exclusively in the developing retina [38]. The lak^th241allele we used bears a point mutation and functions as a null allele which results in a total absence of both RGCs and a neural connection between the eye and the brain [32]. We compared the locomotor activity of homozygous lak mutants with siblings (lak+/+ and lak+/-) in different illumination conditions. For each of these conditions, three independent experiments were performed. Within each independent experiment, the same number of homozygous mutants and control siblings were randomly selected and the mean of the three experiments was plotted. In this manner, the weight of each experiment within the final mean was identical between mutant and sibling populations.

In cycles of 14h light: 10h dark (hereafter referred to as LD), both siblings and lak homozygous mutant larvae exhibit rhythms of locomotor activity that are aligned with the LD cycles (Fig 1B). However, compared to sibling larvae, lak mutants show a specific reduction of activity during the day (Fig 1B and S1 Table). Sibling and lak mutant LD-entrained larvae placed in constant darkness (DD) demonstrate rhythms of locomotor activity with similar levels (Fig 1C and S2 and S3 Tables). In addition, the periods of the rhythms observed in DD did not significantly differ between the two populations (Fig 1D). The reduction in activity observed during the day in LD conditions thus does not affect the persistence of rhythmicity under free running conditions in DD.

Finally, in constant light (LL) conditions, the activity of siblings and lak larvae were similar (Fig 1E, 1F). The period of the lak mutant rhythm was slightly higher than the sibling rhythm but this difference was not significant (siblings: 24.93 ± 1.87 hours (n = 66), lak: 25.63± 2.1 hours (n = 68); mean ± S.D; p = 0.083; Mann-Whitney). Altogether these results suggest that retinal ganglion cells and therefore a neuronal connection between the eye and the brain are dispensable for the establishment of circadian rhythms, their correct alignment to LD cycles and their maintenance in free running conditions (DD or LL).

Absence of a functional eye differentially affects the induction of a phase delay and a phase-advance following pulses of light during the subjective night

To evaluate the role for RGCs in circadian photoentrainment, we assessed the phase-shifting effect of a pulse of white light on locomotor activity in lak larvae during the subjective night. We first chose to perform such a light pulse at CT16, as this was previously shown to induce a robust phase shift of the molecular clock in cell cultures [30,39]. After entraining for 5 LD cycles, larvae from lak+/- incrosses were further reared in DD and subjected to a pulse of light during the second night in DD (“PD larvae”). Their activity was compared with the activity of larvae kept in the dark for 4 days (“DD larvae”). To analyze if a phase shift was induced, we calculated the difference of phase between the two last days (“after the light pulse”) and the two first days (“before the light pulse”), a value we refer to as “Δphase” (Fig 2A). We found that a 2-hours pulse of light at CT16 induced a phase delay of locomotor activity rhythms in larvae, as the Δphase of PD larvae was higher than the one of DD larvae (Fig 2B and Table 1). When the difference between the Δphase of pulsed larvae minus the Δphase of larvae placed in DD was calculated, it suggests a phase delay of 2.94 hours on average in PD larvae. Finally, we determined that control and lak mutant larvae exhibit a similar phase shift in locomotor activity (Fig 2C and Table 1) suggesting that RGCs are not necessary for the circadian photoentrainment of locomotor activity to a pulse of light at the beginning of the subjective night (CT16).

Fig 2 — A) Experimental design of phase delay (PD) experiments. White rectangles represent the day or light pulse period, black rectangles represent the night period and dark grey rectangles represent the subjective day. For each experiment, larvae are entrained for 5 LD cycles, the larvae are therefore 5dpf at the beginning of locomotor activity measurements. Locomotor activity is tracked either in constant darkness for 4 days (DD) or tracked in constant darkness for 4 days and subjected to a 2-hours pulse of light during the night of the 2nd day of constant darkness at CT16 (PD). The phase of locomotor activity is calculated for each larva before and after the timing of the pulse for DD and PD experiments and the Δphase (phase after the pulse–phase before the pulse) is calculated. B) Average distance moved by control larvae (mm/min over 10min) in DD and PD experiments. Mean ± SE. The Δphase calculated using the FFT-NLLS method of PD larvae is higher than the one of DD larvae (p<0.0001, Mann-Whitney two-tailed test), showing that the pulse of light induced a phase delay. C) Average distance moved merged from PD experiments represented in 10 min bins. Mean ± SE. The Δphase of control versus *lak* larvae calculated using the FFT-NLLS method is not significantly different (p = 0.24, Mann-Whitney two-tailed test). *lak* show lower levels of activity during the light pulse (p = 0.03, Mann-Whitney two-tailed test). D) Experimental design of phase advance (PA) experiments. The iconography is similar to A). PA-pulsed larvae were subjected to a one-hour pulse of light at CT21. E) Average distance moved of control larvae (mm/min over 10min) in DD and PD experiments Mean ± SE. The Δphase calculated using the FFT-NLLS method is negative in PA-pulsed larvae and statistically different from DD larvae (p<0.0001, Mann-Whitney two-tailed test), showing that the pulse of light induced a phase advance. F) Average distance moved merged from PA experiments represented in 10 min bins. Mean ± SE.

Table 1. Quantification of the phase shifts in control siblings versus lak-/- (lak) larvae kept in DD or submitted to pulses of white light at CT16 or CT21.

The Δphase is the difference between the phase of the two last cycles and the phase of the two first cycles. A phase shift is observed in DD owing to the period that is close to 25 hours which generates a ~1 hour-shift every cycle. Upon a pulse of light at CT16 or CT21 a statistical difference is observed between DD and pulsed sib larvae as well as lak and sib larvae when the pulse of light is applied at CT21 (****, p<0,0001; *, p<0,05 using a Mann-Whitney two-tailed test). For each type of paradigm, (DD, PD and PA) three independent experiments were pooled.

Condition	Δphase Mean±S.D (n)	P value Mann-Whitney two-tailed test
DD sib	1.9±2.56 (73)
PD-pulsed sib	4.84±1.90 (46)	Sib: PD vs DD: ****
PD-pulsed lak	5.72±2.32 (37)	PD lak vs sib: 0.24
PA-pulsed sib	-1.83±7.84 (86)	Sib: PA vs DD: ****
PA-pulsed lak	-0.56±4.49 (29)	PA lak vs sib: *

Open in a new tab

We next performed a pulse of light at the end of the subjective night. A one- hour pulse induced a phase advance that could be detected during the second circadian cycle after the pulse (Fig 2D and 2E). Since this phase shift is not seen during the first cycle, we analyzed larvae over an additional cycle in order to obtain enough data to perform a robust phase calculation. The difference between the Δphase of pulsed larvae (PA) minus the Δphase of larvae placed in DD alone suggests that this paradigm induced a phase advance of at least 3.7 (1.8 +1.9) hours on average. While lak -/- larvae showed a phase advance upon a pulse of light at CT21 (Fig 2F and Table 1), this phase shift was weaker than that induced in control larvae (Δphase = -1.8 ± 7.84 for siblings versus Δphase = -0.56 ± 4.49 for lak -/- larvae). Although this difference in phase shift between lak and siblings is difficult to observe on the graph representing all the animals, it is more apparent when comparing only the records of animals for which a phase was successfully extracted before and after the pulse (Figs 2F and S1). These results suggest that a phase advance can occur in absence of RGCs although the eye contributes to photoentrainment in this context. Altogether, our results suggest that although phase advances and delays can occur in absence of RGCs, the absence of these cells specifically affect the response in a phase advance paradigm.

To analyse a role for RGCs during masking we calculated the activity of control and lak larvae during the pulses of light performed at CT16 and CT21. Interestingly, lak larvae showed a reduced level of activity compared to control larvae during the pulse performed at CT16 but not at CT21 (CT16: Fig 2C, siblings: 28.33 ± 19.26 mm/min over 10min (n = 62), lak: 21.45 ± 12.27 mm/min over 10min (n = 51); p = 0.03; Mann-Whitney two-tailed test; CT21: Fig 2F siblings: 16.51 ± 10.9 mm/min over 10min (n = 51), lak: 17.17 ± 7.85 mm/min over 10min (n = 62); p = 0.75). These results showed that RGCs are involved in masking in the zebrafish larvae but in a circadian dependent manner.

lak mutation affects the induction of cry1a following a pulse of white light at CT21

To decipher the molecular mechanism underlying the reduction of a phase advance induced by a pulse of white light at CT21 in lak larvae, we looked at the expression of per2 and cry1a in pulsed and control (‘Dark’) embryos at CT22. Indeed, these two genes are strongly induced by light and thought to participate in the molecular mechanism of photoentrainment [40–43]. Control embryos show expression of per2 in the telencephalon independently of the administration of a light pulse (Fig 3A and 3B) and lak larvae show a similar expression compared to control (Fig 3C and 3D). In control and pulsed embryos, three different patterns of cry1a can be distinguished (Fig 3E, 3F and 3G): some larvae show no expression (Fig 3E), some exhibit a mild expression in the tectum and expression in the pineal (Fig 3F) while other larvae show a strong expression in the tectum, the eye, the telencephalon, habenulae and pineal (Fig 3G). In absence of a light pulse, both control and lak larvae show an absence of detectable expression of cry1a, or more rarely a mild expression. In contrast the administration of a light pulse leads to 100% larvae exhibiting a high level of expression, suggesting that cry1a is induced by a light pulse at CT21. This induction is much less important in lak larvae with only 14.3% larvae showing a strong expression pattern after a pulse of light.

Fig 3 — *cry1a* but not *per2* expression is induced upon a pulse of white light at CT21 (A-G) Expression of *per2 (*A-D) or cry1a (E-G) at CT22 in 7 days old larvae. Before fixation for *in situ* at CT 22 the larvae were treated exactly like in the experiment described in Fig 2D, meaning that they were not depigmented before the light pulse which was administered from CT21 and CT22 (CT 22 pulse). In parallel, larvae from the same litter were maintained in the dark and fixed at CT22 (CT 22 dark). (A-D) The white ellipse identifies the pineal gland where no expression is observed. ctl DARK: n = 3, ctl PULSE n = 7, *lak* DARK: n = 4, *lak* PULSE: n = 7. Scale bar: 50 μm. (E-G) Three different expression patterns can be identified with the *cry1a* probe, The grey ellipse surrounds the pineal which expresses cry1a in the ‘mild’ and ‘high’ patterns, the two dark ellipses in G surrounds the habenulae which express *cry1a* in the ‘high’ pattern. Tel = Telencephalon, Tec = Optic tectum. Scale bar: 200 μm. (H) Countings of the repartition of Dark and Pulsed 7 days old larvae at CT22 stained with the *cry1a* probe, ctl DARK: n = 10, ctl PULSE n = 4, *lak* DARK: n = 5, *lak* PULSE: n = 7. Ctl DARK versus Ctl PULSE: p = 0.0010, *lak* DARK versus *lak* PULSE: p>0.9999, ctl DARK versus *lak* DARK: p>0.9999, ctl PULSE versus *lak* PULSE: p = 0.0182 using Fisher test.

Altogether our results suggest that cry1a and not per2 is induced after a pulse of light at CT21 and that this cry1a induction is impaired in lak larvae.

opn4xa function contributes to endogenous period setting in LL

As circadian rhythms of locomotor activity are established and photoentrain in absence of RGCs, albeit with less efficiency, we wondered if opn4xa+ projection neurons present in the pineal gland could play a role in the establishment and photoentrainment of circadian rhythms [35]. We, thus, generated a mutant allele for opn4xa via CRISPR/Cas9 genome editing using guide RNAs targeting the second coding exon. Amongst various alleles that were generated, we selected an allele that displays a 17 nucleotides insertion for further analysis (Fig 4A). The protein encoded from this allele is predicted to contain a premature stop codon (S2A Fig) leading to a truncation of the protein in the middle of the second transmembrane domain (S2B Fig), which should result in a protein devoid of a G protein interaction domain. We have verified that the two alternative ORFs also generate a truncation from the mutated allele (S2C Fig) and that the use of an alternative ATG present in both the wt and the mutant allele also leads to a truncation (S2D Fig). Finally, we have used Spliceator as to verify that the mutation does not generate alternative splicing sites (Spliceator (lbgi.fr)) We therefore predicted production of a null allele. Homozygous animals were viable and fertile.

Fig 4 — **Mutation in *opn4xa* abolishes light sensitivity in pineal *opn4xa*+ cells** (A) Scheme showing the 5’ part of the *opn4xa* locus and in particular the second exon targeted by the CRISPR guide RNA (target sequence is highlighted in red) as well as the WT and mutant exon2 sequences. (B-C) Counts of the number of *opn4xa*+ in the RGC layer (B) and the interneuron layer of the retina (C) after in situ hybridization at 4 days (ZT0) (D) Expression of *opn4xa* in the pineal at 4 days (ZT0) (upper panel) and expression of *fos* at 3 days after 30 min of illumination (lower panel) Red arrowheads point to individual labelled pineal cells. Dorsal views are shown, anterior is up (E) Counts of the number of *opn4xa*+ pineal cells. Scale bars respectively represent 10 μm (B) and 5 μm (C-D). n.s: not significant, see results section for details.

We first looked at the expression of opn4xa in the retina of opn4xa+/+ and opn4xa -/- larvae. The RGC layer contained an average of 33 to 44 opn4xa+ cells (S3A–S3E Fig), which number did not significantly vary between the different time points suggesting an absence of diel rhythm in this layer. Surprisingly, we observed a previously undescribed expression of opn4xa in the interneuron layer with numerous cells at 4dZT0 and 5dZT0 and very few cells at the other ZT time points (S3A–S3D and S3F). The number of opn4xa+ cells in both the RGC and the interneuron layer are normal in the opn4xa -/- retina (Figs Fig 4B, 4C, S4A and S4B RGC layer: opn4xa +/+: 26.17 ± 7.33, n = 6; opn4xa-/-: 23.8±6.92, n = 10; p = 0.42 using a Mann-Whitney two-tailed test; interneurons layer: opn4xa +/+: 26.33± 11.5; opn4xa-/-: 22.9±7.19; p = 0.63 using a Mann-Whitney two-tailed test). Similarly, we have observed that the number of opn4xa + pineal cells were similar in opn4xa +/+ and opn4xa -/- larvae (Fig 4D and 4E (opn4xa +/+: 4.33±1.51 n = 6, opn4xa-/-: 4.75± 1.98 n = 9, p = 0.85 using a Mann-Whitney two-tailed test). In addition, pineal opn4xa+ cells express the Wnt effector tcf7 [35]. At 6 days post fertilization, the opn4xa-/- pineal gland displayed normal expression of tcf7 (opn4xa +/+: 5.5 ± 2,5 (n = 4), opn4xa-/-: 6± 3 cells (n = 3); mean ± S.D; S4C and S4D Fig). Upon illumination with a 30 min pulse of light, fos is expressed in 2–5 cells of the pineal gland (Fig 4D). We have previously shown that this expression corresponds to opn4xa+ cells [35]. On the other hand, fos expression is virtually absent in the pineal gland of opn4xa-/- embryos after a 30 min pulse of light (Fig 4D; at 3 days opn4xa +/+: 4.8 ± 0.8 (n = 9), opn4xa-/-: 0.25 ± 0,7 cells (n = 8) per pineal; at 7 days opn4xa +/+: 5.9 ± 3,5 (n = 9) opn4xa-/-: 0.4 ± 0,7 cells (n = 13); mean ± S.D). Altogether our results suggest that opn4xa-/- larvae contained normal numbers of opn4xa+ cells in the retina and the pineal gland but have lost expression of fos following a 30 mn light pulse. We therefore used the opn4xa mutant as a model in which the pineal ON response is impaired.

To identify a role for opn4xa in the control of circadian rhythms, we analysed locomotor behaviour of opn4xa-/- larvae under various illumination regimes. Similar to the analysis we performed in lak larvae, for each of these conditions, three independent experiments were performed. Within each independent experiment, the same number of opn4xa -/- and opn4xa +/+ siblings were randomly selected and the mean of the three experiments was plotted. We found that opn4xa -/- larvae still entrained to LD cycles and did not show any difference in levels of locomotor activity when compared to their opn4xa +/+ siblings (Fig 5B and S5 Table). In addition, opn4xa-/- larvae were able to maintain rhythms of locomotor activity with a similar frequency and period as wild-type larvae in DD (Fig 5C and 5D and S6 Table). opn4xa-/- larvae placed in LL still showed circadian rhythms of locomotor activity (Fig 5E and 5F) but with several alterations. First, opn4xa-/- larvae were significantly more active during the first night (S8 Table). More importantly, in LL the period was shorter for opn4xa-/- larvae compared to controls using both the FFT-NLLS (opn4xa+/+: 25.31 ± 3.29 hours (n = 65), opn4xa-/-: 24.71 ± 3.32 hours (n = 64); p = 0.041; Mann-Whitney two-tailed test) and mFourfit methods (opn4xa+/+: 25.84 ± 1.60 hours (n = 66), opn4xa-/-: 25.12 ± 1.739 hours (n = 66); p = 0.012). Altogether these results suggest that opn4xa contributes to endogenous period setting in LL.

Fig 5 — A) Experimental design of LD, DD and LL experiments. White rectangles represent the day period, black rectangles represent the night period, dark grey rectangles represent the subjective day period and light grey rectangles the subjective night. For each experiment, larvae are entrained for 5 LD cycles and their locomotor activity is tracked either in LD (LD), constant darkness (DD) or constant light (LL) the larvae are therefore 5dpf at the beginning of locomotor activity measurements. B) Average distance moved (mm/min over 10min) of 3 independent experiments in LD. Mean ± SE. The distance moved is not different in *opn4xa+/+* and *opn4xa-/-* larvae during the 1st (p = 0.73), 2nd days (p = 0.50) and 3rd days (p = 0.07) nor during the 1st (p = 0.30), and 2nd nights (p = 0.27) (S4 Table). A lower level of activity is found in *opn4xa*-/- larvae during the 3rd night (p = 0.01) but is visually clear in only one of the 3 independent experiments (Mann-Whitney two-tailed test). C) Average distance moved (mm/min over 10min) of 3 independent experiments in DD. Mean ± SE. D) Estimation of the periods using the FFT-NLLS method calculated over four cycles. The mean period is not significantly different between control and *opn4xa*+/+ and *opn4xa-/-* larvae in DD (*opn4xa+/+*: 25.05 ± 1.43 hours (n = 64), *opn4xa-/-*: 25.35 ± 1.60 hours (n = 60); mean±SD; p = 0.29; Mann-Whitney two-tailed test). Mean± sd (in hours) is represented. Each grey point represents a larva. E) Average distance moved (mm/min over 10min) of 4 independent experiments in LL. Mean ± SE. *opn4xa*-/- are more active than controls during the first night (p = 0.02, see S6 Table). F) Estimation of the periods using the FFT-NLLS method calculated over three cycles. The mean period is significantly different between *opn4xa*+/+ and *opn4xa-/-* larvae in LL. Mean± sd (in hours) is represented. Each grey point represents a larva.

Since opn4xa-/- larvae showed a slight hyperactivity during the first night as well as a subtle period phenotype in LL, we began to analyse the possible molecular mechanisms behind these effects using RTqPCR (Fig 6). Analysis of clock gene expression in opn4xa-/- versus wt background reveal normal rhythms of clock genes expression in LD except for a slight increase in tefa and cry1a in opn4xa -/- larvae (Fig 6B and 6D). In LL after training, the expression of bmal1a was higher in opn4xa -/- than in wt larvae (Fig 6A). Interestingly, the expression of some Bmal1a direct targets (cry1a, dec1) was also increased (Fig 6B and 6C) while expression of nr1d2a, per1a, per1b, per2 remain unchanged (Fig 6E-H). Overall, only subtle and specific molecular phenotypes were detected in opn4xa -/- larvae in LL. In addition, their relation to the locomotor activity phenotypes is not clear.

Fig 6 — Mean expression relative to beta actin ± s.d. Three pools of larvae were used for each time point. ‘wt’ refers to pool of larvae from crosses of *opn4xa*+/+ animals (siblings of the *opn4xa*-/- fishes used for the *opn4xa*-/-points). Larvae were exposed to LD cycles (until d6 21h) followed by a LL cycle (from d6 21h to d7 18h). The grey rectangles represent the night phase, the yellow rectangles represent the subjective night in the LL cycle. The data were analysed using two-way ANOVAs which revealed time-genotype interaction for *bmal1a* and *cry1a*, as well as statistical differences between genotypes for specific time points using Bonferroni post-hoc tests. p< 0.05; ** p< 0.001; ***p< 0.0005.

opn4xa function is dispensable for photoentrainment to a pulse of white light during the subjective night

We next assessed the ability of pulses of white light at CT 16 and CT21 to induce phase shifts in an opn4xa-/- background. We observed that under such conditions opn4xa-/- larvae shift their activity to the same extent as their wild-type siblings (Fig 6 and Table 2). Furthermore, opn4xa-/- larvae did not show any difference in the level of activity during the pulses of light at CT16 or CT21 compared to wildtype siblings, implying that photosensitivity controlled by opn4xa is not required for masking (CT16, Fig 7B, opn4xa+/+: 20.30 ± 10.03 mm/min over 10min (n = 58), opn4xa-/-: 19.42 ± 10.76 mm/min over 10min (n = 58); p = 0.56; Mann-Whitney two-tailed test. CT21: Fig 7D, opn4xa+/+: 12.85 ± 6.80 mm/min over 10min (n = 44), opn4xa-/-: 16.54 ± 8.55 mm/min over 10min (n = 44); p = 0.47). These results show that the intrinsic photosensitivity of opn4xa expressing cells is not necessary for circadian photoentrainment or masking.

Table 2. Quantification of the phase shifts in opn4xa+/+ versus opn4xa-/- larvae kept in DD or submitted to a 2 hours pulse of white light at CT16.

As for Table 1, the Δphase is the difference between the phase of the two last cycles and the phase of the two first cycles. A Phase shift was observed in DD owing to the period that is close to 25 hours which generates a ~1 hour-shift every cycle. Phases were calculated with the FFT-NLLS method. Upon a pulse of light at CT16 or CT21 a statistical difference was observed between DD and pulsed ctrl larvae (****, p<0.0001 using a Mann-Whitney two-tailed test). In both phase delays (PD, pulse of light at CT16) and phase advance paradigms (PA, pulse of light at CT21), no statistical difference between opn4xa+/+ and opn4xa-/- was observed using a Mann-Whitney two-tailed test. For each type of paradigm (DD, PD and PA) three independent experiments were pooled.

Condition	Δphase Mean±S.D (n)	P value Mann-Whitney two-tailed test
DD opn4xa +/+	1.64±2.92 (39)
PD-pulsed opn4xa +/+	4.73±2.63 (36)	opn4xa +/+: PD vs DD: ****
PD-pulsed opn4xa -/-	5.23±4.81 (35)	PD opn4xa -/- vs opn4xa +/+: 0.32
PA-pulsed opn4xa +/+	-2.61±4.05 (60)	opn4xa +/+: PA vs DD: ****
PA-pulsed opn4xa-/-	-2±2.88 (20)	PA opn4xa -/- vs opn4xa +/+: 0.39

Open in a new tab

Since neither the absence of RGCs (Fig 2) nor the loss of opn4xa-dependent photosensitivity (Fig 7) abolished the capacity of larvae to photoentrain to pulses of light performed in the early or late subjective night, a possible compensation could occur between RGCs and opn4xa expressing cells of the pineal gland. To begin addressing this question, we tested photoentrainment properties of lak-/-; opn4xa-/- larvae (referred to as ‘double’). Compared to lak simple mutants, double mutants did not show an attenuated phase shift response to pulses of light at CT16 or CT21 (Fig 8). This suggests that other photosensitive cells mediate photoentrainment in zebrafish.

Fig 8 — A) Experimental design of phase shift experiments. White rectangles represent the day or light pulse period, black rectangles represent the night period and dark grey rectangles represent the subjective day. For each experiment, larvae are entrained for 5 LD cycles the larvae are therefore 5dpf at the beginning of locomotor activity measurements. Locomotor activity is tracked either in constant darkness for 4 days (DD) or tracked in constant darkness for 4 days and subjected to a 2-hours pulse of light during the night of the 2nd day of constant darkness (PD). The phase of locomotor activity is calculated for each larva before and after the timing of the pulse for DD and PS experiments and the Δphase (phase after the pulse–phase before the pulse) is calculated. B) Average distance moved (mm/min over 10min) of 3 independent PD experiments (n = 27 for *lak* -/- referred as *lak* and n = 27 *lak-/-; opn4xa-/-* larvae referred as ‘double’). Mean ± SE. The Δphase of *lak* and double larvae calculated with the FFT-NLLS method are not significantly different (see Table 3). C) Experimental design of phase advance (PA) experiments. The iconography is similar to A). After 5 training cycles in LD, PA-pulsed larvae were subjected to a one-hour pulse of light at CT21. D) Average distance moved (mm/min over 10min) of 3 independent PA experiments (n = 27 for *lak* and n = 27 double larvae). Error bars represent SE. The Δphase of *lak* and double larvae calculated with the FFT-NLLS method are not significantly different (see Table 3).

Table 3. Quantification of the phase shifts in lak versus double mutant larvae kept in DD or submitted to pulses of white light at CT16 or CT21.

As for Tables 1 and 2, the Δphase is the difference between the phase of the two last cycles and the phase of the two first cycles. A Phase shift is observed in DD owing to the period that is close to 25 hours which generates a ~1 hour-shift every cycle. Phases were calculated with the FFT-NLLS method (biodare2.ed.ac.uk). Upon a pulse of light at CT16 or CT21 a statistical difference is observed between DD and pulsed lak larvae (****. p<0.0001 using a Mann-Whitney two-tailed test). In both phase delays (PD, pulse of light at CT16) and phase advance paradigms (PA. pulse of light at CT21), no statistical difference between lak and double larvae is observed using a Mann-Whitney two-tailed test. For each type of paradigm DD, PD and PA three independent experiments were pooled.

Condition	Δphase Mean±S.D (n)	P value Mann-Whitney two-tailed test
DD lak	2.143±2.09 (31)
PD-pulsed lak	5.72±2.32 (37)	lak: PD vs DD: ****
PD-pulsed double	4.90±2.23 (14)	PD double vs lak: 0.33
PA-pulsed lak	-0.57±4.49(29)	lak: PA vs DD:****
PA-pulsed double	-3.16±4.9 (16)	PA double vs lak: 0.24

Open in a new tab

Finally, lak and lak/opn4xa double mutant larvae show similar levels of activity during the light pulse both at CT 16 and CT21 (CT16: lak: 18.23 ± 8.65 mm/min over 10min (n = 27), double: 19.79 ± 12.39 mm/min over 10min (n = 27); p = 0.94, CT21: lak: 17.46 ± 6.65 mm/min over 10min (n = 27), double: 16.8 ± 8.05 mm/min over 10min (n = 27), p = 0.42, Mann-Whitney two-tailed test). This suggests an absence of redundancy between RGC and opn4xa photosensitivity for masking of locomotor activity.

Discussion

Experiments performed in mouse have established a role for melanopsin expressing cells of the eye in mediating light input to the circadian rhythm in mammals. In addition to the eye, non-mammalian vertebrates exhibit several extraocular sites of photoreception, raising the question of the relative impact of those different inputs. Herein we show that circadian rhythms of locomotor activity are established and photoentrain in the absence of RGCs in zebrafish larvae. Furthermore, our results show that the absence of a functional eye affects masking, but in a circadian dependent manner. As zebrafish also possesses melanopsin expressing cells in their pineal gland [35], we engineered an opn4xa mutant line to address the role of opn4xa-dependent photosensitivity in this structure. Our data suggests that opn4xa is neither involved in masking nor in the establishment/photoentrainment of circadian rhythms. While our analysis does not support a redundant role for RGCs and opn4xa photosensitivity during photoentrainment of circadian rhythms it reveals a subtle function of opn4xa-dependent photosensitivity, possibly in the pineal, in the control of period length of circadian rhythms in constant light.

Subtle defects in opn4xa-/- mutants in LL

While no differences in period or amplitude of locomotor rhythms are observed for opn4xa mutant larvae in DD, subtle alterations are observed in LL. Abrogation of opn4xa activity reduces the increase of period length observed when larvae are placed in LL. A similar defect is observed in Opn4-/- mice placed in constant light condition [8,9] suggesting this could be a conserved function of melanopsin. Interestingly, this phenotype is not observed in lak mutant suggesting that in zebrafish this melanopsin function might involve the pineal gland rather than the eye. While the effect of opn4xa mutation on period length in LL is subtle, such an effect is not at all observed in DD. We see two possible hypotheses. First, opn4xa homozygous larvae could sense less light than controls and since period shows a reverse correlation with the intensity of light exposure [44,45], it could result in a lower period. A second hypothesis is that the opn4xa -/- clock is less stable in LL compared to DD. Indeed, we observed a stronger dampening of the circadian rhythms in LL compared to DD especially when four cycles were filmed and despite a moderate light intensity (20 lux). Along the same line, the variation observed for the periods are higher in LL than in DD for both control and mutant larvae suggesting again less robustness in clock activity in constant light conditions.

While we have analysed the expression of clock genes our results did not yield a clear molecular explanation for the opn4xa -/- period phenotype in LL. Indeed opn4xa -/- larvae only show a modest increase in Bmal1a, cry1 and dec1 expression in LL (Fig 5). A loss of dec1 using morpholino antisense technology suggests a role for this gene in controlling circadian rhythms of locomotor activity induced by a light pulse but a role for this gene in period control in LL has not been addressed [46]. Along the same line a double mutant line for per2 and cry1a exhibit deficits in the generation of rhythms following a light pulse but the role of cry1a during period control in LL has not been addressed [47]. In contrast, per2 regulates period length in constant light but its transcription is not affected in opn4xa-/- larvae ([48,49]; Fig 6G)); it is however possible that affecting the level of CRY1A could modify PER2 activity therefore leading to the observed phenotype. Further experiments will be required to address this question.

RGCs, but not opn4xa, are involved in masking

Compared to their control siblings, we found lak mutant larvae to be less active during the light phases of LD cycles as well as when subjected to a pulse of light at CT16 but not at CT21. This reveals a role for RGCs in positive masking in zebrafish larvae as well as a circadian control of this masking activity. It is important to note that while we refer to this as an effect of ‘masking’, it is at this step impossible to distinguish whether the lak mutation impairs the arousing effect of visual stimuli or the arousing effect of light itself. Moreover, masking is not completely abolished in lak mutant larvae: in LD as well as during a light pulse at CT 16, lak mutant larvae still show some masking, albeit at a reduced level and masking is not affected in these larvae at CT21. Could opn4xa photosensitivity from the pineal compensate for the lack of RGCs? opn4xa -/- larvae display no defect in masking of locomotor activity in LD or during a pulse of light suggesting that opn4xa-dependent photosensitivity is dispensable for this type of masking. In addition, lak; opn4xa double mutants show a similar activity to lak-/- larvae during a pulse of light at CT16 and CT21, suggesting that there is no redundancy between the eye and opn4xa+ cells in the pineal for masking control. Other photosensitive cells are thus involved in this process. Among these could be the classical photoreceptors of the pineal or deep brain photoreceptors, such as those involved in the locomotor response to a loss of illumination [50].

A Differential Role for RGCs in controlling phase advance versus phase delays in the rhythms of locomotor activity?

lak mutant larvae show a reduced phase-advance but no defect in a phase delay paradigm which could indicate a specific role for the RGC in controlling photoentrainment in a phase-advance context. On the other hand, lak mutant larvae display less aggregated pigment granules than siblings (S5 Fig). Could this impact the way light penetrates their body? While this remains a possibility, we do not think it is a very likely hypothesis since 1. even in lak mutant there are rather wide pigment-free areas over the fish brain and in particular over the pineal (S5B Fig) 2.light can still penetrate from the side of the body as pigments are found only on the dorsal and ventral most epidermis (S5C Fig). Experiments aiming at targeting different RGC subpopulations will help consolidate the role of the eye in controlling phase advances as well as identifying downstream circuits.

Finally, our results show an induction of cry1a upon a pulse of light at CT21 and a strong reduction of this induction in lak larvae, which suggests an involvement of this gene in the molecular mechanism of phase advance induction, as previously suggested for the molecular rhythms in cell cultures [39]. In contrast, per2 was not induced in our phase advance paradigm despite previous evidences for per 2 induction by light at different developmental stages and circadian time [43]. Our results thus highlight an additional layer of complexity in the mechanisms of per2 regulation by light.

RGCs and opn4xa are largely dispensable for shifting circadian rhythms of locomotor activity in response to a pulse of white light

The present study shows that neither the eye nor opn4xa mediated photosensitivity in the pineal gland is absolutely required for the development of circadian rhythms and circadian photoentrainment. The absence of a strong requirement for the eye to control the circadian system in zebrafish is surprising given that Astyanax mexicanus blind cavefishes are arrhythmic in DD [27] while Phreatichthys andruzzii adult cavefishes, which also exhibit a complete eye degeneration, and are arrhythmic in LD when fed at random times [28]. In light of our data, we propose that apart from the eye, other photosensitive structures might be affected in these other fish species. This in turn brings the question of which structure(s) relay light information to control circadian rhythm in fishes and other non-mammalian animals? The pineal gland, with its classical photoreceptors and opn4xa+ projection neurons is an appealing candidate [51]. Strategies aiming at genetically killing this structure or impairing its activity will surely help unravelling its function. Studies describing the effect of surgical pinealectomy have been reported in a number of non-mammalian vertebrates. The phenotypes induced seem to depend strongly on the species. For instance, pinealectomy abolishes rhythms in the stinging catfish but not in the amur catfish or the lake chub. Interestingly, in species where rhythms are maintained upon pinealectomy a change in period can occur (see [52] for a review). A similar variety of phenotypes are induced upon pinealectomy in reptiles or birds. In addition to the pineal gland, reptiles have a parietal eye, a structure that is developmentally and spatially related to the pineal gland. Interestingly simultaneous removal of the eye, the pineal gland and the parietal eye in two species of lizards (P. Sicula and S. olivaceous), does not impair rhythms of locomotor activity while on the contrary these rhythms are lost if in addition to this triple ablation injection of dark ink between the skin and the skull is performed [53]. Similarly, experiments in songbirds suggest the existence of additional photosensitive structures located in the brain that control photoentrainment [54]. Altogether these results highlight the existence of other brain structures mediating light inputs on the circadian system. Interestingly, melanopsin expression has been described in other brain areas in the zebrafish larva: opn4a is expressed within the presumptive optic area, opn4b is found in the ventral forebrain and the thalamic region, and opn4.1 is detected in a specific domain located in the ventricular region at the junction between the caudal hindbrain and the anterior spinal cord [34,50]. Larvae double mutant for opn4.1 and opn4xb show a decreased locomotor activity during the day but no circadian phenotype [55]. As 42 opsin genes are predicted in the zebrafish genome, of which 20 are expressed in the adult brain [56], further characterization of their expression in the larval brain will be needed to define the best candidates for further study. Finally, the possibility remains that photoentrainment in zebrafish occurs as a result of direct photosensitivity of motoneurons or muscles themselves as all cells and organs have been shown to be directly photosensitive and light-entrainable in this species (see [57] for a review).

Taken together, our results highlight profound differences in the establishment and photoentrainment of the circadian system between the diurnal zebrafish and other species such as mice and human. A crucial, yet open question is whether these divergences reflect the different phylogeny of these species or their different use of temporal niches. The photosensitive capabilities of the zebrafish in particular and of aquatic species in general (as judged by the number of opsins predicted in the genome) far exceed that observed in mammals. This could imply a greater level of complexity and robustness in circadian control in zebrafish independently of its temporal niche. However, the human brain also expresses opsins (OPN3 and OPN5; [58,59]) suggesting the existence of deep brain photoreceptors in diurnal primates and the possibility that they participate in photoentrainment.

Material and methods

Ethics statement

All animals were handled in the CBI fish facility, which is certified by the French Ministry of Agriculture (approval number A3155510). The project was approved by the French Ministry of Teaching and Research (agreement number APAFIS#3653–2.016.011.512.005.922).

Zebrafish lines and developmental conditions

Embryos were reared at 28 degrees in a 14h light/10h dark cycle with lights on at 9:00 and lights off at 23:00.

The lak mutant line has been described previously [32], lak homozygous mutants were identified by their dark coloration. Genotyping of lak individuals was performed as previously described ³².

Generation of an opn4xa mutant allele

An opn4xa mutant allele was generated using the CRISPR/ Cas9 targeted genome editing. For this. a target site was designed in the second exon by manual screening for PAM sites. Transcription of the guide and coinjection of the guide mRNA with cas9 mRNA was performed as described in [60]. Screening of potential mutants was performed using T7 endonuclease (NEB) treatment of PCR products amplifying the second opn4xa exon (Fw: 5’ CACAACATAAACTGTAACTGCATCC 3’, Rev: 5’ GACACGGGTATGACACTCAGGAAGG 3’). PCR products from potential carriers were subsequently subcloned and sequenced. In this manner we identified several interesting carriers among which an individual transmitting an allele bearing 17 extra nucleotides in the second exon leading to a premature interruption of the coding sequence.

To genotype opn4xa individuals, we used a classical PCR protocol with the following oligos: 5’-GGACGCCTCCAAACTTC-3’ (Forward) and 5’-CGAACACCCACTCCTTGTAC-3’ Reverse). PCR products of different sizes were obtained (110bp for the wt allele and 127bp for the mutant allele) and resolved on a 4% agarose gel.

Locomotor activity assays

Larvae zebrafish coming from heterozygous incrosses were raised on a 14:10 hr light:dark cycle at 28°C in Petri dishes with no more than 50 larvae per Petri dish in a water bath inside the fish facility. On the morning of their 5^th day of development (9:15–10:30), individual larvae were placed in each well of a 96-well plate containing aquarium fish water and placed back in the water bath. Light intensity during the entrainment was 110 lux at 6500K. On the evening (16:00–20:00), the plate was put in an hermetic box in a dark room maintained at 27°C with a heater. This home-made box [61] was continuously illuminated from below with two panels of infra-red lights as well as neutral white light (4000K, 20 lux at water surface)) controlled by a timer from 9:00 to 23:00. Larvae were then filmed at 30 frames per second, with a ceiling mounted infra-red camera connected to a computer on the following days (from the 6^th day of development to the 9^th or 10^th day of development) in controlled conditions of illumination. The temperature inside the box was monitored using an electronic programmable device (I Button. Maxim). After the experiment, larvae were either genotyped by PCR for opn4xa and/or lak and/or simply identified for the lak mutation using the dark coloration phenotype. In addition, larvae presenting developmental defects were discarded from the subsequent analysis. Experiments in which too many larvae presented development issues or where temperature issues were present were discarded. At least three experiments were made for each type of assay.

In situ hybridization

In situ hybridization was performed as described previously [62]. opn4xa, tcf7, cry1a and c-fos probes have been described (34,35,62,63). A per2 probe encompassing the entirety of the second exon was engineered using PCR with the following oligos: Forward primer: 5’-AAATCCGAGTGTCCGTCTGC-3’, Reverse primer with T7: 5’-TAATACGACTCACTATAGGGTCTTGTTGCTTCCCGATGAC-3’ followed by T7 transcription.

Locomotor activity analysis

After the experiment, the distance travelled per minute was extracted for each larva using the Ethovision XT13.0 (Noldus. Wageningen. the Netherlands) with the following parameters: for Detection Settings: dynamic substraction; subject color compared to background: Darker; Dark: 7 to 210; Frame Weight: 2; for Track Smoothing Profiles: Minimal Distance Moved: 0.2mm—Direct (A>MDM); for Data Profiles: Results per time bin. Ignore last time bin if incomplete; for Analysis Profiles: Distance moved of the center-point. The obtained files were then analysed using the wakefish program (written in python by L.Sanchou) to extract an average activity of mm/min over 10min for each larva (‘DM10 files’). For each experiment, the same number of homozygous mutants and wild-type or control larvae were randomly selected. The Biodare software was used to calculate periods and phases for each larva (biodare2.ed.ac.uk). We choose to use the FFT-NLLS to calculate periods and phases on DM10 files after baseline detrending, as advised [63]. The parameters used for period calculation were as follows: baseline detrending, expected periods from 18 to 30 hours. analysis method FFT-NLLS. The parameters used for phase calculation were as follows: baseline detrending. FFT-NLLS, phase by fit, absolute phase to window. Windows used to calculate the phase of locomotor activity “before the pulse” and “after the pulse” encompass time points from CT0 to CT15 (corresponding from 9am of the 1^st day in of the experiment to midnight between the 2^nd and 3^rd day of the experiment for “before the pulse” and from 9am of the 3^rd day of the experiment to midnight between the 4^th and 5^th day of the experiment). Locomotor activity levels were calculated from the DM10 files by calculating means of the average activity in mm/min over 10 min over a given period for each larva. Statistical analysis was done using Prism. Graphs were generated using R studio (ggplot2 and rethomics packages [64,65]).

Analysis of clock gene expression using RTqPCR

For each specific stage, pools of 15 larvae were collected and extracted with TRIzol. Reverse transcription and qPCR were performed using a standard protocol [66] with the oligos detailed in S7 Table. All the experiments were performed in triplicates and the mean expression relative to beta actin was calculated. Three pools of larvae were used for each time point.

Supporting information

S1 Fig

(A) Average distance moved merged from PA experiments in 10 min bins. Mean ± SE. The original data is the same than in Fig 2 but here, only the larvae for which a phase could be extracted for the two first and the two last cycles were included in the average. In addition, two rounds of smoothing each using ten successive time points were applied as this made the difference in phase shift between the lak and the sib larvae easier to visualize.

(TIF)

pgen.1011172.s001.tif^{(5.1MB, tif)}

S2 Fig

(A) Prediction of the protein sequences produced by the wt and mutant exon 2. The part corresponding to the second transmembrane domain (34) is underlined. The red asterisk indicates a premature stop codon. (B) Models of the WT and mutant predicted OPN4XA proteins. (C) Using alternative ORFs leads to a premature stop codon (indicated with a star). (D) The use of an alternative ATG (bold) also leads to a truncated protein.

(TIF)

pgen.1011172.s002.tif^{(1.8MB, tif)}

S3 Fig. opn4xa is expressed in zebrafish RGCs and interneurons.

(A-D) Expression of opn4xa at 4days at different ZT using fluorescent in situ hybridization. Lateral view of mounted eyes imaged under the confocal microscope. The ventral side is oriented towards the left upper corner. Based on position, the opn4xa+ cells from the interneuron layer are most likely horizontal and amacrine cells. Scale bar: 10 μm. E) Number of opn4xa+ cells in the RGC layer in 96–128 hpf zebrafish larvae. All data follows a Gaussian distribution. No statistical differences were observed between the different time points using a one-way ANOVA with Bonferroni post hoc test. F) Number of opn4xa+ cells in the interneuron layer in 96–128 hpf zebrafish larvae. The data at 4dZT0 does not follow a Gaussian distribution. * p<0.05. ** p<0.001. *** p<0.0005 using a Kruskal-Wallis test with Dunn’s post hoc comparison.

(TIF)

pgen.1011172.s003.tif^{(2.4MB, tif)}

S4 Fig

Characterization of opn4xa-/- retina and pineal glands. (A-B) Expression of opn4xa in the retina of wt and opn4xa-/- larvae at 4days ZT0. The ventral side is oriented towards the downward left corner. (C-D) Expression of tcf7 in the pineal gland at 6 days using in situ hybridization in wt and opn4xa-/- larvae. Dorsal views are shown. Anterior is up. Scale bar: 10 μm.

(TIF)

pgen.1011172.s004.tif^{(2.6MB, tif)}

S5 Fig

Live lak and sibling larvae at 5 dpf showing the differences in pigmentation. (A-B) Dorsal views. (C) side views. The red arrow in B points to the position of the pineal gland which is not covered by pigments in lak and sib larvae. Scale bar: 0.5 mm.

(TIF)

pgen.1011172.s005.tif^{(2.7MB, tif)}

S1 Table

Activity of lakritz -/- versus control larvae in LD showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s006.docx^{(12.3KB, docx)}

S2 Table. Percent of rhythmic lak and sib larvae in DD and LL.

The difference between the ctl DD and the lak DD populations is not significant using a khi-two test p = 0.957, similar results are obtained between the ctl LL and the lak LL, p = 0,91.

(DOCX)

pgen.1011172.s007.docx^{(12KB, docx)}

S3 Table

Activity of lakritz -/- versus control larvae in DD showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s008.docx^{(12.4KB, docx)}

S4 Table

Activity of lakritz -/- versus control larvae in LL showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s009.docx^{(12.2KB, docx)}

S5 Table

Activity of opn4xa -/- versus control larvae in LD showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s010.docx^{(12KB, docx)}

S6 Table. Percent of rhythmic opn4xa -/- and ctl larvae in DD and LL.

The difference between the WT DD and the opn4xa-/- DD populations is not significant using a khi-two test, p = 0.06.

(DOCX)

pgen.1011172.s011.docx^{(11.9KB, docx)}

S7 Table

Activity of opn4xa -/- versus control larvae in DD showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s012.docx^{(12.2KB, docx)}

S8 Table

Activity of opn4xa -/- versus control larvae in LL showing the average distance travelled (mm/min) over a 10 min window averaged during the day (D) or the night (N) periods. Mean ± S.D. D1 corresponds to the first day. The p value and statistical significance using a two-tailed Mann-Whitney test is indicated.

(DOCX)

pgen.1011172.s013.docx^{(12.1KB, docx)}

S9 Table. qRTPCR primer sequences used in the study.

The right column indicates the ZDB gene ID (https://zfin.org).

(DOCX)

pgen.1011172.s014.docx^{(14.3KB, docx)}

S1 Data. Numerical data related to Fig 1.

(XLSX)

pgen.1011172.s015.xlsx^{(2.4MB, xlsx)}

S2 Data. Numerical data related to Fig 2.

(XLSX)

pgen.1011172.s016.xlsx^{(4MB, xlsx)}

S3 Data. Numerical data related to Fig 3.

(XLSX)

pgen.1011172.s017.xlsx^{(11.9KB, xlsx)}

S4 Data. Numerical data related to Fig 4.

(XLSX)

pgen.1011172.s018.xlsx^{(10.9KB, xlsx)}

S5 Data. Numerical data related to Fig 5.

(XLSX)

pgen.1011172.s019.xlsx^{(1.9MB, xlsx)}

S6 Data. Numerical data related to Fig 6.

(XLSX)

pgen.1011172.s020.xlsx^{(26.2KB, xlsx)}

S7 Data. Numerical data related to Fig 7.

(XLSX)

pgen.1011172.s021.xlsx^{(1.6MB, xlsx)}

S8 Data. Numerical data related to Fig 8.

(XLSX)

pgen.1011172.s022.xlsx^{(938.5KB, xlsx)}

S9 Data. Numerical data related to S1 Fig.

(XLSX)

pgen.1011172.s023.xlsx^{(1MB, xlsx)}

S10 Data. Numerical data related to S3 Fig.

(XLSX)

pgen.1011172.s024.xlsx^{(9.7KB, xlsx)}

S11 Data. Numerical data related to S4 Fig.

(XLSX)

pgen.1011172.s025.xlsx^{(8.2KB, xlsx)}

Acknowledgments

We are indebted to C. Rampon for allowing us to use the Ethovision Software as well as Julie Batut, Ouria Dkhissy Benyahya and Frederique Gaits-Iacovoni for helpful discussions. We thank M. Halpern, T. Dickmeis and K. Soanes for sharing probes. We would like to thank Brice Ronsin, Stéphanie Bosch and the Toulouse RIO Imaging platform; Stéphane Relexans, Aurore Laire and Richard Brimicombe for taking care of the fish as well as Sophie Polès for technical help.

Data Availability

All data are in the manuscript and/or supporting information files.

Funding Statement

This work was supported by the Centre National de la Recherche Scientifique (CNRS);the Institut National de la Santé et de la Recherche Médicale (INSERM) to P.B; Université de Toulouse III (UPS) to P.B; Fondation pour la Recherche Médicale (FRM, https://www.frm.org/en, grant number DEQ20131029166) to P.B; Fédération pour la Recherche sur le Cerveau (FRC, https://www.frcneurodon.org) to P.B; Association pour la Recherche sur le Cancer (ARC, https://www.fondation-arc.org) to P.B; D.S was a recipient of a fellowship from the Association Rétina France and C.C received a fellowship from the Ministère de la Recherche. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Bhadra B, N T, P D, M PB. Sleep medicine. 2017 [cited 2021 Oct 18]. Evolution of circadian rhythms: from bacteria to human. Available from: https://pubmed-ncbi-nlm-nih-gov.insb.bib.cnrs.fr/28619182/ [DOI] [PubMed]
2.Brzezinski JA, Brown NL, Tanikawa A, Bush RA, Sieving PA, Vitaterna MH, et al. Loss of Circadian Photoentrainment and Abnormal Retinal Electrophysiology in Math5 Mutant Mice. Invest Ophthalmol Vis Sci. 2005. Jul;46(7):2540–51. doi: 10.1167/iovs.04-1123 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Freedman MS, Lucas RJ, Soni B, Schantz M von, Muñoz M, David-Gray Z, et al. Regulation of Mammalian Circadian Behavior by Non-rod, Non-cone, Ocular Photoreceptors. Science [Internet]. 1999. Apr 16 [cited 2021 Oct 18]; Available from: https://www.science.org/doi/abs/10.1126/science.284.5413.502. [DOI] [PubMed] [Google Scholar]
4.Wee R, Castrucci AM, Provencio I, Gan L, Van Gelder RN. Loss of Photic Entrainment and Altered Free-Running Circadian Rhythms in math5−/− Mice. J Neurosci. 2002. Dec 1;22(23):10427–33. doi: 10.1523/JNEUROSCI.22-23-10427.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Hartley S, Dauvilliers Y, Quera-Salva MA. Circadian Rhythm Disturbances in the Blind. Curr Neurol Neurosci Rep. 2018. Aug 6;18(10):65. doi: 10.1007/s11910-018-0876-9 [DOI] [PubMed] [Google Scholar]
6.Lockley SW, Arendt J, Skene DJ. Visual impairment and circadian rhythm disorders. Dialogues Clin Neurosci. 2007;9(3):301–14. doi: 10.31887/DCNS.2007.9.3/slockley [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Sack RL, Lewy AJ, Blood ML, Keith LD, Nakagawa H. Circadian rhythm abnormalities in totally blind people: incidence and clinical significance. J Clin Endocrinol Metab. 1992. Jul;75(1):127–34. doi: 10.1210/jcem.75.1.1619000 [DOI] [PubMed] [Google Scholar]
8.Panda S, Sato TK, Castrucci AM, Rollag MD, DeGrip WJ, Hogenesch JB, et al. Melanopsin (Opn4) requirement for normal light-induced circadian phase shifting. Science. 2002. Dec 13;298(5601):2213–6. doi: 10.1126/science.1076848 [DOI] [PubMed] [Google Scholar]
9.Ruby NF, Brennan TJ, Xie X, Cao V, Franken P, Heller HC, et al. Role of melanopsin in circadian responses to light. Science. 2002. Dec 13;298(5601):2211–3. doi: 10.1126/science.1076701 [DOI] [PubMed] [Google Scholar]
10.Gompf HS, Fuller PM, Hattar S, Saper CB, Lu J. Impaired circadian photosensitivity in mice lacking glutamate transmission from retinal melanopsin cells. J Biol Rhythms. 2015. Feb;30(1):35–41. doi: 10.1177/0748730414561545 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Güler AD, Ecker JL, Lall GS, Haq S, Altimus CM, Liao HW, et al. Melanopsin cells are the principal conduits for rod-cone input to non-image-forming vision. Nature. 2008. May 1;453(7191):102–5. doi: 10.1038/nature06829 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Kofuji P, Mure LS, Massman LJ, Purrier N, Panda S, Engeland WC. Intrinsically Photosensitive Retinal Ganglion Cells (ipRGCs) Are Necessary for Light Entrainment of Peripheral Clocks. PLOS ONE. 2016. Dec 16;11(12):e0168651. doi: 10.1371/journal.pone.0168651 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Altimus CM, Güler AD, Villa KL, McNeill DS, Legates TA, Hattar S. Rods-cones and melanopsin detect light and dark to modulate sleep independent of image formation. Proc Natl Acad Sci U S A. 2008. Dec 16;105(50):19998–20003. doi: 10.1073/pnas.0808312105 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Belenky MA, Smeraski CA, Provencio I, Sollars PJ, Pickard GE. Melanopsin retinal ganglion cells receive bipolar and amacrine cell synapses. J Comp Neurol. 2003;460(3):380–93. doi: 10.1002/cne.10652 [DOI] [PubMed] [Google Scholar]
15.Calligaro H, Coutanson C, Najjar RP, Mazzaro N, Cooper HM, Haddjeri N, et al. Rods contribute to the light-induced phase shift of the retinal clock in mammals. PLoS Biol. 2019. Mar;17(3):e2006211. doi: 10.1371/journal.pbio.2006211 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Dkhissi-Benyahya O, Gronfier C, De Vanssay W, Flamant F, Cooper HM. Modeling the role of mid-wavelength cones in circadian responses to light. Neuron. 2007. Mar 1;53(5):677–87. doi: 10.1016/j.neuron.2007.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Dollet A, Albrecht U, Cooper HM, Dkhissi-Benyahya O. Cones Are Required for Normal Temporal Responses to Light of Phase Shifts and Clock Gene Expression. Chronobiol Int. 2010. May 1;27(4):768–81. doi: 10.3109/07420521003695704 [DOI] [PubMed] [Google Scholar]
18.Perez-Leon JA, Warren EJ, Allen CN, Robinson DW, Brown RL. Synaptic inputs to retinal ganglion cells that set the circadian clock. Eur J Neurosci. 2006. Aug;24(4):1117–23. doi: 10.1111/j.1460-9568.2006.04999.x [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Wong KY, Dunn FA, Graham DM, Berson DM. Synaptic influences on rat ganglion-cell photoreceptors. J Physiol. 2007. Jul 1;582(Pt 1):279–96. doi: 10.1113/jphysiol.2007.133751 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Baver SB, Pickard GE, Sollars PJ, Pickard GE. Two types of melanopsin retinal ganglion cell differentially innervate the hypothalamic suprachiasmatic nucleus and the olivary pretectal nucleus. Eur J Neurosci. 2008;27(7):1763–70. doi: 10.1111/j.1460-9568.2008.06149.x [DOI] [PubMed] [Google Scholar]
21.Fernandez DC, Chang YT, Hattar S, Chen SK. Architecture of retinal projections to the central circadian pacemaker. Proc Natl Acad Sci. 2016. May 24;113(21):6047–52. doi: 10.1073/pnas.1523629113 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Li JY, Schmidt TM. Divergent projection patterns of M1 ipRGC subtypes. J Comp Neurol. 2018. 01;526(13):2010–8. doi: 10.1002/cne.24469 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Chew KS, Renna JM, McNeill DS, Fernandez DC, Keenan WT, Thomsen MB, et al. A subset of ipRGCs regulates both maturation of the circadian clock and segregation of retinogeniculate projections in mice. Takahashi JS, editor. eLife. 2017. Jun 15;6:e22861. doi: 10.7554/eLife.22861 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Rupp AC, Ren M, Altimus CM, Fernandez DC, Richardson M, Turek F, et al. Distinct ipRGC subpopulations mediate light’s acute and circadian effects on body temperature and sleep. eLife [Internet]. 8. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6650245/ doi: 10.7554/eLife.44358 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Karnas D, Hicks D, Mordel J, Pévet P, Meissl H. Intrinsic Photosensitive Retinal Ganglion Cells in the Diurnal Rodent, Arvicanthis ansorgei. PLOS ONE. 2013. Aug 9;8(8):e73343. doi: 10.1371/journal.pone.0073343 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Mure LS. Intrinsically Photosensitive Retinal Ganglion Cells of the Human Retina. Front Neurol. 2021;12:636330. doi: 10.3389/fneur.2021.636330 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Beale A, Guibal C, Tamai TK, Klotz L, Cowen S, Peyric E, et al. Circadian rhythms in Mexican blind cavefish Astyanax mexicanus in the lab and in the field. Nat Commun. 2013. Nov 14;4(1):1–10. doi: 10.1038/ncomms3769 [DOI] [PubMed] [Google Scholar]
28.Cavallari N, Frigato E, Vallone D, Fröhlich N, Lopez-Olmeda JF, Foà A, et al. A Blind Circadian Clock in Cavefish Reveals that Opsins Mediate Peripheral Clock Photoreception. PLoS Biol [Internet]. 2011. Sep 6;9(9). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3167789/ doi: 10.1371/journal.pbio.1001142 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Carr AJF, Whitmore D. Imaging of single light-responsive clock cells reveals fluctuating free-running periods. Nat Cell Biol. 2005. Mar;7(3):319–21. doi: 10.1038/ncb1232 [DOI] [PubMed] [Google Scholar]
30.Vallone D, Gondi SB, Whitmore D, Foulkes NS. E-box function in a period gene repressed by light. Proc Natl Acad Sci U S A. 2004. Mar 23;101(12):4106–11. doi: 10.1073/pnas.0305436101 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Whitmore D, Foulkes NS, Sassone-Corsi P. Light acts directly on organs and cells in culture to set the vertebrate circadian clock. Nature. 2000. Mar;404(6773):87–91. doi: 10.1038/35003589 [DOI] [PubMed] [Google Scholar]
32.Kay JN, Finger-Baier KC, Roeser T, Staub W, Baier H. Retinal Ganglion Cell Genesis Requires lakritz, a Zebrafish atonal Homolog. Neuron. 2001. May 1;30(3):725–36. doi: 10.1016/s0896-6273(01)00312-9 [DOI] [PubMed] [Google Scholar]
33.Kölsch Y, Hahn J, Sappington A, Stemmer M, Fernandes AM, Helmbrecht TO, et al. Molecular classification of zebrafish retinal ganglion cells links genes to cell types to behavior. Neuron. 2021. Feb 17;109(4):645–662.e9. doi: 10.1016/j.neuron.2020.12.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Matos-Cruz V, Blasic J, Nickle B, Robinson PR, Hattar S, Halpern ME. Unexpected diversity and photoperiod dependence of the zebrafish melanopsin system. PloS One. 2011;6(9):e25111. doi: 10.1371/journal.pone.0025111 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Sapède D, Chaigne C, Blader P, Cau E. Functional heterogeneity in the pineal projection neurons of zebrafish. Mol Cell Neurosci. 2020. Feb 3;103:103468. doi: 10.1016/j.mcn.2020.103468 [DOI] [PubMed] [Google Scholar]
36.Covello G, Rossello FJ, Filosi M, Gajardo F, Duchemin A, Tremonti BF, et al. Transcriptome analysis of the zebrafish atoh7−/− Mutant, lakritz, highlights Atoh7-dependent genetic networks with potential implications for human eye diseases. FASEB BioAdvances. 2020. Jun 27;2(7):434–48. doi: 10.1096/fba.2020-00030 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Neuhauss SCF, Biehlmaier O, Seeliger MW, Das T, Kohler K, Harris WA, et al. Genetic Disorders of Vision Revealed by a Behavioral Screen of 400 Essential Loci in Zebrafish. J Neurosci. 1999. Oct 1;19(19):8603–15. doi: 10.1523/JNEUROSCI.19-19-08603.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Masai I, Stemple DL, Okamoto H, Wilson SW. Midline Signals Regulate Retinal Neurogenesis in Zebrafish. Neuron. 2000. Aug 1;27(2):251–63. doi: 10.1016/s0896-6273(00)00034-9 [DOI] [PubMed] [Google Scholar]
39.Tamai TK, Young LC, Whitmore D. Light signaling to the zebrafish circadian clock by Cryptochrome 1a. Proc Natl Acad Sci U S A. 2007. Sep 11;104(37):14712–7. doi: 10.1073/pnas.0704588104 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Hirayama J, Cardone L, Doi M, Sassone-Corsi P. Common pathways in circadian and cell cycle clocks: light-dependent activation of Fos/AP-1 in zebrafish controls CRY-1a and WEE-1. Proc Natl Acad Sci U S A. 2005. Jul 19;102(29):10194–9. doi: 10.1073/pnas.0502610102 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Vatine G, Vallone D, Appelbaum L, Mracek P, Ben-Moshe Z, Lahiri K, et al. Light directs zebrafish period2 expression via conserved D and E boxes. PLoS Biol. 2009. Oct;7(10):e1000223. doi: 10.1371/journal.pbio.1000223 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Weger BD, Sahinbas M, Otto GW, Mracek P, Armant O, Dolle D, et al. The light responsive transcriptome of the zebrafish: function and regulation. PloS One. 2011. Feb 15;6(2):e17080. doi: 10.1371/journal.pone.0017080 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Ziv L, Levkovitz S, Toyama R, Falcon J, Gothilf Y. Functional development of the zebrafish pineal gland: light-induced expression of period2 is required for onset of the circadian clock. J Neuroendocrinol. 2005. May;17(5):314–20. doi: 10.1111/j.1365-2826.2005.01315.x [DOI] [PubMed] [Google Scholar]
44.Aschoff J. Exogenous and endogenous components in circadian rhythms. Cold Spring Harb Symp Quant Biol. 1960;25:11–28. doi: 10.1101/sqb.1960.025.01.004 [DOI] [PubMed] [Google Scholar]
45.Ben-Moshe Livne Z, Alon S, Vallone D, Bayleyen Y, Tovin A, Shainer I, et al. Genetically Blocking the Zebrafish Pineal Clock Affects Circadian Behavior. PLoS Genet. 2016. Nov;12(11):e1006445. doi: 10.1371/journal.pgen.1006445 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Ben-Moshe Z, Alon S, Mracek P, Faigenbloom L, Tovin A, Vatine GD, et al. The light-induced transcriptome of the zebrafish pineal gland reveals complex regulation of the circadian clockwork by light. Nucleic Acids Res. 2014. Apr;42(6):3750–67. doi: 10.1093/nar/gkt1359 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Hirayama J, Alifu Y, Hamabe R, Yamaguchi S, Tomita J, Maruyama Y, et al. The clock components Period2, Cryptochrome1a, and Cryptochrome2a function in establishing light-dependent behavioral rhythms and/or total activity levels in zebrafish. Sci Rep. 2019. Jan 17;9(1):196. doi: 10.1038/s41598-018-37879-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Ruggiero G, Ben-Moshe Livne Z, Wexler Y, Geyer N, Vallone D, Gothilf Y, et al. Period 2: A Regulator of Multiple Tissue-Specific Circadian Functions. Front Mol Neurosci. 2021;14:718387. doi: 10.3389/fnmol.2021.718387 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Wang M, Zhong Z, Zhong Y, Zhang W, Wang H. The Zebrafish Period2 Protein Positively Regulates the Circadian Clock through Mediation of Retinoic Acid Receptor (RAR)-related Orphan Receptor α (Rorα). J Biol Chem. 2015. Feb 13;290(7):4367–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Fernandes AM, Fero K, Arrenberg AB, Bergeron SA, Driever W, Burgess HA. Deep brain photoreceptors control light seeking behavior in zebrafish larvae. Curr Biol CB. 2012. Nov 6;22(21):2042–7. doi: 10.1016/j.cub.2012.08.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Sapède D, Cau E. The pineal gland from development to function. Curr Top Dev Biol. 2013;106:171–215. doi: 10.1016/B978-0-12-416021-7.00005-5 [DOI] [PubMed] [Google Scholar]
52.Zhdanova IV, Reebs SG. Circadian Rhythms in Fish. Fish Physiology (Academic Press; ). 2005;197–238. [Google Scholar]
53.Tosini G, Bertolucci C, Foà A. The circadian system of reptiles: a multioscillatory and multiphotoreceptive system. Physiol Behav. 2001. Mar 1;72(4):461–71. doi: 10.1016/s0031-9384(00)00423-6 [DOI] [PubMed] [Google Scholar]
54.Menaker M, Underwood H. Extraretinal Photoreception in Birds. Photochem Photobiol. 1976;23(4):299–306. doi: 10.1111/j.1751-1097.1976.tb07251.x [DOI] [PubMed] [Google Scholar]
55.Dekens MPS, Fontinha BM, Gallach M, Pflügler S, Tessmar-Raible K. Melanopsin elevates locomotor activity during the wake state of the diurnal zebrafish. EMBO Rep. 2022. May 4;23(5):e51528. doi: 10.15252/embr.202051528 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Davies WIL, Tamai TK, Zheng L, Fu JK, Rihel J, Foster RG, et al. An extended family of novel vertebrate photopigments is widely expressed and displays a diversity of function. Genome Res. 2015. Nov;25(11):1666–79. doi: 10.1101/gr.189886.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Vatine G, Vallone D, Gothilf Y, Foulkes NS. It’s time to swim! Zebrafish and the circadian clock. FEBS Lett. 2011. May 20;585(10):1485–94. doi: 10.1016/j.febslet.2011.04.007 [DOI] [PubMed] [Google Scholar]
58.Halford S, Freedman Melanie S, Bellingham J, Inglis SL, Poopalasundaram S, Soni BG, et al. Characterization of a Novel Human Opsin Gene with Wide Tissue Expression and Identification of Embedded and Flanking Genes on Chromosome 1q43. Genomics. 2001. Mar 1;72(2):203–8. doi: 10.1006/geno.2001.6469 [DOI] [PubMed] [Google Scholar]
59.Tarttelin EE, Bellingham J, Hankins MW, Foster RG, Lucas RJ. Neuropsin (Opn5): a novel opsin identified in mammalian neural tissue 1. FEBS Lett. 2003;554(3):410–6. [DOI] [PubMed] [Google Scholar]
60.Lekk I, Duboc V, Faro A, Nicolaou S, Blader P, Wilson SW. Sox1a mediates the ability of the parapineal to impart habenular left-right asymmetry. Bronner ME, White RM, Moens CB, editors. eLife. 2019. Aug 2;8:e47376. doi: 10.7554/eLife.47376 [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Vignet C, Bégout ML, Péan S, Lyphout L, Leguay D, Cousin X. Systematic screening of behavioral responses in two zebrafish strains. Zebrafish. 2013. Sep;10(3):365–75. doi: 10.1089/zeb.2013.0871 [DOI] [PubMed] [Google Scholar]
62.Cau E, Quillien A, Blader P. Notch resolves mixed neural identities in the zebrafish epiphysis. Dev Camb Engl. 2008. Aug;135(14):2391–401. doi: 10.1242/dev.013482 [DOI] [PubMed] [Google Scholar]
63.Zielinski T, Moore AM, Troup E, Halliday KJ, Millar AJ. Strengths and Limitations of Period Estimation Methods for Circadian Data. PLOS ONE. 2014. May 8;9(5):e96462. doi: 10.1371/journal.pone.0096462 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Geissmann Q, Rodriguez LG, Beckwith EJ, Gilestro GF. Rethomics: An R framework to analyse high-throughput behavioural data. PLOS ONE. 2019. Jan 16;14(1):e0209331. doi: 10.1371/journal.pone.0209331 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Wickham H. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag; New York: ISBN 978-3-319-24277-4,. 2016; [Google Scholar]
66.Quillien A, Gilbert G, Boulet M, Ethuin S, Waltzer L, Vandel L. Prmt5 promotes vascular morphogenesis independently of its methyltransferase activity. PLoS Genet. 2021;17(6). doi: 10.1371/journal.pgen.1009641 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Genet. doi: 10.1371/journal.pgen.1011172.r001

Decision Letter 0

Gregory S Barsh, John Ewer

23 Feb 2023

Dear Dr Cau,

Thank you very much for submitting your Research Article entitled 'Analysis of photoentrainment in the diurnal zebrafish suggests a profound divergence with nocturnal rodents' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an interesting question, but raised some substantial conceptual and experimenta concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

John Ewer

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: Chaigne, C et al investigate the role of retinal ganglion cells and a specific melanopsin ortholog, opn4xa, in zebrafish larval circadian locomotion behavior and circadian clock entrainment. They observe relatively minor differences for photic circadian entrainment for lak-/- mutants versus wildtype when the stimulus is given during the end of the night, as well as for total movement under constant light in the case of opn4xa mutants. Double mutants reveal no additional effects on phase entrainment. They also observe interesting additional details for opn4xa expression and possible function, i.e. robust diel changes in interneurons of the eyes other than the RGCs. Their data on fos indicates that opn4xa is the sole mediator of light sensation by the pineal gland at least up to 7dpf. Albeit minor effects, the results provide very valuable additional information on the non-visual functions of an opsin in a non-mammalian vertebrate. Non-mammalian vertebrates possess much higher numbers of opsins than mammals, thus individual loss-of-function effects are expected to be likely small, but nevertheless important to provide to the scientific community interested in understanding how light impacts on animals.

Before the data can be published, the authors should address the following concerns/suggestions:

>As a general layout comment- it would help to include line and page numbers, because it makes it easier to refer to specific sentences in the manuscript.

„The eye in general and melanopsin expressing cells in particular are crucial for circadian rhythms in nocturnal mammals, most notably during photoentrainment, by which circadian rhythms adapt to a changing light environment.“

> Remove nocturnal. This is probably a general feature for mammals, irrespective of nocturnality/diurnality.

„raising the intriguing possibility that vertebrates might employ different molecular/cellular circuits for photoentrainment depending on their phylogeny and/or temporal niche.“

> It is already well established that in zebrafish different peripheral cell types are directly photosensory. See work by the labs of David Whitmore, Nick Foulkes etc.. The authors even refer to the relevant literature in their introduction.

So, this is not raising a possibility, but it is a long-standing fact. The question is more to the mechanistic details, how different photoreceptors contribute to it, and why this ability apparently got lost in mammals. This is where the authors actually make their contributions. They might be not so obvious, but they are nevertheless important for the large picture of non-visual photoreceptor functions. So, it would be appropriate to re-word this summary accordingly.

Introduction:

"Once established, these rhythms persist in constant light conditions, "

> constant conditions, not just “light“ or better re-phase to: “conditions that don’t provide entrainment information, e.g. constant light and temperature.”

"Although ipRGCs mediate circadian and direct effects of light on behaviour in nocturnal mammals, it is unclear if these roles are conserved in diurnal and non-mammalian species"

>The statements after these sentences need serious rewording. It is long established especially by the work of David Whitmore, Nicholas Foulkes and their labs that individual cells in fish are themselves light sensitive, independent of the eyes. The authors refer to Cavallari et al.. 2011, but do not embed the findings and conclusions of this paper well into their introduction. Directly after the citation they write: “While the function of the eye regarding circadian rhythms has not been addressed in fishes…” and “The role of this local photodetection regarding circadian behaviours has not been explored… “.

However, Cavallari et al.. 2011 explicitly states (in their summary!): “We reveal that eye loss does not account for this “blind” clock. Specifically, mutations of two widely expressed non-visual opsin photoreceptors (Melanopsin and TMT opsin) are responsible for the blind clock phenotype in the cavefish.”

Cavallari et al.. 2011 provides evidence for this statement by tissue culture experiments. Interestingly, Cavallari et al.. 2011 have not performed the lak- mutant experiments, done in this manuscript. So, the current study certainly adds information, but the precise value of these new experiments needs to be better worked out. Thus, the current introduction needs serious rewording.

"Our results suggest that the function of the retina and/or the intrinsic photosensitivity of ipRGCs-like-cells of the pineal gland "

> Suggest to re-word to „ Our results suggest that the function of the retina and the intrinsic photosensitivity of ipRGCs-like-cells of the pineal gland expressing opn4xa …”.

Alternatively- refer to the fos stainings and make clear that your data suggest that at these early stages opn4xa appears to be the only opsin mediating light input into the pineal with light of the given duration, specific spectrum and intensity.

There are more opsins expressed in the pineal gland, and hence without further specifications it is difficult to conclude from the lack of one of the opsins about the functionality of the entire cell type.

Results:

>Please add information on the age of the tested fish into Fig1. It’s in the methods, but as this information is important it should be mentioned directly with the results, especially as different ages are used in Fig.3. (And exposing fish for 5 days to LD does not necessarily imply that the test age starts with 5dpf.)

> Before the mansucripts is published it MUST add information on light intensity and spectrum in its supplementary material. This information is absolutely critical when presenting results on photoreceptors.

> Based on the phase entrainment experiments with the lak mutants, the authors conclude that “Retinal Ganglion Cells are differentially required in a phase delay and a phase-advance paradigm of photoentrainment”. This interpretation needs some revisions. The authors cannot really interpret their results as a test for the impact of RGCs. lak mutants are very differently pigmented compared to their wildtype counterparts, which implies that less light will be able to reach all the tissues of the mutant fish compared to wildtype siblings.

Also, where is ath5, the gene mutated in lak mutant fish, expressed besides the eyes? This should be mentioned and considered for the interpretation of the results.

A possible way to discriminate between RGC vs. pigment vs. ath5 impacts on phase advance entrainment would be to repeat these experiments with wildtype vs. lak-/- eye-ablated larvae. However, the reviewer is aware that this will likely require a new animal experimental permit request. No matter the country- these legal permits usually take months to get. Thus, a vigorous discussion of the different interpretational alternatives would be an appropriate approach to address the raised concern, if such a permit does not already exist.

> Another concern on the PA results is the aspect that is really not well visible in the averaged data from the three experiments. The authors address the issue by showing a single experiment in the supplemental, which is really helpful. It would be even more convincing if they include all three experiments individually in the supplemental materials.

> The diel expression changes of opn4xa in interneurons of the eye other than RGC is interesting. A suggestion for improvements: This needs some rewording as RGCs are also interneurons. The anatomy and cell types of the vertebrate eye are very well described. The authors should be able to assign a more specific label to the cells- are these likely amacrine or horizontal or bipolar cells? This should be possible to tentatively assign based on position and cellular morphology. This provides valuable information for future studies.

> The difference in the fos staining is very interesting, as it indeed suggests that much of the pineal light perception is via opn4xa during these larval stages. This is remarkable given many opsins are present in the fish pineal. This could be given some emphasis in the text.

„Similarly to the analysis we performed in lak larvae, for each of these condition“

> Should be „similar“.

Discussion:

"Melanopsin expressing cells of the eye are the sole mediators of light input to the circadian rhythm in

nocturnal mammals."

> ipRGCs are also considered the sole mediators of entrainment by light in humans- i.e. diurnal mammal. Please rephrase the sentence.

>It would be important really interesting to see how the authors embed their work into the current general knowledge on Opsin functions in teleost fish. There are many more and many even described to be expressed in the pineal. In this context the fos expression comparison between mutant and wildtype is particularly remarkable. Do the authors expect that this sole role of opn4xa changes with later stages of development? What’s known about possible alterations of opsin functions in teleosts? Or do they think that this is due to the specific spectrum/intensity of light they use?

>The argument with the “destabilized” clock is cryptic. First, what exactly LL is doing depends very much on its intensity. This information is entirely lacking (see above). Second, moderate LL will cause differences in period length (see Aschoff, J. Cold Spring Harb Symp Quant Biol. 1960; 25:11-28, but besides the mentioned examples that’s also established for humans, the insect Drosophila, the annelid Platynereis). The mentioned “destabilization” likely refers to an effect seen under strong LL when it is assumed that this causes a constant re-setting of the circadian phase and hence desynchronization of the cellular networks and ultimately behavior.

One possible alternative explanation for the observed effects on the LL period of opn4xa mutants is that they sense less light (i.e. less light reaches the fish’s circadian clockwork) and hence– consistent with the above mentioned observations in many organisms– mutants show a slight period length difference.

Reviewer #2: In this study, Chaigne et al. examine the locomotor activities of a zebrafish developmental mutant lakritz (lak), and a CRISPR-Cas9-generated melanopsin gene opn4xa mutant, as well as their responses to two-pulse skeleton photoperiods. The authors reported that retinal ganglion cells and Opn4xa are not required for generating zebrafish locomotor rhythms. They also showed that functional eyes with retinal ganglion cells, but not Opn4xa, contribute to what they called “masking.” These are interesting observations. However, numerous issues must be carefully addressed.

1. Even though the circadian functions of intrinsically photosensitive retinal ganglion cells (ipRGCs) have been most revealed in nocturnal mice. Studies have shown that diurnal rodents, even humans, likely possess functional equivalent ipRGCs as nocturnal mice (doi:10.1371/journal.pone.0073343, doi.org/10.3389/fneur.2021.636330). Thus, in the title, as well as numerous descriptions and discussions in the manuscript, the authors should consider the photoentrainment differences between diurnal zebrafish and nocturnal mice carefully, as these differences are not just between diurnal zebrafish and nocturnal mice.

2. The authors should examine possible mechanisms that underpin what they observed in locomotor activities. For instance, the expression of two light-inducible circadian clock genes, per2 and cry1a(a), in lak and opn4xa mutants should be done.

3. The authors should use rhythmicity programs, such as Hughes et al. 2010. JTK_CYCLE: an efficient nonparametric algorithm for detecting rhythmic components in genome-scale data sets. J. Biological Rhythms) and/or MetaCycle (Wu et al. 2016. MetaCycle: an integrated R package to evaluate periodicity in large scale data. Bioinformatics) to analyze their behavioral data, which produces, rhythmicity probability, period, amplitude, and phase of each data set. For instance, in Figures 1C and E, it may have differences in amplitudes and phases between lak and sib.

4. In Figure 1, why D used “four complete cycles in DD” while D used “three complete cycles in DD”?

5. In the two-pulse skeleton photoperiod experiments, why a two-hour pulse of light at CT 16 while a one-hour pulse of light at CT21? What is the rationale?

6. What machine was used to conduct behavioral assays? Was it homemade?

7. As most of the behavioral assays were done after 6 day post fertilization, when larvae start foraging, were these larvae fed?

8. What is the lux (intensity) of light used?

9. Δphase calculated via the difference of phase between the two last days (“after the light pulse”) and the two first days (“before the light pulse”) may not be accurate because of the developmental stage-specific effects. Δphase should be the phase difference between larvae with the light impulse and larvae without the light impulse of the same period.

10. It would be better to show the data in Tables 1-3 as Figures.

11. In Figure 3, B, C, and D should have scale bars. Quite contrary to what is claimed in the manuscript, I see differences in the numbers of positive (opn4xa and c-fos) cells, as well as their spatial structures between opn4xa mutant and wild-type control larvae.

12. Where is the tcf7 expression data?

13. No figure legend for supplementary figure 3. Scale bars should be shown in A-D.

14. Put “To genotype opn4xa individuals, we used a classical PCR protocol with the following oligos: 5'-

GGACGCCTCCAAACTTC-3' (Forward) and 5'-CGAACACCCACTCCTTGTAC-3' Reverse). PCR products of different sizes were obtained (110bp for the wt allele and 127bp for the mutant allele) and resolved on a 4% agarose gel” into “Generation of an opn4xa mutant allele”.

15. “Enucleated mice” should be “eye enucleated mice”?

16. “Mice mutant for Opn4 show” should be “Mice mutant for Opn4 shows”

17. “In contrast, mice with no ipRGCs or with impaired neurotransmission from ipRGCs show no entrainment to LD as well as no phase delay following a light pulse at CT16 (Cahill, 1996; Güler et al., 2008; Kofuji et al., 2016).” Is Cahill, 1996 relevant here?

Reviewer #3: This manuscript by Chaigne et al provides some interesting new insight into the genetic and molecular elements that contribute to how environmental lighting conditions are detected and thereby entrain the vertebrate circadian clock. The authors focus on this issue using the diurnal, non-mammalian model, the Zebrafish instead of more commonly used nocturnal rodents such as mouse. More specifically, they explore the role of retinal ganglion cells (RGCs) and the zebrafish melanopsin photoreceptor Opn4xa in the entrainment of locomotor activity rhythms of zebrafish larvae. Using the lakritz mutant which lacks RGCs, they reveal attenuation of both the masking effects of light on locomotor activity in larvae as well as the phase advances induced by a pulse of white light delivered at the end of the subjective night period. Instead, the establishment of robust circadian cycles of locomotor activity as well as the phase delaying effects of light pulses delivered at the beginning of the subjective night, are all normal in the lakritz homozygous mutants. The next step is the generation of a loss of function mutation in the Opn4xa gene. Mutant fish exhibit apparently normal masking and circadian rhythms of locomotor activity as well as phase shifting responses to light pulses. The only abnormality detected in these fish are changes in the period length of activity rhythms as they free run in conditions of constant light. The authors conclude that there are „profound“ differences between the diurnal zebrafish and nocturnal rodents such as the mouse in terms of circadian system and photoentrainment.

While certainly interesting, the manuscript in its current form has a number of conceptual and experimental weaknesses as well as problems in the way that the work is presented that preclude its publication in its current form.

Issues, in their order of appearance in the manuscript:

Title, Abstract and Introduction

1) For a number of reasons, I find the title somewhat misleading: The word „profound“ is an extremely strong word and I do not agree it is appropriate for the findings that have been reported here. Also, the reference to diurnal and nocturnal implies that somehow the results have ascribed special significance to the temporal niche occupied by these two species. I don’t see this.

2) First sentence of abstract (as well as first sentence of Results): the importance of the eye for controlling circadian rhythms is not a special feature limited to „nocturnal rodents“ (- the inference here). It is also very clearly the case for other diurnal vertebrates such as humans. This recurrent reference to diurnality and nocturnality throughout the text needs to be toned down.

3) There is already much evidence for major differences between the organization of the zebrafish and mouse circadian timing systems, so the last sentence of the abstract (as well as the title) which implies that this is somehow the original conclusion of this work is also misleading.

4) First sentence of the Introduction: „regulate a phenomenal variety of biological functions“ is once again a wild over statement!

5) End of second paragraph of the Introduction section. „…which is though to behave as a ‚master clock‘….“ is a little understating the issue. There is so much data to support this notion that I think it would be more accurate to state „…..is well established to serve as a master clock”.

6) Introduction, paragraph 4: While the cavefish P. andruzzii does not show significant locomotor activity rhythmicity under LD cycle conditions (Cavallari et al., 2011), Astyanax mexicanus Pachon (blind form) does show rhythmicity under artificial LD cycles (Beale et al., 2013). This statement should be corrected. Last sentence, „peripheric“ should be corrected to „peripheral“, and „………still begs for an answer“ should be corrected to „…. is still unclear“

Results and Conclusions

1) The authors should provide a more detailed description of the Lakritz mutant retinal phenotype as well as details of the underlying mutation in Ath5 etc.

2) 2nd paragraph: „The reduction in activity observed during the day in LD conditions thus does not reflect a defect in circadian control“ is not an accurate statement based on the data that this statement is based on. Better would be „The reduction in activity observed during the day in LD conditions thus does not affect the persistence of rhythmicity under free running conditions in DD“.

3) The opn4xa knock out experiments completely lack formal proof that the mutation indeed does lead to production of a significantly truncated and non-functional protein!!!!

4) Light-induced fos expression in the pineal gland is used as a proxy for „intrinsic photosensitivity in pineal cells“. However, this assumes that there is just a single pathway linking Opn4xa with gene expression. I am not convinced that there is sufficient data to support such a hypothesis. Therefore, it would be important to test expression of other light-regulated genes such as 6-4 photolyase, Cry1a or Per2 in these pineal cells.

5) In the discussion, the authors refer correctly to the large opsin gene repertoire of zebrafish and how this might complicate the interpretation of their results. Given this central issue, it is important that the authors defend in more detail precisely why this particular opsin was chosen for the loss of function experiments. Furthermore, it might be valuable for the reader to already mention this issue in the Introduction..

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: No: The authors state that all the numerical data will be sent as supplemental information in the form of excell files with the revised manuscript. This has not been done yet.

Reviewer #2: No: No data for tcf7 expression

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2024 Feb 26;20(2):e1011172. doi: 10.1371/journal.pgen.1011172.r002

Author response to Decision Letter 0

1 Jun 2023

Attachment

Submitted filename: answer to reviewers.docx

pgen.1011172.s026.docx^{(699.2KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1011172.r003

Decision Letter 1

Gregory S Barsh, John Ewer

12 Jul 2023

Dear Dr Cau,

Thank you very much for submitting your revised Research Article entitled 'Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish' to PLOS Genetics.

The revised manuscript was fully evaluated at the editorial level and by three independent peer reviewers. The reviewers appreciated the revisions made to the original submission, but consider that some substantial concerns about the current manuscript remain. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

John Ewer

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors have sufficiently addressed my concerns and comments.

Reviewer #2: I appreciate that the authors have addressed some of my concerns and suggestions. However, my main concerns are not adequately responded to.

1. Regarding the Δphase, I suggested it should be the phase difference between larvae with the light impulse and larvae without the light impulse of the same period. Actually, it is the phase difference between those of the larvae under DD and PD/PA, which would be a better estimate.

2. Regarding the possible mechanisms underlying what you observed in locomotor activities, in particular, why “the eye/RGCs are dispensable for the induction of a phase delay following a pulse of white light at CT 16 but contribute to the induction of a phase advance upon a pulse of white light at CT21.” The parallel examination of the expression of two light-inducible circadian clock genes, per2 and cry1a(a), in lak mutant, should be done, rather than just examining the expression of circadian clock genes under LL conditions, as shown in Figure 5. The hypothesis could be that the expression of key circadian clock genes is altered in these light impulse schedules, which may underlie the behavioral phenotypes.

3. Regarding what is shown in Figures 3B and 3C, the authors should select new representative panels that show similar numbers of opn4xa-positive cells in the mutant and wild-type controls.

4. It is highly recommended that the authors should put some paramecia in each well, along with tested larvae, which should help obtain better behavioral data, avoiding having the data shown in Figure 1 B, where the third-day results show little difference between the mutant and wild types, likely due to the possibility that the larvae ran out of energy without feeding.

5. It is good that the authors performed the rhythmicity analysis of the relevant behavioral data with Biodare2. But the authors should cite the results, for example, locomotor activities of the lak mutant and wild type display rhythmicity with statistically significant P values. Put the P values on the respective panels.

Minor issues:

In Figure 5. Should tefalpha be tefa? What is reverbB1? These genes should have IDs.

Reviewer #3: The revised version of this manuscript is much improved and most of my concerns have been addressed. However, there are some issues which have been raised in the process of revision that I feel need to be addressed before the manuscript can pass on to the final step. Specifically:

1) Text modification 1.111-133

The circadian locomotor activity rhythm phenotype of Astyanax mexicanus is NOT documented in Cavallari et al, 2011. Instead this is refered to in the manuscript from the Whitmore group: Beale et al., 2013, Nature Communications. This citation should be added.

2) Text modification 1.111-133, Final sentence(s): “………..although some level of central control is expected for orchestrating a complex process such as behaviour. As such, the relative importance of central versus peripheral control for the photoentrainment of locomotor activity is still unclear.” Here, and in other parts of the manuscript, the authors tend to give the impression that if a central clock structure is involved in photoentrainment of complex behaviour, then it should operate like the mammalian SCN - so light input coming from the retina or other dedicated photoreceptors. However, as the authors state, the situation in fish is that most cell types, likely including neurons, are directly photosensitive. So, the division between central and peripheral clocks in fish is less well defined. Therefore, it is formally possible that a central CNS-based pacemaker could coordinate light entrainment of rhythmicity WITHOUT the need for indirect input from a functional photoreceptor - in some way acting more like a peripheral clock. This possibility should be raised to avoid any confusion.

3) Text modification 1.161-164

The text should be corrected to “……. is expressed exclusively in the developing retina (Masai et al., 2000). The Lakth241 allele we used bears a point mutation and functions as a null allele which results in a total absence of both…….”

4) Concerning the lack of experimental evidence for the production of a truncated Opn4xa opsin protein.

I apologise that I do not agree with the authors in their argumentation. Using the observation that most zebrafish papers in which a mutant line is generated do not show direct protein data is not a credible excuse. If a mouse-based project failed to provide such evidence then this would be considered as a serious negative point. I am sure that antibodies can be raised against proteins even from zebrafish - it just takes more time and effort!!! However, that said I do appreciate the authors arguments that protein prediction can be useful as indirect evidence that the mutation is likely to have been successful. As a compromise solution, I would advise the authors to state in the Results section text the lines of evidence that they have provided in their rebuttal letter, basically that they have eliminated the possibility of Alternative ORFs, Alternative ATGs and alternative splicing. At least this way, the reader can make up their own mind as to the confidence they can associate with the results obtained using this mutant.

5) The logic for requesting expression data for Cry1a, and 6-4 photolyase: These (as well as per2) have been extensively studied as light regulated genes, and the enhancers responsible for this photic regulation have been identified. There are also gene-specific differences in the mechanisms (TFs) whereby they are regulated by light. Furthermore, given the complexity of the opsin gene repertoire in the zebrafish, it seems likely that there is also complexity at the signalling and gene expression regulation levels of the light response. For this reason, analysing a small number of well characterized light - regulated genes would provide more compelling evidence for whether a particular cell type is truly photosensitive or not. However, on balance, I do not hold the authors to provide this extra evidence.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2024 Feb 26;20(2):e1011172. doi: 10.1371/journal.pgen.1011172.r004

Author response to Decision Letter 1

1 Dec 2023

Attachment

Submitted filename: answertoreviewers.odt

pgen.1011172.s027.odt^{(38.2KB, odt)}

PLoS Genet. doi: 10.1371/journal.pgen.1011172.r005

Decision Letter 2

Gregory S Barsh, John Ewer

8 Jan 2024

Dear Dr Cau,

Thank you very much for submitting your re-revised Research Article entitled 'Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish' to PLOS Genetics.

The manuscript was fully evaluated at the editorial level and by Reviewer 2. You will see that Reviewer 2 still has reservations about the work. Although we agree with their comments, the Editor-in -Chief and I agree that they do not severely jeopardize this solid piece of work. Nevertheless, we ask you to please respond to the reviewer's comments as best you can. And in order to not extend this reviewing process any further, the revised version will not be sent out for review again; it (together with your detailed response to the reviewer's comments) will be evaluated at the editorial level only.

Thus, we ask you to please:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

Please let us know if you have any questions while making these revisions.

Yours sincerely,

John Ewer

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #2: This reviewer appreciates that the authors took time to address the issues being raised. However, I felt that several issues are still not adequately explained.

1. Regarding the Δphase, I think that the difference between the final phase (‘phase after’) and the initial phase (‘phase before’) of the same larvae doesn’t faithfully reflect the effects of light impulses on phase changes of locomotor activities, even it might get a better value, as the authors argued. As shown in Figures 2D and 2E, compared to those in DD, light impulses at CT16 lead to phase delay, while light impulses at CT 21 cause phase advance. Thus Δphase between those of PD larvae and those of DD control larvae, and between those of PA larvae and those of DD control larvae should be a better indicator of the effects of light impulses on phase changes. With any behavioral assay, interindividual and interexperimental variations often occur, which should not be a reason not to calculate the right parameter. If the authors have calculated Δphase between those of PD larvae and those of DD control larvae, and between those of PA larvae and those of DD control larvae, they should describe them in the main text. I think that Δphase between the final phase (‘phase after’) and the initial phase (‘phase before’) of the same larvae is just arrow phase change, which will confuse the audience, should be deleted or put in to the supplementary file.

2. The authors said that “we addressed whether per2 and cry1a were induced upon administration of a one-hour light pulse at CT21 and how these inductions were affected by the absence of a functional lak gene. These results are described in figure 5”, I did not see them in Figure 5.

3. The authors cited studies that paramecia display circadian rhythms, and argued that paramecia feeding could affect the larval locomotor rhythms. The fact is that the authors showed the amplitude damped quickly in their behavioral assays without feeding, while many behavioral experiments display robust behavioral rhythms with paramecia feeding.

4. I suggest the authors should cite the results of Biodare2, for example, locomotor activities of the

lak mutant and wild type display rhythmicity with statistically significant P values. Put the P

values on the respective panels. The author didnot give reasons why not putting the P

values on the respective panels.

5. In Figure 5, tefalpha is still not changed into tefa.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #2: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

PLoS Genet. 2024 Feb 26;20(2):e1011172. doi: 10.1371/journal.pgen.1011172.r006

Author response to Decision Letter 2

18 Jan 2024

Attachment

Submitted filename: answer to reviewers.docx

pgen.1011172.s028.docx^{(18.9KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1011172.r007

Decision Letter 3

Gregory S Barsh, John Ewer

5 Feb 2024

Dear Dr Cau,

We are pleased to inform you that your manuscript entitled "Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish" has (finally!) been editorially accepted for publication in PLOS Genetics. Congratulations! I made a couple of suggestions for the text (see below) but you should be able to make them in the proofs, if not before.

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

John Ewer

Academic Editor

PLOS Genetics

Gregory Barsh

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

Thank you for making the final changes to the manuscript. My only suggestions would be to change "... supporting that vertebrates might employ..." (lines 41-42) for ".... revealing that vertebrates employ...". I think your results are solid enough to make a more definitive statement. Also line 226 needs editing. I would suggest "... it is more apparent when comparing only the records of animals for which a phase was...." You should be able to request these small changes when you are sent the proofs.

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-22-01386R3

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

PLoS Genet. doi: 10.1371/journal.pgen.1011172.r008

Acceptance letter

Gregory S Barsh, John Ewer

21 Feb 2024

PGENETICS-D-22-01386R3

Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish

Dear Dr Cau,

We are pleased to inform you that your manuscript entitled "Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Anita Estes

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig

(TIF)

pgen.1011172.s001.tif^{(5.1MB, tif)}

S2 Fig

(TIF)

pgen.1011172.s002.tif^{(1.8MB, tif)}

S3 Fig. opn4xa is expressed in zebrafish RGCs and interneurons.

(TIF)

pgen.1011172.s003.tif^{(2.4MB, tif)}

S4 Fig

(TIF)

pgen.1011172.s004.tif^{(2.6MB, tif)}

S5 Fig

(TIF)

pgen.1011172.s005.tif^{(2.7MB, tif)}

S1 Table

(DOCX)

pgen.1011172.s006.docx^{(12.3KB, docx)}

S2 Table. Percent of rhythmic lak and sib larvae in DD and LL.

The difference between the ctl DD and the lak DD populations is not significant using a khi-two test p = 0.957, similar results are obtained between the ctl LL and the lak LL, p = 0,91.

(DOCX)

pgen.1011172.s007.docx^{(12KB, docx)}

S3 Table

(DOCX)

pgen.1011172.s008.docx^{(12.4KB, docx)}

S4 Table

(DOCX)

pgen.1011172.s009.docx^{(12.2KB, docx)}

S5 Table

(DOCX)

pgen.1011172.s010.docx^{(12KB, docx)}

S6 Table. Percent of rhythmic opn4xa -/- and ctl larvae in DD and LL.

The difference between the WT DD and the opn4xa-/- DD populations is not significant using a khi-two test, p = 0.06.

(DOCX)

pgen.1011172.s011.docx^{(11.9KB, docx)}

S7 Table

(DOCX)

pgen.1011172.s012.docx^{(12.2KB, docx)}

S8 Table

(DOCX)

pgen.1011172.s013.docx^{(12.1KB, docx)}

S9 Table. qRTPCR primer sequences used in the study.

The right column indicates the ZDB gene ID (https://zfin.org).

(DOCX)

pgen.1011172.s014.docx^{(14.3KB, docx)}

S1 Data. Numerical data related to Fig 1.

(XLSX)

pgen.1011172.s015.xlsx^{(2.4MB, xlsx)}

S2 Data. Numerical data related to Fig 2.

(XLSX)

pgen.1011172.s016.xlsx^{(4MB, xlsx)}

S3 Data. Numerical data related to Fig 3.

(XLSX)

pgen.1011172.s017.xlsx^{(11.9KB, xlsx)}

S4 Data. Numerical data related to Fig 4.

(XLSX)

pgen.1011172.s018.xlsx^{(10.9KB, xlsx)}

S5 Data. Numerical data related to Fig 5.

(XLSX)

pgen.1011172.s019.xlsx^{(1.9MB, xlsx)}

S6 Data. Numerical data related to Fig 6.

(XLSX)

pgen.1011172.s020.xlsx^{(26.2KB, xlsx)}

S7 Data. Numerical data related to Fig 7.

(XLSX)

pgen.1011172.s021.xlsx^{(1.6MB, xlsx)}

S8 Data. Numerical data related to Fig 8.

(XLSX)

pgen.1011172.s022.xlsx^{(938.5KB, xlsx)}

S9 Data. Numerical data related to S1 Fig.

(XLSX)

pgen.1011172.s023.xlsx^{(1MB, xlsx)}

S10 Data. Numerical data related to S3 Fig.

(XLSX)

pgen.1011172.s024.xlsx^{(9.7KB, xlsx)}

S11 Data. Numerical data related to S4 Fig.

(XLSX)

pgen.1011172.s025.xlsx^{(8.2KB, xlsx)}

Attachment

Submitted filename: answer to reviewers.docx

pgen.1011172.s026.docx^{(699.2KB, docx)}

Attachment

Submitted filename: answertoreviewers.odt

pgen.1011172.s027.odt^{(38.2KB, odt)}

Attachment

Submitted filename: answer to reviewers.docx

pgen.1011172.s028.docx^{(18.9KB, docx)}

Data Availability Statement

All data are in the manuscript and/or supporting information files.

[pgen.1011172.ref001] 1.Bhadra B, N T, P D, M PB. Sleep medicine. 2017 [cited 2021 Oct 18]. Evolution of circadian rhythms: from bacteria to human. Available from: https://pubmed-ncbi-nlm-nih-gov.insb.bib.cnrs.fr/28619182/ [DOI] [PubMed]

[pgen.1011172.ref002] 2.Brzezinski JA, Brown NL, Tanikawa A, Bush RA, Sieving PA, Vitaterna MH, et al. Loss of Circadian Photoentrainment and Abnormal Retinal Electrophysiology in Math5 Mutant Mice. Invest Ophthalmol Vis Sci. 2005. Jul;46(7):2540–51. doi: 10.1167/iovs.04-1123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref003] 3.Freedman MS, Lucas RJ, Soni B, Schantz M von, Muñoz M, David-Gray Z, et al. Regulation of Mammalian Circadian Behavior by Non-rod, Non-cone, Ocular Photoreceptors. Science [Internet]. 1999. Apr 16 [cited 2021 Oct 18]; Available from: https://www.science.org/doi/abs/10.1126/science.284.5413.502. [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref004] 4.Wee R, Castrucci AM, Provencio I, Gan L, Van Gelder RN. Loss of Photic Entrainment and Altered Free-Running Circadian Rhythms in math5−/− Mice. J Neurosci. 2002. Dec 1;22(23):10427–33. doi: 10.1523/JNEUROSCI.22-23-10427.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref005] 5.Hartley S, Dauvilliers Y, Quera-Salva MA. Circadian Rhythm Disturbances in the Blind. Curr Neurol Neurosci Rep. 2018. Aug 6;18(10):65. doi: 10.1007/s11910-018-0876-9 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref006] 6.Lockley SW, Arendt J, Skene DJ. Visual impairment and circadian rhythm disorders. Dialogues Clin Neurosci. 2007;9(3):301–14. doi: 10.31887/DCNS.2007.9.3/slockley [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref007] 7.Sack RL, Lewy AJ, Blood ML, Keith LD, Nakagawa H. Circadian rhythm abnormalities in totally blind people: incidence and clinical significance. J Clin Endocrinol Metab. 1992. Jul;75(1):127–34. doi: 10.1210/jcem.75.1.1619000 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref008] 8.Panda S, Sato TK, Castrucci AM, Rollag MD, DeGrip WJ, Hogenesch JB, et al. Melanopsin (Opn4) requirement for normal light-induced circadian phase shifting. Science. 2002. Dec 13;298(5601):2213–6. doi: 10.1126/science.1076848 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref009] 9.Ruby NF, Brennan TJ, Xie X, Cao V, Franken P, Heller HC, et al. Role of melanopsin in circadian responses to light. Science. 2002. Dec 13;298(5601):2211–3. doi: 10.1126/science.1076701 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref010] 10.Gompf HS, Fuller PM, Hattar S, Saper CB, Lu J. Impaired circadian photosensitivity in mice lacking glutamate transmission from retinal melanopsin cells. J Biol Rhythms. 2015. Feb;30(1):35–41. doi: 10.1177/0748730414561545 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref011] 11.Güler AD, Ecker JL, Lall GS, Haq S, Altimus CM, Liao HW, et al. Melanopsin cells are the principal conduits for rod-cone input to non-image-forming vision. Nature. 2008. May 1;453(7191):102–5. doi: 10.1038/nature06829 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref012] 12.Kofuji P, Mure LS, Massman LJ, Purrier N, Panda S, Engeland WC. Intrinsically Photosensitive Retinal Ganglion Cells (ipRGCs) Are Necessary for Light Entrainment of Peripheral Clocks. PLOS ONE. 2016. Dec 16;11(12):e0168651. doi: 10.1371/journal.pone.0168651 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref013] 13.Altimus CM, Güler AD, Villa KL, McNeill DS, Legates TA, Hattar S. Rods-cones and melanopsin detect light and dark to modulate sleep independent of image formation. Proc Natl Acad Sci U S A. 2008. Dec 16;105(50):19998–20003. doi: 10.1073/pnas.0808312105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref014] 14.Belenky MA, Smeraski CA, Provencio I, Sollars PJ, Pickard GE. Melanopsin retinal ganglion cells receive bipolar and amacrine cell synapses. J Comp Neurol. 2003;460(3):380–93. doi: 10.1002/cne.10652 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref015] 15.Calligaro H, Coutanson C, Najjar RP, Mazzaro N, Cooper HM, Haddjeri N, et al. Rods contribute to the light-induced phase shift of the retinal clock in mammals. PLoS Biol. 2019. Mar;17(3):e2006211. doi: 10.1371/journal.pbio.2006211 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref016] 16.Dkhissi-Benyahya O, Gronfier C, De Vanssay W, Flamant F, Cooper HM. Modeling the role of mid-wavelength cones in circadian responses to light. Neuron. 2007. Mar 1;53(5):677–87. doi: 10.1016/j.neuron.2007.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref017] 17.Dollet A, Albrecht U, Cooper HM, Dkhissi-Benyahya O. Cones Are Required for Normal Temporal Responses to Light of Phase Shifts and Clock Gene Expression. Chronobiol Int. 2010. May 1;27(4):768–81. doi: 10.3109/07420521003695704 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref018] 18.Perez-Leon JA, Warren EJ, Allen CN, Robinson DW, Brown RL. Synaptic inputs to retinal ganglion cells that set the circadian clock. Eur J Neurosci. 2006. Aug;24(4):1117–23. doi: 10.1111/j.1460-9568.2006.04999.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref019] 19.Wong KY, Dunn FA, Graham DM, Berson DM. Synaptic influences on rat ganglion-cell photoreceptors. J Physiol. 2007. Jul 1;582(Pt 1):279–96. doi: 10.1113/jphysiol.2007.133751 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref020] 20.Baver SB, Pickard GE, Sollars PJ, Pickard GE. Two types of melanopsin retinal ganglion cell differentially innervate the hypothalamic suprachiasmatic nucleus and the olivary pretectal nucleus. Eur J Neurosci. 2008;27(7):1763–70. doi: 10.1111/j.1460-9568.2008.06149.x [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref021] 21.Fernandez DC, Chang YT, Hattar S, Chen SK. Architecture of retinal projections to the central circadian pacemaker. Proc Natl Acad Sci. 2016. May 24;113(21):6047–52. doi: 10.1073/pnas.1523629113 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref022] 22.Li JY, Schmidt TM. Divergent projection patterns of M1 ipRGC subtypes. J Comp Neurol. 2018. 01;526(13):2010–8. doi: 10.1002/cne.24469 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref023] 23.Chew KS, Renna JM, McNeill DS, Fernandez DC, Keenan WT, Thomsen MB, et al. A subset of ipRGCs regulates both maturation of the circadian clock and segregation of retinogeniculate projections in mice. Takahashi JS, editor. eLife. 2017. Jun 15;6:e22861. doi: 10.7554/eLife.22861 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref024] 24.Rupp AC, Ren M, Altimus CM, Fernandez DC, Richardson M, Turek F, et al. Distinct ipRGC subpopulations mediate light’s acute and circadian effects on body temperature and sleep. eLife [Internet]. 8. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6650245/ doi: 10.7554/eLife.44358 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref025] 25.Karnas D, Hicks D, Mordel J, Pévet P, Meissl H. Intrinsic Photosensitive Retinal Ganglion Cells in the Diurnal Rodent, Arvicanthis ansorgei. PLOS ONE. 2013. Aug 9;8(8):e73343. doi: 10.1371/journal.pone.0073343 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref026] 26.Mure LS. Intrinsically Photosensitive Retinal Ganglion Cells of the Human Retina. Front Neurol. 2021;12:636330. doi: 10.3389/fneur.2021.636330 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref027] 27.Beale A, Guibal C, Tamai TK, Klotz L, Cowen S, Peyric E, et al. Circadian rhythms in Mexican blind cavefish Astyanax mexicanus in the lab and in the field. Nat Commun. 2013. Nov 14;4(1):1–10. doi: 10.1038/ncomms3769 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref028] 28.Cavallari N, Frigato E, Vallone D, Fröhlich N, Lopez-Olmeda JF, Foà A, et al. A Blind Circadian Clock in Cavefish Reveals that Opsins Mediate Peripheral Clock Photoreception. PLoS Biol [Internet]. 2011. Sep 6;9(9). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3167789/ doi: 10.1371/journal.pbio.1001142 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref029] 29.Carr AJF, Whitmore D. Imaging of single light-responsive clock cells reveals fluctuating free-running periods. Nat Cell Biol. 2005. Mar;7(3):319–21. doi: 10.1038/ncb1232 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref030] 30.Vallone D, Gondi SB, Whitmore D, Foulkes NS. E-box function in a period gene repressed by light. Proc Natl Acad Sci U S A. 2004. Mar 23;101(12):4106–11. doi: 10.1073/pnas.0305436101 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref031] 31.Whitmore D, Foulkes NS, Sassone-Corsi P. Light acts directly on organs and cells in culture to set the vertebrate circadian clock. Nature. 2000. Mar;404(6773):87–91. doi: 10.1038/35003589 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref032] 32.Kay JN, Finger-Baier KC, Roeser T, Staub W, Baier H. Retinal Ganglion Cell Genesis Requires lakritz, a Zebrafish atonal Homolog. Neuron. 2001. May 1;30(3):725–36. doi: 10.1016/s0896-6273(01)00312-9 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref033] 33.Kölsch Y, Hahn J, Sappington A, Stemmer M, Fernandes AM, Helmbrecht TO, et al. Molecular classification of zebrafish retinal ganglion cells links genes to cell types to behavior. Neuron. 2021. Feb 17;109(4):645–662.e9. doi: 10.1016/j.neuron.2020.12.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref034] 34.Matos-Cruz V, Blasic J, Nickle B, Robinson PR, Hattar S, Halpern ME. Unexpected diversity and photoperiod dependence of the zebrafish melanopsin system. PloS One. 2011;6(9):e25111. doi: 10.1371/journal.pone.0025111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref035] 35.Sapède D, Chaigne C, Blader P, Cau E. Functional heterogeneity in the pineal projection neurons of zebrafish. Mol Cell Neurosci. 2020. Feb 3;103:103468. doi: 10.1016/j.mcn.2020.103468 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref036] 36.Covello G, Rossello FJ, Filosi M, Gajardo F, Duchemin A, Tremonti BF, et al. Transcriptome analysis of the zebrafish atoh7−/− Mutant, lakritz, highlights Atoh7-dependent genetic networks with potential implications for human eye diseases. FASEB BioAdvances. 2020. Jun 27;2(7):434–48. doi: 10.1096/fba.2020-00030 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref037] 37.Neuhauss SCF, Biehlmaier O, Seeliger MW, Das T, Kohler K, Harris WA, et al. Genetic Disorders of Vision Revealed by a Behavioral Screen of 400 Essential Loci in Zebrafish. J Neurosci. 1999. Oct 1;19(19):8603–15. doi: 10.1523/JNEUROSCI.19-19-08603.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref038] 38.Masai I, Stemple DL, Okamoto H, Wilson SW. Midline Signals Regulate Retinal Neurogenesis in Zebrafish. Neuron. 2000. Aug 1;27(2):251–63. doi: 10.1016/s0896-6273(00)00034-9 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref039] 39.Tamai TK, Young LC, Whitmore D. Light signaling to the zebrafish circadian clock by Cryptochrome 1a. Proc Natl Acad Sci U S A. 2007. Sep 11;104(37):14712–7. doi: 10.1073/pnas.0704588104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref040] 40.Hirayama J, Cardone L, Doi M, Sassone-Corsi P. Common pathways in circadian and cell cycle clocks: light-dependent activation of Fos/AP-1 in zebrafish controls CRY-1a and WEE-1. Proc Natl Acad Sci U S A. 2005. Jul 19;102(29):10194–9. doi: 10.1073/pnas.0502610102 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref041] 41.Vatine G, Vallone D, Appelbaum L, Mracek P, Ben-Moshe Z, Lahiri K, et al. Light directs zebrafish period2 expression via conserved D and E boxes. PLoS Biol. 2009. Oct;7(10):e1000223. doi: 10.1371/journal.pbio.1000223 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref042] 42.Weger BD, Sahinbas M, Otto GW, Mracek P, Armant O, Dolle D, et al. The light responsive transcriptome of the zebrafish: function and regulation. PloS One. 2011. Feb 15;6(2):e17080. doi: 10.1371/journal.pone.0017080 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref043] 43.Ziv L, Levkovitz S, Toyama R, Falcon J, Gothilf Y. Functional development of the zebrafish pineal gland: light-induced expression of period2 is required for onset of the circadian clock. J Neuroendocrinol. 2005. May;17(5):314–20. doi: 10.1111/j.1365-2826.2005.01315.x [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref044] 44.Aschoff J. Exogenous and endogenous components in circadian rhythms. Cold Spring Harb Symp Quant Biol. 1960;25:11–28. doi: 10.1101/sqb.1960.025.01.004 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref045] 45.Ben-Moshe Livne Z, Alon S, Vallone D, Bayleyen Y, Tovin A, Shainer I, et al. Genetically Blocking the Zebrafish Pineal Clock Affects Circadian Behavior. PLoS Genet. 2016. Nov;12(11):e1006445. doi: 10.1371/journal.pgen.1006445 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref046] 46.Ben-Moshe Z, Alon S, Mracek P, Faigenbloom L, Tovin A, Vatine GD, et al. The light-induced transcriptome of the zebrafish pineal gland reveals complex regulation of the circadian clockwork by light. Nucleic Acids Res. 2014. Apr;42(6):3750–67. doi: 10.1093/nar/gkt1359 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref047] 47.Hirayama J, Alifu Y, Hamabe R, Yamaguchi S, Tomita J, Maruyama Y, et al. The clock components Period2, Cryptochrome1a, and Cryptochrome2a function in establishing light-dependent behavioral rhythms and/or total activity levels in zebrafish. Sci Rep. 2019. Jan 17;9(1):196. doi: 10.1038/s41598-018-37879-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref048] 48.Ruggiero G, Ben-Moshe Livne Z, Wexler Y, Geyer N, Vallone D, Gothilf Y, et al. Period 2: A Regulator of Multiple Tissue-Specific Circadian Functions. Front Mol Neurosci. 2021;14:718387. doi: 10.3389/fnmol.2021.718387 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref049] 49.Wang M, Zhong Z, Zhong Y, Zhang W, Wang H. The Zebrafish Period2 Protein Positively Regulates the Circadian Clock through Mediation of Retinoic Acid Receptor (RAR)-related Orphan Receptor α (Rorα). J Biol Chem. 2015. Feb 13;290(7):4367–82. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref050] 50.Fernandes AM, Fero K, Arrenberg AB, Bergeron SA, Driever W, Burgess HA. Deep brain photoreceptors control light seeking behavior in zebrafish larvae. Curr Biol CB. 2012. Nov 6;22(21):2042–7. doi: 10.1016/j.cub.2012.08.016 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref051] 51.Sapède D, Cau E. The pineal gland from development to function. Curr Top Dev Biol. 2013;106:171–215. doi: 10.1016/B978-0-12-416021-7.00005-5 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref052] 52.Zhdanova IV, Reebs SG. Circadian Rhythms in Fish. Fish Physiology (Academic Press; ). 2005;197–238. [Google Scholar]

[pgen.1011172.ref053] 53.Tosini G, Bertolucci C, Foà A. The circadian system of reptiles: a multioscillatory and multiphotoreceptive system. Physiol Behav. 2001. Mar 1;72(4):461–71. doi: 10.1016/s0031-9384(00)00423-6 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref054] 54.Menaker M, Underwood H. Extraretinal Photoreception in Birds. Photochem Photobiol. 1976;23(4):299–306. doi: 10.1111/j.1751-1097.1976.tb07251.x [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref055] 55.Dekens MPS, Fontinha BM, Gallach M, Pflügler S, Tessmar-Raible K. Melanopsin elevates locomotor activity during the wake state of the diurnal zebrafish. EMBO Rep. 2022. May 4;23(5):e51528. doi: 10.15252/embr.202051528 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref056] 56.Davies WIL, Tamai TK, Zheng L, Fu JK, Rihel J, Foster RG, et al. An extended family of novel vertebrate photopigments is widely expressed and displays a diversity of function. Genome Res. 2015. Nov;25(11):1666–79. doi: 10.1101/gr.189886.115 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref057] 57.Vatine G, Vallone D, Gothilf Y, Foulkes NS. It’s time to swim! Zebrafish and the circadian clock. FEBS Lett. 2011. May 20;585(10):1485–94. doi: 10.1016/j.febslet.2011.04.007 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref058] 58.Halford S, Freedman Melanie S, Bellingham J, Inglis SL, Poopalasundaram S, Soni BG, et al. Characterization of a Novel Human Opsin Gene with Wide Tissue Expression and Identification of Embedded and Flanking Genes on Chromosome 1q43. Genomics. 2001. Mar 1;72(2):203–8. doi: 10.1006/geno.2001.6469 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref059] 59.Tarttelin EE, Bellingham J, Hankins MW, Foster RG, Lucas RJ. Neuropsin (Opn5): a novel opsin identified in mammalian neural tissue 1. FEBS Lett. 2003;554(3):410–6. [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref060] 60.Lekk I, Duboc V, Faro A, Nicolaou S, Blader P, Wilson SW. Sox1a mediates the ability of the parapineal to impart habenular left-right asymmetry. Bronner ME, White RM, Moens CB, editors. eLife. 2019. Aug 2;8:e47376. doi: 10.7554/eLife.47376 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref061] 61.Vignet C, Bégout ML, Péan S, Lyphout L, Leguay D, Cousin X. Systematic screening of behavioral responses in two zebrafish strains. Zebrafish. 2013. Sep;10(3):365–75. doi: 10.1089/zeb.2013.0871 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref062] 62.Cau E, Quillien A, Blader P. Notch resolves mixed neural identities in the zebrafish epiphysis. Dev Camb Engl. 2008. Aug;135(14):2391–401. doi: 10.1242/dev.013482 [DOI] [PubMed] [Google Scholar]

[pgen.1011172.ref063] 63.Zielinski T, Moore AM, Troup E, Halliday KJ, Millar AJ. Strengths and Limitations of Period Estimation Methods for Circadian Data. PLOS ONE. 2014. May 8;9(5):e96462. doi: 10.1371/journal.pone.0096462 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref064] 64.Geissmann Q, Rodriguez LG, Beckwith EJ, Gilestro GF. Rethomics: An R framework to analyse high-throughput behavioural data. PLOS ONE. 2019. Jan 16;14(1):e0209331. doi: 10.1371/journal.pone.0209331 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1011172.ref065] 65.Wickham H. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag; New York: ISBN 978-3-319-24277-4,. 2016; [Google Scholar]

[pgen.1011172.ref066] 66.Quillien A, Gilbert G, Boulet M, Ethuin S, Waltzer L, Vandel L. Prmt5 promotes vascular morphogenesis independently of its methyltransferase activity. PLoS Genet. 2021;17(6). doi: 10.1371/journal.pgen.1009641 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Contribution of the eye and of opn4xa function to circadian photoentrainment in the diurnal zebrafish

Clair Chaigne

Dora Sapède

Xavier Cousin

Laurent Sanchou

Patrick Blader

Elise Cau

Roles

Abstract

Author summary

Introduction

Results

The zebrafish eye is dispensable for the establishment of circadian rhythms

Fig 1. Locomotor activity of larvae devoid of RGCs in LD, DD and LL.

Absence of a functional eye differentially affects the induction of a phase delay and a phase-advance following pulses of light during the subjective night

Fig 2. Larvae devoid of RGCs still photoentrain to pulses of white light at CT16 and CT21.

Table 1. Quantification of the phase shifts in control siblings versus lak-/- (lak) larvae kept in DD or submitted to pulses of white light at CT16 or CT21.

lak mutation affects the induction of cry1a following a pulse of white light at CT21

Fig 3.

opn4xa function contributes to endogenous period setting in LL

Fig 4.

Fig 5. Locomotor activity of larvae devoid of opn4xa-mediated photosensitivity (opn4xa-/-) in LD, DD and LL.

Fig 6. opn4xa -/- larvae show subtle modifications of a few clock genes in LL: RTqPCR performed on pools of 15 larvae for the gene indicated at the top of the figures.

opn4xa function is dispensable for photoentrainment to a pulse of white light during the subjective night

Table 2. Quantification of the phase shifts in opn4xa+/+ versus opn4xa-/- larvae kept in DD or submitted to a 2 hours pulse of white light at CT16.

Fig 7. Larvae devoid of opn4xa-mediated photosensitivity (opn4xa-/-) still photoentrain to pulses of light at CT16 and CT21.

Fig 8. Larvae devoid of RGCs and opn4xa-mediated photosensitivity still entrain to pulses of light at CT16 and CT21.

Table 3. Quantification of the phase shifts in lak versus double mutant larvae kept in DD or submitted to pulses of white light at CT16 or CT21.

Discussion

Subtle defects in opn4xa-/- mutants in LL

RGCs, but not opn4xa, are involved in masking

A Differential Role for RGCs in controlling phase advance versus phase delays in the rhythms of locomotor activity?

RGCs and opn4xa are largely dispensable for shifting circadian rhythms of locomotor activity in response to a pulse of white light

Material and methods

Ethics statement

Zebrafish lines and developmental conditions

Generation of an opn4xa mutant allele

Locomotor activity assays

In situ hybridization

Locomotor activity analysis

Analysis of clock gene expression using RTqPCR

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Gregory S Barsh

John Ewer

Roles

Author response to Decision Letter 0

Decision Letter 1

Gregory S Barsh

John Ewer

Roles

Author response to Decision Letter 1

Decision Letter 2

Gregory S Barsh

John Ewer

Roles

Author response to Decision Letter 2

Decision Letter 3

Gregory S Barsh

John Ewer

Roles

Acceptance letter

Gregory S Barsh

John Ewer

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases