Effects of microencapsulated essential oils and organic acids preparation on growth performance, slaughter characteristics, nutrient digestibility and intestinal microenvironment of broiler chickens

Jia Huang; Fangshen Guo; Waseem Abbas; Zeqiong Hu; Lin Liu; Jianing Qiao; Ruichen Bi; Tiantian Xu; Kaichen Zhang; Jinyu Huang; Yuming Guo; Zhong Wang

doi:10.1016/j.psj.2024.103655

. 2024 Mar 16;103(5):103655. doi: 10.1016/j.psj.2024.103655

Effects of microencapsulated essential oils and organic acids preparation on growth performance, slaughter characteristics, nutrient digestibility and intestinal microenvironment of broiler chickens

Jia Huang ^*, Fangshen Guo ^*, Waseem Abbas ^*, Zeqiong Hu ^*, Lin Liu ^*, Jianing Qiao ^*, Ruichen Bi ^*, Tiantian Xu ^*, Kaichen Zhang ^†, Jinyu Huang ^‡, Yuming Guo ^*, Zhong Wang ^*,¹

PMCID: PMC11067778 PMID: 38537402

Abstract

To develop effective antibiotics alternatives is getting more and more important to poultry healthy production. The study investigated the effects of a microencapsulated essential oils and organic acids preparation (EOA) on growth performance, slaughter performance, nutrient digestibility and intestinal microenvironment of broilers. A total of 624 1-day-old male Arbor Acres broilers were randomly divided into 6 groups including the control group (T1) fed with basal diet, the antibiotic group (T2) supplemented with basal diet with 45 mg/kg bacitracin methylene disalicylate (BMD), and 4 inclusion levels of EOA-treated groups (T3, T4, T5, T6 groups) chickens given basal diet with 200, 400, 600, and 800 mg EOA/kg of diet, respectively. Results showed that compared with the control, the 200 mg/kg EOA group increased average daily gain (ADG) and average body weight (ABW) during the early stage (P < 0.05). EOA addition decreased crypt depth of the ileum (P < 0.05), but villus height to crypt depth ratio was increased by EOA addition at 200 and 400 mg/kg at d 21 (P < 0.05). Compared with the control, dietary addition EOA at 200, 400 and 600 mg/kg increased the lipase activity in the duodenum at d 21 (P < 0.05). Increased lactic acid bacteria population was found in cecal digesta of the 400 mg/kg EOA group at d 21 (P < 0.05), and higher concentration of butyric acid level was observed in cecal digesta at d 21 and d 42 in the 200 mg/kg EOA group compared with the control (P < 0.05). RT-PCR analysis found that dietary EOA addition decreased the gene expression of IL-1β, COX-2 and TGF-β4 in the ileum at d 21 (P < 0.05), while only the 200 mg/kg EOA increased the gene expression of IL-10, TGF-β4, Claudin-1, ZO-1, CATH-1, CATH-3, AvBD-1, AvBD-9 and AvBD-12 in the ileum at d 42 (P < 0.05) compared with the control. In summary, adding 200 mg/kg and 400 mg/kg of the EOA to the diet could improve the growth performance and intestinal microenvironment through improving intestinal morphology, increasing digestive enzymes activity and cecal lactic acid bacteria abundance and butyric acid content, improving intestinal barrier function as well as maintaining intestinal immune homeostasis. The improving effect induced by EOA addition in the early growth stage was better than that in the later growth stage. Overall, the EOA product might be an effective antibiotic alternative for broiler industry.

Key words: broiler, microencapsulated essential oils and organic acids preparation, intestinal microenvironment

INTRODUCTION

Although sub-therapeutic levels of antibiotics have been utilized in the livestock industry to improve growth and production performance while decreasing morbidity and mortality, the long-term use of in-feed antibiotics in livestock and poultry has brought about a series of problems such as the dramatic increase in the emergence and spread of bacterial antibiotic-resistance bacteria, disruption of intestinal flora, compromised immune system and the phenomenon of “trichomonas” as well as antibiotic residues in animal and poultry products and antibiotic contamination around environment (Mehdi et al., 2018; Kalia et al., 2022). Therefore, countries and regions around the world, such as the European Union, the United States, Canada, and China have gradually restricted or banned the use of antibiotics as growth promoters for livestock and poultry (Salim et al., 2018). At the same time, intestinal diseases caused by intestinal pathogens such as pathogenic Escherichia coli, Clostridium perfringens, Salmonella, Campylobacter spp, and Enterococcus etc. have not disappeared with the restriction or prohibition of antibiotics in feed. Moreover, intestinal health problems caused by these pathogens are getting more and more serious, thereby causing the overall decline of production performance in animal and poultry industry (Kaldhusdal et al., 2016). Therefore, in the postantibiotic era, the development of effective in-feed antibiotic substitutes has become more important and urgent for reducing negative effects of antibiotics.

Among many substances, organic acids such as formic acid, propionic acid, butyric acid, fumaric acid, malic acid, benzoic acid, and their inorganic salts or lipids have been reported to have obvious bacteriostatic, bactericidal, and anti-inflammatory effects, and have been used to improve livestock and poultry production performance (Sun et al., 2020; Sobotik et al., 2021) and intestinal health (Saleem et al., 2020; Manvatkar et al., 2022), improve nutrient digestibility (Nguyen et al., 2018; Zhu et al., 2022) and control intestinal pathogen infection in chickens (Scicutella et al., 2021). In addition, plant-derived essential oils such as thymol, carvacrol, eugenol, cinnamaldehyde are also often used as in-feed antibiotic alternatives to improve livestock and poultry performance (Youssef et al., 2021; Noruzi et al., 2022), intestinal health (Mohebodini et al., 2021; Zhang et al., 2021), feed digestion and absorption efficiency (Elbaz et al., 2022), and to control chicken intestinal pathogens such as E. coli (Pham et al., 2023), Salmonella (Moharreri et al., 2022), and C. jejuni (Wannissorn et al., 2005), C. perfringens (Yang et al., 2016) and coccidia infections (Remmal et al., 2011) due to their significant antibacterial, bactericidal and antioxidant effects as well as their ability to stimulate intestinal digestive enzyme secretion without residues or toxic effects (Abd El-Hack et al., 2022).

In addition, studies have demonstrated that the addition of hydrophilic organic acids and hydrophobic essential oils complex is more effective in inhibiting pathogenic bacteria than their individual addition (Vande Maele et al., 2016; Zhang et al., 2019; Gómez-García et al., 2020; Huang et al., 2021), and exhibits positive impacts in regulating poultry immunity and intestinal microflora, enhancing intestinal barrier function, thereby improving poultry growth performance and feed efficiency (Liu et al., 2017; van Eerden et al., 2022) along with controlling sub-clinical infection caused by enteric pathogens including E. coli, Salmonella, C. perfringens, C. jejuni and coccidia infections in chickens (Pham et al., 2020;2022; Hu et al., 2023; Pham et al., 2023). The synergistic effect of organic acids and plant-derived essential oils might be the hydrophobic essential oils disrupt the integrity of bacterial cell membranes, making it easier for hydrophilic organic acids to enter bacterial cells and achieve antibacterial and bactericidal effects (Ait-Ouazzou et al., 2011). In this experiment, we designed a formula based on the antibacterial and antimicrobial functions of organic acids and essential oils, and first carried out a study on its antibacterial effect for chicken common enteric pathogens in vitro using micro-dilution method, which was found to have broad-spectrum bacteriostatic effects on E. coli, Salmonella and C. perfringens (unpublished data). Then, we further study the impacts of adding this microencapsulated essential oils and organic acids preparation into diets on growth performance, slaughtering performance, nutrient digestibility, and intestinal microenvironment along with gut health of broilers through comparing with in-feed antibiotic BMD, with the purpose of providing effective in-feed antibiotic substitutes for nonantibiotic production in broiler chickens.

MATERIALS AND METHODS

Broiler Chickens, Diets, and Experimental Design

All the procedures implemented in this study were approved by the Experimental Animal Welfare and Animal Experiment Ethics Review Committee of China Agricultural University (statement no: AW11112202-1-5).

A total of 624 1 day-old male Arbor Acres broiler chickens with similar body weight and condition procured from a local commercial hatchery were selected and randomly allocated to 48 floor pens with 6 dietary treatment groups, with 8 replicates and 13 chickens per pen. The experimental treatment proceeded as follows: 1) control group (T1; fed with a basal diet); 2) antibiotic group (T2; fed the basal diet with 300 mg/kg bacitracin methylene disalicylate (BMD, 15% purity); 3) 4 inclusion levels of EOA-treated groups (T3, T4, T5 and T6 groups; chickens received the basal diet with 200, 400, 600 and 800 mg EOA/kg of diet, respectively). The initial weight of broiler chickens in each pen before entry was not different (P > 0.05) through analysis of variance. The blend of encapsulated essential oil and organic acid used in the experiment was provided by a commercial company (Menon Co., Ltd., Shanghai, China). Its main ingredients were fumaric acid ≥ 22%, malic acid ≥ 9%, benzoic acid ≥ 5%, thymol ≥ 2%, and carvacrol ≥ 0.5%, coating materials and carriers. Corn-soybean meal-based diets were formulated to in accordance with the Chinese Chicken Breeding Standards (NY/T33-2004) and in conjunction with the Arbor Acres Broiler Chicken Breeding Manual (pelleted diet, antibiotic-free and coccidiostat-free), 0.5% titanium dioxide was added to the diet in the later growth stage (from d 21 to d 42) as an exogenous indicator (Table 1). The experiment performed in automated controlled temperature, humidity and ventilation rooms at Zhuozhou poultry farm (Hebei, China). All the pens were within the same environmentally controlled facility, which was equipped with a nipple drinker and a plastic feeder. Chickens had free access to feed and water. The temperature, lighting program and relative humidity were set according to the commercial Arbor Acres management manual.

Table 1.

Composition and nutrient levels of the basal diets.

Ingredients (%)	D 0–21	D 21–42	Nutrient contents³	D 0–21	D 21–42
Maize (8.0%, CP)	42.03	31.32	ME (Mcal/kg)	3.03	3.17
Soybean meal (46.0%, CP)	33.80	28.00	Crude protein (%)	21.00	19.57
Wheat (15.3%, CP)	15.00	30.00	Calcium (%)	1.00	0.92
Soybean oil	4.60	6.60	Available phosphorus (%)	0.36	0.35
Limestone	1.41	1.23	Lysine (%)	1.31	1.15
Dicalcium phosphate	1.50	1.40	Methionine (%)	0.60	0.50
Sodium chloride	0.25	0.15
Sodium bicarbonate	0.15	0.15
L-Lysine hydrochloride (78.8%)	0.33	0.30
DL-Methionine (99%)	0.30	0.22
L-Threonine (98%)	0.11	0.08
Choline chloride (50%)	0.25	0.28
Vitamin premix¹	0.03	0.03
Trace mineral premix²	0.20	0.20
Phytase	0.02	0.02
Wheat enzyme	0.02	0.02
Total	100.00	100.00

Open in a new tab

Composition of vitamin premix provided per kg of complete diet: vitamin A (retinyl acetate), 12,500 IU; vitamin D₃ (cholecalciferol), 2,500 IU; vitamin E (DL-a-tocopherol acetate), 30 IU; vitamin K₃ (menadione sodium bisulfate), 2.65 mg; vitamin B₁₂ (cyanocobalamin), 0.025 mg; biotin, 0.30 mg; folic acid, 1.25 mg; nicotinic acid, 50 mg; d-pantothenic acid, 12 mg; pyridoxine hydrochloride, 6.0 mg; riboflavin, 6.5 mg; thiamine mononitrate, 3.0 mg.

Trace mineral premix provided per kg of complete diet: iron, 80 mg; copper, 8 mg; manganese, 100 mg; zinc, 80 mg; iodine, 0.35 mg; selenium, 0.15 mg.

ME was a calculated value, while the others were measured values.

Measurement of Growth Performance and Slaughter Traits

Mortality was recorded daily for each replicate cage. Total body weight and remaining feed per pen were weighed and recorded on d 1, 21, and 42 in the early morning after an 8-h period of feed deprivation. Average body weight (ABW), average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR) were calculated. At the end of the experiment (42 d of age), 8 birds with an average weight per treatment group was randomly selected and ethically slaughtered to assess slaughter performance after 4 h of feed deprivation. The live weight before slaughter was weighed, and then euthanized and scalded, finally feather, head, viscera, and feet were removed. After evisceration, carcass, semi-eviscerated, full eviscerated, abdominal fat, breast muscle, and leg muscle were dissected out and weighed, separately. Dressing percentage, semi-eviscerated rate, eviscerated rate, abdominal fat rate, breast muscle rate, and leg muscle rate were calculated, respectively. Methods refer to “Terms and Measurement Statistical Methods of Poultry Production Performance (NY/T 823–2004).”

Samples Collection

On d 21 and d 42, 8 broiler chickens with a body weight close to the average in each treatment group was randomly selected, euthanized for collecting samples. The middle intestinal sections of the ileum were cut out, washed with ice-cold sterile saline, and then immediately snap-frozen in liquid nitrogen and stored at –80℃ for mRNA expression determination. Approximately 1 cm-long ileal sample were rinsed in 0.9% (w/vol) physiological saline and then fixed in 4% (w/vol) paraformaldehyde buffer solution for later morphological analysis. The cecal contents were aseptically collected into 3 sterile tubes, immediately snap-frozen in liquid nitrogen and then transferred to –80℃ for microbial culture, microbial 16S rRNA analysis and the measurement of short chain fatty acids (SCFAs) content, respectively. Small intestinal mucosa was collected, homogenized in ice-cold PBS (pH 7.2), centrifuged and then collected the supernatant and stored at –20℃ for digestive enzyme activity (amylase, lipase, trypsin and chymotrypsin) analysis, and ileal mucosa for secretary IgA determination. The digesta in the ileum was collected on d 42, and then freeze-dried until constant weight to determine the apparent metabolic energy and apparent digestibility of diet.

Measurement of the Ileal Nutrient Apparent Digestibility

Freeze-dried diets and ileal digesta were ground through a 0.5-mm sieve to measure dry matter (DM), gross energy (GE), crude protein (CP), starch, crude fat, amino acids (AA) and titanium dioxide. Dry matter was determined using the standard procedure drying them to a constant weight at 105°C in a forced draft oven for 24 h (Method 930.15; AOAC International, 2005). Titanium dioxide content in diets and digesta was measured on a UV spectrophotometer following the method of (Myers et al., 2004). Gross energy was determined in a bomb calorimeter (IKA Calorimeter System C 5000; IKA Works, Wilmington, NC) standardized with benzoic acid. Nitrogen was determined by the combustion method (method 968.06; AOAC International, 2005) using a BUCHI-K350 semi-automatic Kjeldahl nitrogen analyzer. The crude protein (CP) content was calculated as N × 6.25. Starch was measured using the Megazyme total starch assay kit (Megazyme International Ireland Ltd., Wicklow, Ireland) based on thermostable α-amylase and amyloglucosidase. Crude fat was determined by Soxhlet extraction procedure with diethyl ether (Method 2003.06; AOAC International, 2005). For AA analyses, digesta samples were prepared by acid hydrolysis according to (Method 994.12; AOAC International, 2005). Briefly, 100 mg of each sample was digested in 2.5 mL of concentrated hydrochloric acid (HCL) for 24 h at 110°C, followed by neutralization with 6 mol/L NaOH and cooled to room temperature. Feed and digesta samples for the analysis of sulfur-containing AA (Met and Cys) were subjected to performic acid oxidation prior to acid hydrolysis.

The apparent digestibility of energy, starch, protein, fat and amino acids were calculated according the following formula:

Apparent digestibility (%) = [1-(content of titanium dioxide in diet/content of titanium dioxide in digesta) × (content of nutrients in digesta/content of nutrients in diet)] ×100%.

Assay of Morphology and Goblet Cells in the Ileum

According to the method of Wu et al. (Wu et al., 2018), fixed ileum tissues were dehydrated using alcohol gradients in a tissue processor (Leica Microsystems K. K., Tokyo, Japan), made transparent with xylene, and then embedded in paraffin wax. Paraffin-embedded samples were sliced (5 μm-thick slices) serially using a microtome (Leica Microsystems K. K., Tokyo, Japan) and mounted on glass slides (CITOGLAS, Jiangsu, China). The mounted slices were de-paraffined with xylene and then rehydrated in 95% alcohol (5 min) and 50% alcohol (5 min). Afterward, the sections were subjected to hematoxylin and eosin staining (H&E) for villus morphology measurement or were stained with Periodic Acid-Schiffstain (PAS) for goblet cell density measurement. Ten complete and straight villi from each HE-stained section were randomly selected to measure villus height, crypt depth, villus width, and muscle layer thickness. And the ratio of villus height to crypt depth (VH/CD) and villus surface area (VSA) were calculated. The VSA is the convex surface area of the villi cylinder, VSA = 2πrh, r is the radius (half of the villi width), h is the height of villi. Complete and straight intestinal villi was randomly selected from each PAS-stained section to measure the density of goblet cells (GC). Each 100 μm intestinal villi was 1 intestinal villi unit, while 10 full-length intestinal villus units were selected for goblet cell numbers counting on each section. Goblet cell density was expressed as the number of goblet cells per 100 μm villi (cell counts/100 μm). An Olympus optical microscope (Progres capturepro software; version 2.7, Jenoptik, Jena, Germany) was used for performing all examinations and measurements.

Measurement of Enzyme Activity in Small Intestinal Mucosa

The mucosa sample of the duodenum, jejunum and ileum were weighed, diluted in sterile cold physiological saline in a ratio of weight (g) to volume (mL) = 1 : 9, homogenized and then centrifuged at 4℃ and 2500 rpm for 10 min to collect the mucosal supernatant, respectively. The activities of amylase, lipase, trypsin, and chymotrypsin in mucosal supernatant were measured using corresponding digestive enzyme assay kits, receptively (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China). The protein content in the supernatant was determined using the bicinchoninic acid (BCA) protein quantification kit (purchased from Nanjing Jiancheng Biotechnology Co., Ltd.). The enzyme activity was expressed as the activity unit per milligram protein.

Determination of Secretary Immunoglobulin A (sIgA) Content in Ileal Mucosa

The ileal mucosa was weighted, diluted in ice-cold sterile physiological saline in a ratio of weight (g) to volume (mL) = 1 : 9, homogenized, and then centrifuged at 4,000 rpm for 10 min at 4℃. The mucosal supernatant was collected and stored at –80℃. The sIgA content was measured using the chicken sIgA ELISA quantitative kit (Shanghai mlBio Technology Co., Ltd., Shanghai, China) according to the manufacturers’ instructions. The protein concentration in the supernatant was determined using the BCA protein quantification kit (Nanjing Jiancheng Biotechnology Co., Ltd.). The value was expressed as the level of sIgA per gram protein.

Measurement of Cecal Microbiota

The cecal contents sample (0.50 g) from each group were weighted, diluted to an initial 10⁻¹ with ice-cold sterile buffered peptone water (CM201, Land Bridge Technology Ltd.), and homogenized separately with a Heidolph Diax 600 homogenizer (Heidolph, Schwabach, Germany). The homogenized suspension of each organ was serially diluted from 10⁻¹ to 10⁻⁷ with the sterile PBS (pH 7.2) solution, and 100 μL of each diluted sample were subsequently plated on selective agar plates for bacterial counting in duplicate. Escherichia coli was plated on MacConkey agar (CM908; Beijing Land Bridge Technology Co., Ltd., Beijing, China) after aerobic incubation at 37°C for 24 h. Numbers of C. perfringens were determined on cycloserine supplemented Tryptose-Sulphite-Cycloserine agar (CM 138; Beijing Land Bridge Technology Co., Ltd.) after anaerobic incubation at 37°C for 48 h (black colonies). Campylobacter was measured on CCDA Base agar media supplemented CCD agar additive after anaerobic incubation at 37°C for 48 h (white colonies).The cecal contents were serially diluted in PBS and plated on de Man, Rogosa, and Sharpe agar (MRS agar, CM 188, Land Bridge Technology Ltd.) for enumeration of lactic acid bacteria (LAB). The number of colony forming units (CFUs) was expressed as a logarithmic (log10) value per gram of intestinal digesta.

Measurement of Short Chain Fatty Acid (SCFA) Content in Cecal Digesta

Cecal SCFA were determined using a gas chromatograph (GC) following the method of Hu Z et al. (Hu et al., 2023). The thawed cecal digesta sample (0.50 g) was diluted in 1.0 mL of deionized water in a 1.5 mL centrifuge tube, homogenized thoroughly until the materials were completely dissolved, and then centrifuged at 4℃ and 15,000 rpm for 10 min to collect the supernatant. Then, 400 μL of supernatant was combined with 25% meta-phosphate acid solution containing internal standard 2-ethylbutyric acid into a 1.5 mL centrifuge tube, vortexed and rested at 4℃ overnight to precipitate the protein, and then centrifuged at 4℃ and 15,000 rpm for 10 min. The supernatant was collected and filtered with a 0.22 µm aqueous phase filter membrane, and then transferred to a glass vial and analyzed via gas chromatograph (GC-2014; Shimadzu Corporation, Kyoto, Japan) equipped with a hydrogen flame detector and a capillary column (Agilent Technologies, Santa Clara, CA,; 30 m long, 0.32-mm diameter, 0.50-μm film thickness). Nitrogen was used as the carrier gas, with a flow rate at 46.3 cm/s; sampling quantity was 0.4 μL. The inlet temperature was 220℃; The column temperature was 110℃ and maintained for 30 s, then increased to 120℃ at a rate of 10℃/min and maintained for 4 min, and then increased to 150℃ at a rate of 10℃/min; The detector temperature was 250℃. Results are expressed as micro-mol per gram of the weight of digesta.

Measurement of Gene Expression in Ileum Using Quantitative Real-time PCR

Extraction of total RNA in the ileum (about 100 mg) was performed by using Trizol reagent (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The purity and concentration of total RNA were measured using a NanoDrop-2,000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Then, cDNA was synthesized by using PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (Takara BioTechnology Co. Ltd., Beijing, China). Quantitative real-time PCR (qRT-PCR) reactions were performed in the Applied Biosystems' 7500 Fast Real-Time PCR system by using SYBR Premix Ex Taq diagnostic kit (Takara BioTechnology Co. Ltd., Beijing, China) and each sample was measured in duplicate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as housekeeping control to normalize variations in the mRNA amount for the target genes including immune regulatory-related genes (IL-1β,iNOS,COX-2,IL-10,TNF-α,TGF-β4), tight junction protein-related genes (Claudin-1, ZO-1, Occludin, FABP-2), Mucin-2, lysozyme, antimicrobial peptides related genes (CATH1, CATH3, AVBD1, AVBD2, AVBD4, AVBD9, AVBD10, AVBD12) and nutrient transport vectors related genes (SGLT1). The primers (Table 2) were based on chicken sequences and were purchased from Sango Biological Engineering Co., Ltd. (Shanghai, China). Relative target gene expression level of each target gene was normalized by the comparative cycle threshold (CT) 2^−ΔΔCt method (Livak and Schmittgen, 2001).

Table 2.

Primer sequences of qRT-PCR¹.

Gene	Primer sequence 5′→ 3′	GenBank Accession No.
TNF-α	F: GAGCGTTGACTTGGCTGTC	NM_204267.2
	R: AAGCAACAACCAGCTATGCAC
IL-1β	F: ACTGGGCATCAAGGGCTA	XM_015297469.1
	R: GGTAGAAGATGAAGCGGGTC
IL-6	F: CGCCCAGAAATCCCTCCTC	XM_015281283.1
	R: AGGCACTGAAACTCCTGGTC
iNOS	F: TGGGTGGAAGCCGAAATA	NM_204961.1
	R: GTACCAGCCGTTGAAAGGAC
COX-2	F: TGTCCTTTCACTGCTTTCCAT	NM_001167718
	R: TTCCATTGCTGTGTTTGAGGT
IL-10	F: GCTGCCAAGCCCTGTT	NM_001004414.4
	R: CCTCAAACTTCACCCTCA
TGF-β4	F: AGGATCTGCAGTGGAAGTGGAT	M31160
	R: CCCCGGGTTGTGTGTTGGT
Mucin-2	F: TTCATGATGCCTGCTCTTGTG	XM_040701667.1
	R: CCTGAGCCTTGGTACATTCTTGT
Claudin-1	F: CATACTCCTGGGTCTGGTTGGT	NM_001013611.2
	R: GACAGCCATCCGCATCTTCT
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM_015278981.2
	R: CTGTGGTTTCATGGCTGGATC
Occludin	F: ACGGCAGCACCTACCTCAA	NM_205128.1
	R: GGGCGAAGAAGCAGATGAG
FABP-2	F: TGGAAGCAATGGGCGTGAAT	NM_001007923.1
	R: TGTCGATGGTACGGAAGTTGC
Lysozyme c	F: GACGATGTGAGCTGGCAG	NM_205281
	R: GGATGTTGCACAGGTTCC
SGLT1	F: GATGTGCGGATACCTGAAGC	XM_415247
	R: AGGGATGCCAACATGACTGA
CATH1	F: GCTGTGGACTCCTACAACCAAC	FJ938357.1
	R: GGAGTCCACGCAGGTGACATC
CATH3	F: TGCGAGTTCAAGGAGGAC	NM_001311177.1
	R: CTGATGGCTTTGTAGAGG
AVBD1	F: GAGTGGCTTCTGTGCATTTCTG	NM_204993.1
	R: TTGAGCATTTCCCACTGATGAG
AVBD2	F: TCTGCAGCCATGAGGATTC	XM_015285091.1
	R: TAAAGCACATGCCTGGAAGAAAT
AVBD4	F: CGTGCTCCTCTTTGTGGCAG	NM_001001610.2
	R: GACGGCATAGCCCCAGGTAA
AVBD9	F: ATGAGAATCCTTTTCTTCCTTGTTGCT	NM_001001611.2
	R: TAGGAGCTAGGTGCCCATTTGCAGC
AVBD10	F: TGGGGCACGCAGTCCACAAC	NM_001001609.1
	R: CATGCCCCAGCACGGCAGAA
AVBD12	F: TGTAACCACGACAGGGGATTG	NM_001001607.2
	R: GGGAGTTGGTGACAGAGGTTT
GAPDH	F: GGTGGTGCTAAGCGTGTTAT	K01485
	R: ACCTCTGTCATCTCTCCACA

Open in a new tab

Primers were designed and synthesized by Sango Biotech (Shanghai, China) Co., Ltd.

Abbreviations: AVBD, avian beta-defensin; CATH, cathelicidin; COX-2, cyclooxygenase 2; F, forward; FABP-2, fatty acid binding protein 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL, interleukin; iNOS, inducible nitric oxide synthase; R, reverse; SGLT1, sodium-glucose cotransporter 1; TGF-β4, transforming growth factor β4; TNF-α, tumor necrosis factor α; ZO-1, zonula occludens protein 1.

Statistical Analysis

Data from all groups were analyzed by ANOVA using Duncan's multiple comparison. Then, the experimental data from different levels of EOA groups except for antibiotic-treated group were determined by ANOVA using the general linear model (GLM) procedure of SPSS Statistics Version 20.0 (IBM Corporation. Somers, NY) with linear and quadratic comparison. The results were expressed as means and standard error of mean (SEM). The differences between the groups were explored using the LSD multiple range test (Tukey's multiple comparison test or Duncan's multiple comparison). Statistical results take P < 0.05 as a significant difference, and 0.05 < P < 0.1 as a trend of change.

RESULTS

Growth Performance

As shown in Table 3, during the starter period, compared with the control group (T1), dietary 200 mg/kg EOA addition increased the ABW and ADG (P = 0.017; P = 0.018 < 0.05), which was similar to the BMD-treated group. Moreover, the 200, 600, and 800 mg/kg EOA group tended to improve FCR compared with the control group, but no difference for ABW, ADG, and FCR was observed among different levels of EOA groups (P > 0.05). Compared with the control group and the EOA-treated groups, BMD addition remarkably improved FCR of broilers (P = 0.031 < 0.05). However, there was no difference in mortality rate and ADFI among 6 groups (P > 0.05).

Table 3.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on growth performance of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
D 1–21
Mortality rate, %	2.88	1.92	3.85	2.88	0.96	2.88	0.529	0.730	0.653	0.555	0.864
ADG¹, g/bird/d	40.2^b	42.2^a	41.9^a	40.4^b	41.2^ab	41.0^ab	0.201	0.017	0.127	0.388	0.214
ADFI², g/bird/d	55.7	57.2	57.3	56.0	56.6	55.9	0.212	0.123	0.214	0.900	0.110
ABW³, g/bird	809.4^b	847.5^a	841.4^a	814.1^ab	829.0^ab	823.8^ab	3.834	0.018	0.130	0.391	0.216
FCR⁴	1.39^a	1.36^b	1.37^ab	1.38^a	1.37^ab	1.37^ab	0.003	0.031	0.203	0.101	0.911
D 22–42
Mortality rate, %	6.53	3.22	5.40	4.26	2.08	4.45	0.903	0.793	0.755	0.311	0.698
ADG¹, g/bird/d	101.9	106.1	102.9	102.4	102.4	101.7	0.626	0.378	0.988	0.931	0.612
ADFI², g/bird/d	161.8	167.3	160.6	160.3	157.0	159.6	1.017	0.083	0.728	0.299	0.815
FCR⁴	1.59	1.59	1.56	1.57	1.54	1.57	0.010	0.646	0.757	0.382	0.531
D 1–42
Mortality rate, %	9.61	4.81	8.65	6.73	2.88	6.73	1.098	0.540	0.516	0.200	0.739
ADG¹, g/bird/d	71.9	74.9	73.2	72.2	72.6	72.1	0.352	0.122	0.854	0.887	0.422
ADFI², g/bird/d	110.1	113.7	110.3	109.5	108.2	109.1	1.957	0.537	0.538	0.831	0.514
ABW³, g/bird	2847.9	2967.1	2900.1	2861.7	2877.1	2858.4	13.754	0.123	0.855	0.888	0.423
FCR⁴	1.49	1.47	1.46	1.47	1.45	1.47	0.025	0.376	0.570	0.860	0.670

Open in a new tab

T1: control; T2: basal diet supplemented with 45 mg/kg bacitracin methylene disalicylate (BMD); T3: basal diet supplemented with 200 mg/kg EOA; T4: basal diet supplemented with 400 mg/kg EOA; T5: basal diet supplemented with 600 mg/kg EOA; T6: basal diet supplemented with 800 mg/kg EOA.

SEM: standard error of the mean.

P₁: P value of one-way ANOVA analysis among all groups; P_2, P_L, and P_Q: P value of one-way ANOVA analysis, Linear analysis and Quadratic analysis among 5 groups except for BMD group, respectively.

^{a, b, c, d}

Means in the same row without common superscripts differ significantly (P < 0.05).

ADG, average daily gain.

ADFI, average daily feed intake.

ABW, average body weight.

⁴

FCR, feed conversion ratio.

During the later and the whole stage, no difference for mortality rate, ADG, ADFI, ABW and FCR was observed among 6 groups (P > 0.05).

Carcass Characteristics

As presented in Table 4, BMD treatment had greater eviscerated rate (P = 0.046 < 0.05) than the control group and the 200, 600, and 800 mg/kg EOA groups, but showed similar to that of the 400 mg/kg EOA group. There was no difference in dressing percentage, semi-eviscerated rate, abdominal fat rate, leg muscle rate, and breast muscle rate among 6 groups (P > 0.05).

Table 4.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on slaughter performance (%) of broilers on d 42 (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
Dressing percentage	93.15	93.40	93.19	93.12	92.88	93.19	0.109	0.867	0.927	0.808	0.852
Semi-eviscerated rate	86.63	88.17	86.99	87.32	86.62	86.93	0.174	0.086	0.756	0.775	0.455
Eviscerated rate	74.10^b	76.52^a	74.89^b	75.21^ab	74.95^b	74.94^b	0.220	0.046	0.638	0.231	0.338
Abdominal fat rate	2.07	1.97	1.60	1.89	1.81	1.56	0.083	0.433	0.414	0.188	0.819
Leg muscle rate	18.43	16.73	17.82	17.72	19.33	18.49	0.269	0.102	0.278	0.475	0.338
Breast muscle rate	30.09	32.41	31.65	31.69	31.70	31.75	0.291	0.333	0.488	0.125	0.347

Open in a new tab

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

Apparent Digestibility of Diet

Table 5 showed that dietary addition of either EOA or BMD addition had no difference in apparent digestibility of dietary energy, starch, protein, fat and amino acids between 6 groups (P > 0.05).

Table 5.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on nutrient digestibility of diet (%) of broilers on d 42 (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
Energy	71.07	70.50	63.73	71.11	69.17	72.09	1.059	0.228	0.141	0.516	0.090
Crude fat	81.70	80.79	87.23	91.55	78.86	82.58	1.977	0.497	0.326	0.820	0.177
Crude protein	80.11	78.25	68.65	78.65	76.11	78.11	1.363	0.159	0.125	0.977	0.095
Starch	93.03	91.78	90.43	91.42	91.22	92.77	0.381	0.387	0.191	0.759	0.029
Aspartate	77.91	78.53	70.49	79.18	78.02	78.54	1.167	0.259	0.202	0.467	0.247
Threonine	74.77	75.41	66.05	76.99	75.40	75.12	1.420	0.272	0.203	0.488	0.341
Serine	78.90	78.76	70.42	80.09	78.72	79.04	1.258	0.238	0.169	0.524	0.231
Glutamate	87.99	87.36	82.76	88.47	87.15	87.76	0.781	0.328	0.240	0.701	0.249
Proline	84.77	84.73	79.79	86.35	84.52	85.86	0.872	0.321	0.203	0.411	0.270
Glycine	74.00	73.39	63.74	74.93	73.72	74.11	1.481	0.232	0.169	0.529	0.202
Alanine	76.54	75.44	67.46	78.35	75.28	75.91	1.380	0.294	0.204	0.703	0.323
Valinel	78.13	77.32	69.52	79.73	78.11	77.84	1.307	0.268	0.178	0.571	0.300
Isoleucine	81.80	81.29	73.97	82.73	80.92	80.97	1.143	0.279	0.203	0.729	0.288
Leucine	81.61	80.70	74.20	82.78	80.02	81.24	1.683	0.338	0.225	0.737	0.280
Tyrosine	81.79	81.60	73.05	82.73	79.51	81.31	1.210	0.192	0.147	0.746	0.191
Phenylalanine	82.48	81.34	74.82	82.89	81.28	81.86	1.048	0.237	0.158	0.710	0.192
Histidine	81.28	80.34	73.83	82.38	81.22	81.11	1.135	0.295	0.211	0.580	0.287
Lysine	83.06	82.20	74.18	83.99	82.95	82.89	1.251	0.203	0.156	0.545	0.218
Arginine	85.57	84.04	77.64	86.24	85.47	85.59	1.138	0.237	0.186	0.541	0.216

Open in a new tab

Morphological Structure, Goblet Cell Density and sIgA Content in the Ileum

As illustrated in Table 6 and Figure 1, on d 21, relative to the control group (T1), dietary either EOA or BMD decreased crypt depth (P = 0.009 < 0.05), and higher VH/CD was observed in the BMD group, 200 mg/kg and 400 mg/kg group (P = 0.009 < 0.05). Additionally, EOA addition showed a quadratic relationship for CD and VH/CD with increasing levels of EOA supplementation (P = 0.016; = 0.003 < 0.05). Lower CD was observed in all EOA-treated groups, and the 200 mg/kg and 400 mg/kg EOA group had greater VH/CD compared with the control group (T1). However, no difference was observed in villus surface area (VSA), muscular thickness, GC cells counts (Figure 2), and sIgA content among all groups (P > 0.05).

Table 6.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on morphology and goblet cell density and secretory immunoglobulin A (sIgA) content in the ileum of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
D 21
Villus height, μm	892	1119	924	1209	944	937	38.327	0.082	0.108	0.565	0.121
Crypt depth, μm	242^a	167^b	167^b	185^b	198^b	193^b	6.930	0.009	0.025	0.067	0.016
VH/CD¹	3.87^c	6.82^a	5.64^ab	6.48^a	4.87^bc	4.86^bc	0.259	0.003	0.013	0.201	0.003
Villus surface area, mm²	0.50	0.65	0.63	0.56	0.53	0.56	0.021	0.282	0.373	0.634	0.223
Muscular thickness, μm	230	248	189	233	215	239	6.268	0.078	0.150	0.535	0.103
Goblet cell density, cell counts/100 μm	10.50	11.83	11.50	12.17	11.33	10.00	0.326	0.400	0.356	0.855	0.053
sIgA content, μg/g prot	771	813	756	709	666	687	18.109	0.152	0.361	0.065	0.988
D 42
Villus height, μm	1261	1165	1073	1155	1069	1186	21.890	0.088	0.080	0.199	0.033
Crypt depth, μm	213^a	122^c	177^b	188^ab	199^ab	196^ab	6.328	<0.001	0.259	0.469	0.081
VH/CD¹	6.13^b	9.62^a	6.06^b	6.25^b	5.44^b	6.17^b	0.283	<0.001	0.719	0.707	0.863
Villus surface area, mm²	0.72	0.79	0.75	0.78	0.72	0.80	0.020	0.788	0.743	0.380	0.959
Muscular thickness, μm	280	278	201	270	254	284	8.912	0.053	0.031	0.590	0.021
Goblet cell density, cell counts/100 μm	10.00^b	12.83^a	10.83^b	10.17^b	10.17^b	10.00^b	0.285	0.016	0.864	0.856	0.432
sIgA content, μg/g prot	578	682	669	612	549	644	17.623	0.197	0.290	0.787	0.669

Open in a new tab

SEM: standard error of the mean.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

VH/CD, villus height to crypt depth ratio.

Effect of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on morphological structure in the ileum of broilers. T1: control; T2: basal diet supplemented with 45 mg/kg bacitracin methylene disalicylate (BMD); T3: basal diet supplemented with 200 mg/kg EOA; T4: basal diet supplemented with 400 mg/kg EOA; T5: basal diet supplemented with 600 mg/kg EOA; T6: basal diet supplemented with 800 mg/kg EOA.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on goblet cell density in the ileum of broilers. T1: control; T2: basal diet supplemented with 45 mg/kg bacitracin methylene disalicylate (BMD); T3: basal diet supplemented with 200 mg/kg EOA; T4: basal diet supplemented with 400 mg/kg EOA; T5: basal diet supplemented with 600 mg/kg EOA; T6: basal diet supplemented with 800 mg/kg EOA.

On d 42, as illustrated in Table 6, EOA addition showed a quadratic relationship for VH and muscular thickness with increasing level of EOA supplementation (P = 0.033; = 0.021 < 0.05). Feeding EOA at 200 mg/kg, 400 mg/kg, and 600 mg/kg had lower VH and muscular thickness compared with the control group (Figures 1 and2). BMD addition remarkably lowered CD (P < 0.001) but increased VH/CD (P < 0.001) and GC cell numbers (P = 0.016 < 0.05) compared with the other groups (Table 6 and Figure 2). EOA addition groups only showed a reduced trend for CD compared with the control, but there was no significant differences on VSA, muscular thickness, and sIgA content among all groups.

Enzyme Activity of Small Intestinal Mucosa

As exhibited in Table 7, on d 21, EOA supplementation exhibited a quadratic increase for lipase activity in the duodenum with the increasing level of dietary EOA supplementation (P < 0.05). However, lipase activity in the ileum exhibited a quadratic reduce with the increasing level of dietary EOA supplementation (P < 0.05). Additionally, amylase activity in the jejunum exhibited a linear decrease with the increasing levels of dietary EOA supplementation on d 21 (P < 0.05). Compared with the control, the highest lipase activity in the duodenum was observed in the 600 mg/kg EOA group, followed by the 200 mg/kg and 400 mg/kg EOA group (P < 0.05), but no difference for lipase activity in the duodenum was observed among the 800 mg/kg EOA, the BMD-treated group and the control group. In the ileum, the lower lipase activity was observed in the 200mg/kg, 600 mg/kg and 800 mg/kg EOA group (P < 0.05), but no significant difference for lipase activity in the ileum was observed among the 400 mg/kg EOA, the BMD-treated group and the Control group.

Table 7.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on digestive enzyme activity (d 21) in the gut of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
Duodenum
Amylase activity, U/mgprot	50.79	58.64	53.86	31.53	74.48	54.33	5.224	0.332	0.190	0.517	0.580
Lipase activity, U/gprot	2.17^c	3.74^bc	5.15^b	4.68^b	6.78^a	2.36^c	0.338	<0.001	<0.001	0.027	<0.001
Trypsin activity, U/mgprot	709	1108	1069	1052	946	855	48.789	0.139	0.120	0.344	0.015
Chymotrypsin activity, U/mgprot	0.37	0.25	0.61	0.62	0.43	0.40	0.048	0.189	0.360	0.993	0.064
Jejunum
Amylase activity, U/mgprot	56.05	51.31	43.57	45.70	38.38	35.82	2.431	0.133	0.080	0.007	0.782
Lipase activity, U/gprot	3.57	2.53	3.31	4.68	1.94	4.50	0.378	0.241	0.308	0.891	0.741
Trypsin activity, U/mgprot	491	1001	715	797	847	668	49.581	0.056	0.208	0.110	0.096
Chymotrypsin activity, U/mgprot	0.76	0.58	0.47	0.78	0.52	0.55	0.383	0.083	0.053	0.143	0.685
Ileum
Amylase activity, U/mgprot	18.60	21.47	12.11	14.40	14.61	22.80	1.503	0.239	0.201	0.497	0.027
Lipase activity, U/gprot	1.90^a	1.51^ab	0.89^b	1.40^ab	1.02^b	1.06^b	0.097	0.016	0.013	0.011	0.105
Trypsin activity, U/mgprot	1544	1310	1416	1414	951	1526	119.222	0.761	0.692	0.592	0.584
Chymotrypsin activity, U/mgprot	0.51	0.29	0.29	0.41	0.30	0.37	0.033	0.263	0.243	0.168	0.223

Open in a new tab

SEM: standard error of the mean.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

As exhibited in Table 8, on d 42, trypsin activity in the duodenum and amylase activity in the jejunum had a linear increase with increasing EOA supplementation levels (P < 0.05). However, chymotrypsin activity in the duodenum and lipase activity in the ileum displayed a linear reduce with the increasing levels of dietary EOA supplementation (P < 0.05). Compared with the control, the highest amylase activity in the jejunum was observed in the 600 mg/kg EOA group, followed by the 400 mg/kg and 800 mg/kg EOA group (P < 0.05), but no significant difference for amylase activity in the jejunum was observed among the 200 mg/kg EOA, the BMD-treated group and the Control group. In the ileum, lower lipase activity was observed in the 400mg/kg, 800 mg/kg EOA group and the BMD-treated group (P < 0.05), but no difference for lipase activity in the ileum (P > 0.05) was observed among the 200 mg/kg and 600 mg/kg EOA group.

Table 8.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on digestive enzyme activity (d 42) in the gut of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
Duodenum
Amylase activity, U/mgprot	24.31	16.98	23.08	26.29	18.58	29.31	1.362	0.069	0.244	0.666	0.352
Lipase activity, U/gprot	0.33	0.17	0.37	0.41	0.38	0.35	0.028	0.176	0.936	0.756	0.468
Trypsin activity, U/mgprot	1280	1231	1121	1514	1452	1827	76.276	0.091	0.081	0.025	0.157
Chymotrypsin activity, U/mgprot	0.47	0.36	0.31	0.28	0.37	0.27	0.026	0.210	0.119	0.047	0.269
Jejunum
Amylase activity, U/mgprot	8.39^b	15.04^ab	15.75^ab	18.56^a	23.31^a	19.39^a	1.361	0.029	0.030	0.004	0.239
Lipase activity, U/gprot	0.89	0.64	0.56	0.66	0.76	0.85	0.069	0.743	0.625	0.951	0.139
Trypsin activity, U/mgprot	800	599	1157	759	1014	1283	89.353	0.214	0.414	0.243	0.675
Chymotrypsin activity, U/mgprot	0.52	0.40	0.36	0.44	0.53	0.41	0.031	0.524	0.446	0.697	0.482
Ileum
Amylase activity, U/mgprot	4.48	5.67	3.27	2.14	4.00	5.30	0.425	0.152	0.186	0.635	0.028
Lipase activity, U/gprot	1.04^a	0.68^bc	0.87^ab	0.65^bc	0.76^abc	0.54^c	0.045	0.013	0.005	<0.001	0.884
Trypsin activity, U/mgprot	473	607	837	719	682	730	77.779	0.261	0.230	0.183	0.138
Chymotrypsin activity, U/mgprot	0.35	0.37	0.47	0.35	0.46	0.35	0.029	0.708	0.584	0.927	0.376

Open in a new tab

SEM: standard error of the mean.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

Bacterial Concentration in Cecal Digesta

Bacterial concentration in the cecum is shown in Table 9. On d 21, EOA supplementation exhibited a quadratic increase for lactic acid bacteria and a linear increase in E coli in the cecum with the increasing level of dietary EOA supplementation (P < 0.05). Compared with the control, greater lactic acid bacteria level (P < 0.05) was observed in the 200 mg/kg and 400 mg/kg EOA groups, but no significant difference for lactic acid bacteria and Escherichia coli counts was observed among the other EOA groups and the control group. BMD addition had no influence on lactic acid bacteria concentration compared with the other groups (P > 0.05), but showed a significant increase for E. coli population (P < 0.05) as compared to the control and 200 mg/kg EOA group. On d 42, EOA and BMD addition had no significant effects on lactic acid bacteria and E. coli number.

Table 9.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on microflora (log₁₀ CFU/g)¹ in the cecum of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
D 21
Lactic acid bacteria	8.20^b	8.61^ab	8.65^ab	9.07^a	8.65^ab	8.65^ab	0.072	0.019	0.014	0.036	0.014
Escherichia coli	7.82^b	8.21^a	7.75^b	7.91^b	8.13^ab	8.09^ab	0.059	0.006	0.009	0.029	0.338
Clostridium perfringens	8.43	8.66	8.34	8.89	8.58	8.49	0.066	0.191	0.182	0.462	0.352
Campylobacter	7.11	7.27	7.51	7.12	7.27	7.14	0.075	0.654	0.561	0.914	0.328
d 42
Lactic acid bacteria	8.74	8.61	8.98	9.08	8.96	8.90	0.070	0.426	0.719	0.458	0.247
Escherichia coli	7.63	7.83	7.87	8.36	8.31	8.01	0.100	0.229	0.156	0.076	0.174
Clostridium perfringens	8.83	8.76	9.13	9.34	8.97	8.97	0.067	0.136	0.266	0.605	0.068
Campylobacter	7.61	7.08	7.28	7.08	7.41	7.58	0.088	0.343	0.414	0.858	0.073

Open in a new tab

SEM: standard error of the mean.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

log₁₀CFU/g, log 10 colony-forming units per gram of cecal digesta.

Short Chain Fatty Acids Content in Cecal Digesta

The effect of EOA on SCFAs content in cecal digesta was shown in Table 10. The content of butyric acid (d 21 and d 42) and isobutyric acid (d 21) in cecal digesta increased linearly with the increasing dietary EOA level (P < 0.05). Compared with the control, the 600 mg/kg and 800 mg/kg EOA groups had greater isobutyric acid (d 21) concentration in cecal digesta than the control and the 200 mg/kg and 400 mg/kg EOA groups. Moreover, higher butyric acid content was also observed in the 200, 600, and 800 mg/kg EOA group at d 21 and the 200 and 600 mg/kg EOA group at d 42 than that of the control group (P < 0.05). BMD treatment increased isobutyric acid (d 21) concentration in cecal digesta compared with the control at d 21, but had no marked differences for the concentration of butyric acid and isobutyric acid in cecal digesta compared with the EOA-treated groups at d 21 and d 42 except for the 200 mg/kg EOA group. The 200 mg/kg EOA group had greater butyric acid content in cecal digesta of 42-day-old broilers than that in the antibiotic group (P < 0.05). There was no difference in the contents of acetic acid, propionic acid, isovaleric acid, and valeric acid in cecal digesta at d 21 and d 42 among all groups (P > 0.05).

Table 10.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on the content of short chain fatty acids (μmol/g) in cecum digesta of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
D 21
Acetic acid	15.76	21.92	20.54	18.86	23.60	20.28	0.933	0.227	0.226	0.081	0.377
Propionic acid	2.11	2.31	2.69	1.25	2.04	1.98	0.169	0.255	0.242	0.547	0.899
Isobutyric acid	0.15^b	0.25^a	0.19^ab	0.22^ab	0.26^a	0.28^a	0.013	0.040	0.009	<0.001	0.675
Butyric acid	4.12^b	6.32^ab	7.16^a	4.49^b	7.61^a	6.85^a	0.358	0.008	0.007	0.013	0.531
Isovaleric acid	0.16	0.19	0.19	0.22	0.24	0.21	0.011	0.359	0.337	0.067	0.475
Valeric acid	0.25	0.31	0.35	0.23	0.33	0.31	0.018	0.360	0.334	0.388	0.716
D 42
Acetic acid	22.90	20.86	23.27	22.07	22.11	26.27	0.747	0.426	0.381	0.352	0.199
Propionic acid	1.40	2.05	1.92	2.02	1.70	2.16	0.115	0.453	0.325	0.106	0.601
Isobutyric acid	0.36	0.35	0.47	0.50	0.52	0.41	0.034	0.638	0.740	0.492	0.265
Butyric acid	9.43^bc	9.86^b	13.01^a	6.69^c	10.68^ab	9.47^bc	0.479	0.003	0.001	0.613	0.550
Isovaleric acid	0.32	0.35	0.40	0.38	0.28	0.40	0.028	0.807	0.740	0.784	0.807
Valeric acid	0.37	0.39	0.44	0.38	0.34	0.40	0.013	0.373	0.267	0.862	0.557

Open in a new tab

SEM: standard error of the mean.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

Gene Expression in the Ileum

As exhibited in Table 11, on d 21, the expressions of immune regulatory related genes including TNF-α, IL-1β, IL-6, iNOS, COX-2, CATH-1, AvBD1 and AvBD12 along with barrier-related genes ZO-1 and Occludin decreased linearly with increasing levels of dietary EOA supplementation (P < 0.05). The gene expression of IL-10 and TGF- β4 showed linear and quadratic changes with the increase doses of dietary EOA supplementation (P < 0.05), while the gene expression of FABP-2 and Na⁺ dependent glucose and galactose transporter SGLT1 showed a quadratic changes with the increase doses of dietary EOA supplementation (P < 0.05). Compared with the control group, different levels of EOA addition downregulated (P < 0.05) IL-1β, COX-2 and TGF- β4 mRNA levels, but the 800 mg/kg EOA group (P < 0.05) decreased the gene expression of TNF-α, IL-6, ZO-1, FABP-2, AvBD1 and AvBD12; the 600 mg/kg EOA group (P < 0.05) remarkably decreased TNF-α, IL-6, IL-10, ZO-1, AvBD1 and AvBD12;mRNA levels, the 400 mg/kg EOA group (P < 0.05) reduced TNF-α and AvBD12 gene expression, but upregulated SGLT1 and FABP-2 mRNA levels in the ileum (P < 0.05).

Table 11.

Effects of dietary microencapsulated essential oils and organic acids preparation (EOA) supplementation on immune-related and barrier-related genes expression in the ileum of broilers (n = 8).

Items	Groups						SEM	P-values
Items	T1	T2	T3	T4	T5	T6	SEM	P₁	P₂	P_L	P_Q
D 21
TNF-α	1.00^a	1.01^a	0.89^ab	0.83^bc	0.72^c	0.78^bc	0.026	<0.001	0.009	0.001	0.457
IL-1β	0.72^a	0.61^ab	0.39^bc	0.43^bc	0.33^c	0.29^c	0.041	0.007	0.006	<0.001	0.226
IL-6	0.78^a	0.75^a	0.54^ab	0.72^a	0.37^b	0.32^b	0.054	0.026	0.002	0.001	0.473
iNOS	1.00^a	0.71^ab	0.53^ab	1.08^a	0.54^ab	0.33^b	0.082	0.045	0.030	0.029	0.451
COX-2	1.00^a	0.47^b	0.50^b	0.51^b	0.30^b	0.42^b	0.068	0.049	0.042	0.006	0.177
IL-10	1.00^a	0.76^ab	0.59^ab	0.64^ab	0.45^b	0.55^ab	0.044	0.002	0.001	<0.001	0.045
TGF-β4	1.00^a	0.67^b	0.48^bcd	0.59^bc	0.35^d	0.42^cd	0.044	<0.001	<0.001	<0.001	<0.001
Lysozyme c	1.00^b	1.78^a	0.58^b	0.90^b	0.43^b	0.78^b	0.117	0.009	0.339	0.305	0.386
Claudin-1	1.00	1.25	0.65	0.61	0.54	0.37	0.098	0.092	0.001	<0.001	0.629
ZO-1	1.00^a	0.86^ab	0.73^abc	0.84^abc	0.50^c	0.60^bc	0.050	0.034	0.005	0.001	0.693
Occludin	1.00^abc	1.10^a	0.98^abc	1.04^ab	0.70^c	0.74^bc	0.046	0.035	0.035	0.016	0.197
FABP-2	1.00	1.57	1.37	1.59	0.96	0.58	0.117	0.070	0.085	0.252	0.015
Mucin-2	1.00	1.14	0.92	0.89	0.74	0.85	0.040	0.061	0.414	0.113	0.716
CATH1	0.51	0.46	0.32	0.35	0.25	0.32	0.033	0.214	0.173	0.043	0.248
CATH3	1.00	1.02	1.14	0.92	0.65	0.64	0.082	0.380	0.257	0.070	0.319
AvBD1	1.00^a	0.43^bc	0.88^ab	1.03^a	0.32^c	0.50^bc	0.075	0.005	0.017	0.009	0.347
AvBD2	1.00	0.65	0.74	1.34	0.73	0.68	0.109	0.431	0.479	0.513	0.544
AvBD4	1.00	1.07	0.97	0.49	0.84	0.50	0.086	0.178	0.149	0.062	0.940
AvBD9	1.00	0.35	0.59	1.20	0.40	0.23	0.123	0.128	0.170	0.094	0.407
AvBD10	1.00^abc	1.83^a	0.96^abc	1.57^ab	0.47^c	0.87^bc	0.134	0.028	0.135	0.487	0.380
AvBD12	1.00^a	0.30^b	0.62^ab	0.53^b	0.29^b	0.38^b	0.066	0.007	0.019	0.001	0.370
SGLT1	1.00^b	2.02^a	1.67^ab	2.08^a	1.44^ab	1.29^ab	0.114	0.029	0.020	0.315	0.003
d 42
TNF-α	1.00	1.57	1.40	1.28	1.28	1.00	0.077	0.220	0.035	0.869	0.002
IL-1β	1.00^b	2.87^a	3.79^a	0.80^b	1.23^b	0.61^b	0.262	<0.001	<0.001	0.019	<0.001
IL-6	1.00^b	3.34^a	4.07^a	1.09^b	1.70^b	0.86^b	0.246	<0.001	<0.001	0.093	<0.001
iNOS	1.00^b	3.19^a	3.25^a	0.81^b	0.79^b	0.72^b	0.239	<0.001	<0.001	0.000	<0.001
COX-2	1.00^b	5.49^a	5.76^a	1.11^b	1.37^b	0.82^b	0.459	<0.001	<0.001	0.007	<0.001
IL-10	1.00^c	2.18^b	3.40^a	1.25^bc	0.83^c	0.47^c	0.209	<0.001	<0.001	0.005	<0.001
TGF-β4	1.00^bc	1.40^b	2.15^a	0.70^c	0.64^c	0.70^c	0.107	<0.001	<0.001	<0.001	<0.001
Lysozyme c	1.00	0.73	0.80	0.95	0.68	0.61	0.073	0.628	0.327	0.071	0.671
Claudin-1	1.00^bc	1.67^ab	1.77^a	0.84^c	0.79^c	0.32^c	0.127	0.002	0.001	0.005	0.004
ZO-1	1.00^b	4.12^a	4.64^a	1.30^b	0.97^b	0.83^b	0.326	<0.001	<0.001	0.010	<0.001
Occludin	1.00^ab	1.15^a	0.96^ab	0.54^bc	0.57^bc	0.36^c	0.074	0.003	<0.001	<0.001	0.424
FABP-2	1.00	2.35	1.71	1.90	2.07	1.15	0.154	0.068	0.069	0.301	0.013
Mucin-2	1.00	1.14	0.81	0.53	0.52	0.56	0.077	0.070	0.003	<0.001	0.217
CATH1	1.00^c	4.83^a	3.48^ab	1.60^bc	0.86^c	0.96^c	0.388	0.003	0.007	0.299	<0.001
CATH3	0.81^b	4.73^a	5.10^a	0.95^b	1.76^b	1.08^b	0.408	<0.001	<0.001	0.213	<0.001
AVBD1	1.00^b	5.16^a	4.63^a	1.11^b	1.63^b	0.77^b	0.409	<0.001	<0.001	0.033	<0.001
AVBD2	1.00^b	4.31^a	2.13^a	0.96^b	1.93^a	0.96^b	0.304	0.003	0.027	0.925	0.057
AVBD4	1.00^ab	0.69^abc	1.11^a	0.38^c	0.46^bc	0.28^c	0.089	0.018	0.011	0.002	0.575
AVBD9	1.00^c	4.86^a	4.28^ab	1.40^c	3.27^ab	1.77^bc	0.403	0.010	0.019	0.508	0.040
AVBD10	1.00^ab	1.88^a	1.29^ab	0.84^ab	1.76^a	0.32^b	0.157	0.025	0.017	0.439	0.068
AVBD12	1.00^b	3.46^a	5.06^a	1.37^b	1.29^b	0.80^b	0.363	<0.001	<0.001	0.061	<0.001
SGLT1	1.00	1.59	0.95	1.20	1.00	1.03	0.101	0.465	0.812	0.817	0.733

Open in a new tab

SEM: standard error of the mean.

Abbreviations: AVBD, avian beta-defensin; CATH, cathelicidin; COX-2, cyclooxygenase 2; FABP-2, fatty acid binding protein 2; IL, interleukin; iNOS, inducible nitric oxide synthase; SGLT1, sodium-glucose cotransporter 1; TGF-β4, transforming growth factor β4; TNF-α, tumor necrosis factor α; ZO-1, zonula occludens protein 1.

^a,b,c,d

Means in the same row without common superscripts differ significantly (P < 0.05).

At the same time, the BMD groups showed the same changed tendency for TJ (occluding and ZO-1), SGLT1, and immune-related genes (IL-1β, IL-6, iNOS, COX-2, TGF- β4, and AvBD-10) as the lower dose (200 and 400 mg/kg) of EOA-treated groups.

At d 42, the expressions of immune regulatory related genes including IL-1β, iNOS, COX-2, IL-10, TGF-β4 and AvBD1 along with barrier-related genes Claudin-1 and ZO-1 showed linear and quadratic changes with dietary increasing levels of EOA supplementation (P < 0.05). The gene expression of TNF-α, IL-6, FABP-2, CATH1, CATH3, AvBD9 and AvBD12 showed a quadratic change with the increase of dietary EOA supplementation (P < 0.05), while the gene expression of Occludin, Mucin-2, and AvBD4 decreased linearly with the increase of dietary EOA supplementation (P < 0.05). Compared with the control group, the gene expression of IL-1β,IL-6,iNOS,COX-2,IL-10,TGF-β4, CATH1, CATH3, AvBD1, AvBD9, AvBD12 and Claudin-1 and ZO-1 increased in the ileum of the 200 mg/kg EOA group, while the gene expression of AvBD4 decreased in the 400 mg/kg EOA groups, and the 800 mg/kg EOA group decreased AvBD4 and Occludin mRNA levels in the ileum. Additionally, BMD treatment sharply upregulated the expressions of immune-related genes (IL-1β, IL-6, IL-10, iNOS, and COX-2) and intestinal antimicrobial peptides (CATH-1, -2; AvBD-1,-2, -9, -10 and -12) genes in the ileum as compared to the control group during the later stage, but similar to the 200 mg/kg EOA-treated group.

DISCUSSION

This study was conducted to assess the effects of a microencapsulated essential oils and organic acids preparation addition on growth and slaughter performance, nutrient digestibility and intestinal microenvironment of broilers reared under nonchallenged conditions. Our data showed that dietary 200 mg/kg EOA addition increased ABW and ADG, which was similar to the BMD-treated group during the starter period, but no significant differences for growth performance was observed among the different levels of EOA-supplemented groups and the BMD-treated group during the later and the whole stage. In similar to our findings, several previous studies have reported that the addition of coated essential oils and organic acids mixtures could increase ADG or improve FCR in broiler chickens reared under either nonchallenged (Basmacioğlu-Malayoğlu et al., 2016; Fascina et al., 2017; Yang et al., 2018) or challenged conditions (Stefanello et al., 2019; Abdelli et al., 2020; Pham et al., 2020; Pham et al., 2022; Pham et al., 2023). However, other studies have reported that the dietary supplementation with coated essential oils and organic acids had no significant or even had negative effects on growth performance (Yang et al., 2019; Adewole et al., 2021; Greene et al., 2022). Inconsistent results in growth performance in broiler chickens supplemented with EOA might be related with EOA product formula composition, the physical and chemical properties of EOs or OAs in EOA products, dietary EOA addition level, whether the EOA is coated or not; the age or health status (challenged or not) of experimental broilers; the composition of the experimental diet; and the hygienic conditions of the rearing environment, and etc. (Zeng et al., 2020).

The improvement of production performance was reported to be positively correlated with intestinal morphology development, digestive enzymes activity and nutrient digestibility in chickens (Miles et al., 2006; Duan et al., 2018). In the present study, EOA supplementation improved ileum morphological structure, as evidenced by increasing VH/CD at the early stage and decreased CD at the different stages. Similarly, previous many studies have confirmed that essential oils and organic acids alone or in combination can improve intestinal morphological structure in chickens (Basmacioğlu-Malayoğlu et al., 2016; Liu et al., 2017; Pham et al., 2020; Adewole et al., 2021). Meanwhile, our data also showed that dietary supplementation with EOA linearly increased lipase activity in the duodenum whereas linearly reduced amylase activity in the jejunum and lipase activity in the ileum of 21-day-old broilers with the increasing levels of dietary EOA supplementation. Additionally, on d 42, trypsin activity in the duodenum and amylase activity in the jejunum linearly increase while chymotrypsin activity in the duodenum and lipase activity in the ileum linearly reduced with the increasing levels of dietary EOA supplementation. These observations showed that EOA could differentially affect the secretion and activities of digestive enzymes in different intestinal segments. Nevertheless, a previous study reported that essential oils and organic acids blend could increase the activities of intestinal amylase or protease in broilers (Liu et al., 2017). The discrepancy might be related to the differences in EOA composition and additional level, releasing ability in different intestine segments of coated EOA, sampling time-point, or physiological functions of different gut segments. Surprisingly, our data also found that dietary addition of either EOA or BMD addition had no significant effects on apparent nutrient digestibility at d 42, which was different from the others studies, who reported that some EOA products had positive influences on the apparent ileal digestibility of dry matter and/or crude proteins at d 42 (Cross et al., 2007; Basmacioğlu-Malayoğlu et al., 2016; Iqbal et al., 2019; Stefanello et al., 2019). The reason why the EOA or BMD addition didn't affect nutrient digestibility in broiler chickens needed further investigation. Taken together, our data suggested that the improvement of body weight gain in the 200 mg/kg EOA-treated broilers may be attributed to the improvement of ileum morphology and increase in intestinal lipase activity in the early growth period. It was concluded that the EOA product could replace in-feed antibiotics BMD to improve the growth performance of broilers in the starter phase.

Slaughter performance is an important index to evaluate meat yield of livestock and poultry, which affects the economic benefits of the broiler industry. In this study, the 400 mg/kg EOA group showed greater eviscerated rate than other EOA groups, but was similar to BMD treatment, indicating that reasonable level of EOA addition could improve slaughter performance. Similarly, some studies reported that dietary organic acids blend addition increased breast and leg muscle percentage and lowered visceral fat accumulation in broilers (Basmacioğlu-Malayoğlu et al., 2016; Zhu et al., 2022); and drinking water supplemented with 400 mg/L oregano essential oil reduced slaughter weight but increased thigh yield (Hernández-Coronado et al., 2019). Inconsistently, some studies have reported that the dietary supplementation with essential oils and organic acids had no significant effects on slaughter performance in chickens (Mikulski et al., 2008; Adewole et al., 2021). The inconsistent results in slaughter performance in chickens supplemented with EOA might be related to EOA composition and additional level.

Intestinal microbial composition and microbiota-derived SCFA profiles affects feed digestion, absorption and utilization, and physiology, growth, immune and health of chickens (Diaz Carrasco et al., 2019). In the current study, EOA addition linearly increased lactic acid bacteria counts, butyric acid (d 21 and d 42) and isobutyric acid (d 21) concentration in the cecum with the increasing level of dietary EOA supplementation. Moreover, the 400 mg/kg EOA addition had greater lactic acid bacteria abundance, the 200 mg/kg EOA group showed higher butyric acid (d 21 and d 42) concentration, and greater isobutyric acid concentration was found in the 600 mg/kg and 800 mg/kg EOA groups at d 21 compared with the control, suggesting that low dose of EOA could improve intestinal microbial composition and shift cecal fermentation to predominantly carbohydrate fermentation, where higher levels of EOA was prone to cecal protein fermentation. In line with our results, several studies have reported that dietary EOA supplementation either promote the growth of beneficial bacteria such as lactic acid bacteria and inhibited potential harmful bacteria proliferation (Liu et al., 2017; Pham et al., 2023), or increased SCFA production in the cecum (Hu et al., 2023), or both (Yang et al., 2019) in chickens. Lactic acid bacteria was shown to positively be involved in intestinal development and maturity, immuno-regulation and intestinal health (Teng and Kim, 2018). Intestinal microbial-derived metabolites butyric acid play an important role in inhibiting the growth of harmful bacteria, anti-inflammatory, anti-infective, barrier-protecting, and providing energy for intestinal epithelial cells (Sorbara and Pamer, 2022). Thus, we suggested that increased lactic acid bacteria abundance and butyric acids levels in the cecum induced by EOA addition was possibly contributed to improvement in intestinal morphology, growth performance and intestinal microenvironment.

Intestinal epithelial tight junction (TJ) proteins (Claudin-1, ZO-1, Occludin) play an important roles in regulating the absorption and nutrients, intestinal permeability and integrity, resistance to pathogen invasion and maintaining body health (Awad et al., 2017; Wang et al., 2020). FABP-2 is a biomarker of impaired intestinal barrier epithelial cell integrity, and the decrease in FABP-2 expression indicates the occurrence of intestinal barrier function damage (Chen et al., 2015). The activation of Na+/glucose cotransport-1 (SGLT1) meant an increased nutrients absorption in the gut (Turner et al., 1997). Mucin-2 plays important role in lubrication and protection of intestinal mucosal epithelium and intestinal health (Gill et al., 2011), intestinal beneficial bacteria could stimulate and increase mucin-2 secretion whereas intestinal harmful bacteria decomposes mucin layer resulting in increased intestinal permeability and barrier injury (Gill et al., 2011; Broom, 2018). In the current study, ZO-1 and Occludin mRNA levels in the early stages, and Occludin and Mucin-2 mRNA levels in the ileum in the later stages decreased linearly with the increase of dietary EOA supplementation. SGLT1, FABP-2 and TJ (Claudin-1 and ZO-1) mRNA levels in the ileum increased in the 200 mg/kg and/or 400 mg/kg EOA groups, while SGLT1, FABP-2, Mucin-2 as well as TJ (Claudin-1. Occluding or ZO-1) mRNA levels reduced in the 600 mg/kg and/or 800 mg/kg EOA groups. Thus, our results indicated that suitable dose of EOA addition could help to establish a healthy intestinal microenvironment, which was similar to previous studies (Yang et al., 2019; Pham et al., 2020; Pham et al., 2022), while high levels of EOA inclusion into diets might cause gut injury. Increased body weight gain obtained in the lower and middle dose of EOA-treated groups in the early growth stage of broilers possibly attributed to improved intestinal barrier functions and increased sugar absorption and utilization in the gut.

Cytokines play an important role in the regulation of immune homeostasis. The proper expression of proinflammatory cytokines meant the activation of immune system, which helps the body to resist the invasion of external pathogenic microorganisms, whereas the overexpression of pro-inflammatory factors will lead to inflammatory reaction, growth depression and/or tissue injury (Smith and Humphries, 2009). Anti-inflammatory factors participate in immune tolerance and antibody synthesis, but excessive expression of anti-inflammatory factors will compromise immune functions and increase disease susceptibility (O'Garra and Vieira, 2007). In this study, the expressions of pro-inflammatory factors (TNF-α, IL-1β, IL-6, iNOS, and COX-2) and anti-inflammatory cytokines (IL-10 and TGF-β4) decreased linearly at the early and later stage with increasing levels of dietary EOA supplementation, which was similar to the changed trend of TJ protein expression. A similar result was reported by previous researcher (Bortoluzzi et al., 2021). Combined with increased body weight gain and butyric acids content obtained in all levels of EOA-treated group chickens, we suggested that EOA supplementation downregulated intestinal mucosal immune function under nonchallenged conditions but without disrupting immune homeostasis, resulting in decreasing nutrition consumption for immune responses, thereby contributing to increased body weight. However, with prolonged use of EOA, chickens received diets with 200 mg/kg EOA displayed upregulated immune-related genes (IL-1β, IL-6, iNOS, COX-2, IL-10, and TGF-β4) and antimicrobial peptides (CATH1, CATH3, AvBD1, AvBD9, and AvBD12) mRNA levels in the ileum. Endogenous antimicrobial peptides displayed multiple biological functions such as antibacterial, immune regulation, and intestinal barrier protection (Fusco et al., 2021). Intestinal mucosal immune responses induced by the EOA product in this study indicated that continuous lower doses of EOA treatment could enhance innate immune function, which was possibly associated with increased butyric acids levels and improved microbial composition in the gut (Liu et al., 2017; Yang et al., 2019). Similarly, several previous studies have reported that suitable dose of coated EOA addition could activate immune responses and improve intestinal microenvironment by modulating intestinal cytokines expression and increasing intestinal beneficial microbiota abundance (Wang et al., 2019; Ma et al., 2022). Decreased immune responses induced by higher concentrations of the EOA supplementation was possible due to inhibit the growth of intestinal microbiota including potentially beneficial and harmful bacteria (Abdelli et al., 2021; Greene et al., 2022). Taken together, our results suggested that dietary supplementation with the EOA could be used as antibiotics alternatives to improve growth performance of broiler chickens.

CONCLUSIONS

Supplemental appropriate dose of the EOA could improve the growth performance and intestinal microenvironment through improving intestinal morphology, increasing digestive enzymes activity and cecal lactic acid bacteria abundance and butyric acid content, improving intestinal barrier function as well as maintaining intestinal immune homeostasis. The improving effect induced by suitable level of EOA addition in the early growth stage was better than that in the later growth stage. However, continuous high-dose EOA dietary addition might have adverse effects on intestinal microenvironment, but had no harmful effect on production performance in broilers. Taken together, it is concluded that adding 200 and 400 mg/kg of the EOA to the diet showed better effects on growth, intestinal microenvironment and gut health. This study provides a new antibiotic substitute for improving intestinal microenvironment and health as well as production performance of broilers in the post-antibiotic era.

ACKNOWLEDGMENTS

The authors acknowledge Menon Animal Nutrition Technology Co. Ltd., Shanghai, China provided EOA product for this experiment. We'd like to thank the Zhuozhou Poultry Experimental Base with limited liability for animal management.

Author Contribution: ZW conceived and designed the experiment; JH, FSG, ZQH, JNQ, RCB, TTX and AW carried out the research; JH analyzed the data and wrote the manuscript; ZW, FSG and AW participate in the draft editing process manuscript. All authors read and approved the final manuscript.

DISCLOSURES

The authors declare that there are no conflicts of interest.

REFERENCES

Abd El-Hack M.E., El-Saadony M.T., Saad A.M., Salem H.M., Ashry N.M., Abo Ghanima M.M., Shukry M., Swelum A.A., Taha A.E., El-Tahan A.M., AbuQamar S.F., El-Tarabily K.A. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: a comprehensive review. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101584. [DOI] [PMC free article] [PubMed] [Google Scholar]
Abdelli N., Pérez J.F., Vilarrasa E., Cabeza Luna I., Melo-Duran D., D'Angelo M., Solà-Oriol D. Targeted-release organic acids and essential oils improve performance and digestive function in broilers under a necrotic enteritis challenge. Animals. (Basel) 2020;10:259. doi: 10.3390/ani10020259. [DOI] [PMC free article] [PubMed] [Google Scholar]
Abdelli N., Solà-Oriol D., Pérez J.F. Phytogenic feed additives in poultry: achievements, prospective and challenges. Animals. (Basel) 2021;11:3471. doi: 10.3390/ani11123471. [DOI] [PMC free article] [PubMed] [Google Scholar]
Adewole D.I., Oladokun S., Santin E. Effect of organic acids-essential oils blend and oat fiber combination on broiler chicken growth performance, blood parameters, and intestinal health. Anim. Nutr. 2021;7:1039–1051. doi: 10.1016/j.aninu.2021.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ait-Ouazzou A., Cherrat L., Espina L., Lorán S., Rota C., Pagán R. The antimicrobial activity of hydrophobic essential oil constituents acting alone or in combined processes of food preservation. Innov. Food Sci. Emerg. Technol. 2011;12:320–329. [Google Scholar]
AOAC International . 18th ed. AOAC Int; 2005. Official Methods of Analysis. [Google Scholar]
Awad W.A., Hess C., Hess M. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins. (Basel) 2017;9:60. doi: 10.3390/toxins9020060. [DOI] [PMC free article] [PubMed] [Google Scholar]
Basmacioğlu-Malayoğlu H., Ozdemir P., Bağriyanik H.A. Influence of an organic acid blend and essential oil blend, individually or in combination, on growth performance, carcass parameters, apparent digestibility, intestinal microflora and intestinal morphology of broilers. Br. Poult. Sci. 2016;57:227–234. doi: 10.1080/00071668.2016.1141171. [DOI] [PubMed] [Google Scholar]
Bortoluzzi C., Lahaye L., Oxford J., Detzler D., Eyng C., Barbieri N.L., Santin E., Kogut M.H. Protected organic acid and essential oils for broilers raised under field conditions: intestinal health biomarkers and cecal microbiota. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.722339. [DOI] [PMC free article] [PubMed] [Google Scholar]
Broom L.J. Gut barrier function: effects of (antibiotic) growth promoters on key barrier components and associations with growth performance. Poult. Sci. 2018;97:1572–1578. doi: 10.3382/ps/pey021. [DOI] [PubMed] [Google Scholar]
Chen J., Tellez G., Richards J.D., Escobar J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front. Vet. Sci. 2015;2:14. doi: 10.3389/fvets.2015.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cross D.E., McDevitt R.M., Hillman K., Acamovic T. The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. Br. Poult. Sci. 2007;48:496–506. doi: 10.1080/00071660701463221. [DOI] [PubMed] [Google Scholar]
Diaz Carrasco J.M., Casanova N.A., Fernández Miyakawa M.E. Microbiota, gut health and chicken productivity: What is the connection? Microorganisms. 2019;7:374. doi: 10.3390/microorganisms7100374. [DOI] [PMC free article] [PubMed] [Google Scholar]
Duan Y., Wang Y., Dong H., Ding X., Liu Q., Li H., Zhang J., Xiong D. Changes in the intestine microbial, digestive, and immune-related genes of litopenaeus vannamei in response to dietary probiotic clostridium butyricum supplementation. Front. Microbiol. 2018;9:2191. doi: 10.3389/fmicb.2018.02191. [DOI] [PMC free article] [PubMed] [Google Scholar]
Elbaz A.M., Ashmawy E.S., Salama A.A., Abdel-Moneim A.E., Badri F.B., Thabet H.A. Effects of garlic and lemon essential oils on performance, digestibility, plasma metabolite, and intestinal health in broilers under environmental heat stress. BMC. Vet. Res. 2022;18:430. doi: 10.1186/s12917-022-03530-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
Fascina V.B., Pasquali G., Carvalho F., Muro E., Vercese F., Aoyagi M., Pezzato A., Gonzales E., Sartori J. Effects of phytogenic additives and organic acids, alone or in combination, on the performance, intestinal quality and immune responses of broiler chickens. Braz. J. Poult. Sci. 2017;19:497–508. [Google Scholar]
Fusco A., Savio V., Donniacuo M., Perfetto B., Donnarumma G. Antimicrobial peptides human beta-defensin-2 and -3 protect the gut during candida albicans infections enhancing the intestinal barrier integrity: In vitro study. Front. Cell Infect. Microbiol. 2021;11 doi: 10.3389/fcimb.2021.666900. [DOI] [PMC free article] [PubMed] [Google Scholar]
Gill N., Wlodarska M., Finlay B.B. Roadblocks in the gut: barriers to enteric infection. Cell Microbiol. 2011;13:660–669. doi: 10.1111/j.1462-5822.2011.01578.x. [DOI] [PubMed] [Google Scholar]
Gómez-García M., Argüello H., Puente H., Mencía-Ares Ó., González S., Miranda R., Rubio P., Carvajal A. In-depth in vitro evaluation of the activity and mechanisms of action of organic acids and essential oils against swine enteropathogenic bacteria. Front. Vet. Sci. 2020;7 doi: 10.3389/fvets.2020.572947. [DOI] [PMC free article] [PubMed] [Google Scholar]
Greene G., Koolman L., Whyte P., Lynch H., Coffey A., Lucey B., Egan J., O'Connor L., Bolton D. The efficacy of organic acid, medium chain fatty acid and essential oil-based broiler treatments; in vitro anti-campylobacter jejuni activity and the effect of these chemical-based treatments on broiler performance. J. Appl. Microbiol. 2022;132:687–695. doi: 10.1111/jam.15204. [DOI] [PubMed] [Google Scholar]
Hernández-Coronado A.C., Silva-Vázquez R., Rangel-Nava Z.E., Hernández-Martínez C.A., Kawas-Garza J.R., Hume M.E., Méndez-Zamora G. Mexican oregano essential oils given in drinking water on performance, carcass traits, and meat quality of broilers. Poult. Sci. 2019;98:3050–3058. doi: 10.3382/ps/pez094. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hu Z., Liu L., Guo F., Huang J., Qiao J., Bi R., Huang J., Zhang K., Guo Y., Wang Z. Dietary supplemental coated essential oils and organic acids mixture improves growth performance and gut health along with reduces salmonella load of broiler chickens infected with salmonella enteritidis. J. Anim. Sci. Biotechnol. 2023;14:95. doi: 10.1186/s40104-023-00889-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Huang X., Lao Y., Pan Y., Chen Y., Zhao H., Gong L., Xie N., Mo C.H. Synergistic antimicrobial effectiveness of plant essential oil and its application in seafood preservation: a review. Molecules. 2021;26:307. doi: 10.3390/molecules26020307. [DOI] [PMC free article] [PubMed] [Google Scholar]
Iqbal Z., Metzger F., Singh M., Morgan N., Swick R.A., Perez-Maldonado R.A., M'Sadeq S.A., Zentek J., Ruhnke I. Enzymes and/or combination of organic acid and essential oils supplementation in pasture-fed free-range laying hens increased the digestibility of nutrients and non-starch polysaccharides. Poult. Sci. 2019;98:1410–1424. doi: 10.3382/ps/pey479. [DOI] [PubMed] [Google Scholar]
Kaldhusdal M., Benestad S.L., Lovland A. Epidemiologic aspects of necrotic enteritis in broiler chickens - disease occurrence and production performance. Avian Pathol. 2016;45:271–274. doi: 10.1080/03079457.2016.1163521. [DOI] [PubMed] [Google Scholar]
Kalia V.C., Shim W.Y., Patel S.K.S., Gong C., Lee J.K. Recent developments in antimicrobial growth promoters in chicken health: Opportunities and challenges. Sci. Total. Environ. 2022;834 doi: 10.1016/j.scitotenv.2022.155300. [DOI] [PubMed] [Google Scholar]
Liu Y., Yang X., Xin H., Chen S., Yang C., Duan Y., Yang X. Effects of a protected inclusion of organic acids and essential oils as antibiotic growth promoter alternative on growth performance, intestinal morphology and gut microflora in broilers. Anim. Sci. J. 2017;88:1414–1424. doi: 10.1111/asj.12782. [DOI] [PubMed] [Google Scholar]
Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
Ma J., Long S., Wang J., Gao J., Piao X. Microencapsulated essential oils combined with organic acids improves immune antioxidant capacity and intestinal barrier function as well as modulates the hindgut microbial community in piglets. J. Anim. Sci. Biotechnol. 2022;13:16. doi: 10.1186/s40104-021-00670-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
Manvatkar P.N., Kulkarni R.C., Awandkar S.P., Chavhan S.G., Durge S.M., Avhad S.R., Channa G.R., Kulkarni M.B. Performance of broiler chicken on dietary supplementation of protected organic acids blend. Br. Poult. Sci. 2022;63:633–640. doi: 10.1080/00071668.2022.2076211. [DOI] [PubMed] [Google Scholar]
Mehdi Y., Létourneau-Montminy M.P., Gaucher M.L., Chorfi Y., Suresh G., Rouissi T., Brar S.K., Côté C., Ramirez A.A., Godbout S. Use of antibiotics in broiler production: global impacts and alternatives. Anim. Nutr. 2018;4:170–178. doi: 10.1016/j.aninu.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mikulski D., Zdunczyk Z., Jankowski J., Juskiewicz J. Effects of organic acids or natural plant extracts added to diets for turkeys on growth performance, gastrointestinal tract metabolism and carcass characteristics. J. Anim. Feed Sci. 2008;17:233. [Google Scholar]
Miles R.D., Butcher G.D., Henry P.R., Littell R.C. Effect of antibiotic growth promoters on broiler performance, intestinal growth parameters, and quantitative morphology. Poult. Sci. 2006;85:476–485. doi: 10.1093/ps/85.3.476. [DOI] [PubMed] [Google Scholar]
Moharreri M., Vakili R., Oskoueian E., Rajabzadeh G. Evaluation of microencapsulated essential oils in broilers challenged with salmonella enteritidis: a focus on the body's antioxidant status, gut microbiology, and morphology. Arch. Razi. Inst. 2022;77:629–639. doi: 10.22092/ARI.2021.354334.1634. [DOI] [PMC free article] [PubMed] [Google Scholar]
Mohebodini H., Jazi V., Ashayerizadeh A., Toghyani M., Tellez-Isaias G. Productive parameters, cecal microflora, nutrient digestibility, antioxidant status, and thigh muscle fatty acid profile in broiler chickens fed with eucalyptus globulus essential oil. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
Myers W.D., Ludden P.A., Nayigihugu V., Hess B.W. Technical note: a procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 2004;82:179–183. doi: 10.2527/2004.821179x. [DOI] [PubMed] [Google Scholar]
Nguyen D.H., Lee K.Y., Mohammadigheisar M., Kim I.H. Evaluation of the blend of organic acids and medium-chain fatty acids in matrix coating as antibiotic growth promoter alternative on growth performance, nutrient digestibility, blood profiles, excreta microflora, and carcass quality in broilers. Poult. Sci. 2018;97:4351–4358. doi: 10.3382/ps/pey339. [DOI] [PubMed] [Google Scholar]
Noruzi S., Torki M., Mohammadi H. Effects of supplementing diet with thyme (Thymus vulgaris L.) essential oil and/or selenium yeast on production performance and blood variables of broiler chickens. Vet. Med. Sci. 2022;8:1137–1145. doi: 10.1002/vms3.736. [DOI] [PMC free article] [PubMed] [Google Scholar]
O'Garra A., Vieira P. T(h)1 cells control themselves by producing interleukin-10. Nat. Rev. Immunol. 2007;7:425–428. doi: 10.1038/nri2097. [DOI] [PubMed] [Google Scholar]
Pham V.H., Abbas W., Huang J., Guo F., Zhang K., Kong L., Zhen W., Guo Y., Wang Z. Dietary coated essential oil and organic acid mixture supplementation improves health of broilers infected with avian pathogenic Escherichia coli. Anim. Nutr. 2023;12:245–262. doi: 10.1016/j.aninu.2022.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pham V.H., Abbas W., Huang J., He Q., Zhen W., Guo Y., Wang Z. Effect of blending encapsulated essential oils and organic acids as an antibiotic growth promoter alternative on growth performance and intestinal health in broilers with necrotic enteritis. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101563. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pham V.H., Kan L., Huang J., Geng Y., Zhen W., Guo Y., Abbas W., Wang Z. Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis. J. Anim. Sci. Biotechnol. 2020;11:18. doi: 10.1186/s40104-019-0421-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
Remmal A., Achahbar S., Bouddine L., Chami N., Chami F. In vitro destruction of Eimeria oocysts by essential oils. Vet. Parasitol. 2011;182:121–126. doi: 10.1016/j.vetpar.2011.06.002. [DOI] [PubMed] [Google Scholar]
Saleem K., Saima A.R., Pasha T.N., Mahmud A., Hayat Z. Effects of dietary organic acids on performance, cecal microbiota, and gut morphology in broilers. Trop. Anim. Health Prod. 2020;52:3589–3596. doi: 10.1007/s11250-020-02396-2. [DOI] [PubMed] [Google Scholar]
Salim H.M., Huque K.S., Kamaruddin K.M., Beg M. Global restriction of using antibiotic growth promoters and alternative strategies in poultry production. Sci. Prog. 2018;101:52–75. doi: 10.3184/003685018X15173975498947. [DOI] [PMC free article] [PubMed] [Google Scholar]
Scicutella F., Mannelli F., Daghio M., Viti C., Buccioni A. Polyphenols and organic acids as alternatives to antimicrobials in poultry rearing: a review. Antibiotics. (Basel) 2021;10:1010. doi: 10.3390/antibiotics10081010. [DOI] [PMC free article] [PubMed] [Google Scholar]
Smith A.J., Humphries S.E. Cytokine and cytokine receptor gene polymorphisms and their functionality. Cytokine Growth Factor Rev. 2009;20:43–59. doi: 10.1016/j.cytogfr.2008.11.006. [DOI] [PubMed] [Google Scholar]
Sobotik E.B., Ramirez S., Roth N., Tacconi A., Pender C., Murugesan R., Archer G.S. Evaluating the effects of a dietary synbiotic or synbiotic plus enhanced organic acid on broiler performance and cecal and carcass salmonella load. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101508. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sorbara M.T., Pamer E.G. Microbiome-based therapeutics. Nat. Rev. Microbiol. 2022;20:365–380. doi: 10.1038/s41579-021-00667-9. [DOI] [PubMed] [Google Scholar]
Stefanello C., Rosa D.P., Dalmoro Y.K., Segatto A.L., Vieira M.S., Moraes M.L., Santin E. Protected blend of organic acids and essential oils improves growth performance, nutrient digestibility, and intestinal health of broiler chickens undergoing an intestinal challenge. Front. Vet. Sci. 2019;6:491. doi: 10.3389/fvets.2019.00491. [DOI] [PMC free article] [PubMed] [Google Scholar]
Sun Y., Ni A., Jiang Y., Li Y., Huang Z., Shi L., Xu H., Chen C., Li D., Han Y., Chen J. Effects of replacing in-feed antibiotics with synergistic organic acids on growth performance, health, carcass, and immune and oxidative statuses of broiler chickens under clostridium perfringens type a challenge. Avian Dis. 2020;64:393–400. doi: 10.1637/aviandiseases-D-19-00101. [DOI] [PubMed] [Google Scholar]
Teng P.Y., Kim W.K. Review: Roles of prebiotics in intestinal ecosystem of broilers. Front. Vet. Sci. 2018;5:245. doi: 10.3389/fvets.2018.00245. [DOI] [PMC free article] [PubMed] [Google Scholar]
Turner J.R., Rill B.K., Carlson S.L., Carnes D., Kerner R., Mrsny R.J., Madara J.L. Physiological regulation of epithelial tight junctions is associated with myosin light-chain phosphorylation. Am. J. Physiol. 1997;273:C1378–C1385. doi: 10.1152/ajpcell.1997.273.4.C1378. [DOI] [PubMed] [Google Scholar]
van Eerden E., Santos R.R., Molist F., Dardi M., Pantoja-Millas L.A., Molist-Badiola J., Baratelli M., Pages M. Efficacy of an attenuated vaccine against avian coccidiosis in combination with feed additives based on organic acids and essential oils on production performance and intestinal lesions in broilers experimentally challenged with necrotic enteritis. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101848. [DOI] [PMC free article] [PubMed] [Google Scholar]
Vande Maele L., Heyndrickx M., Maes D., De Pauw N., Mahu M., Verlinden M., Haesebrouck F., Martel A., Pasmans F., Boyen F. In vitro susceptibility of brachyspira hyodysenteriae to organic acids and essential oil components. J. Vet. Med. Sci. 2016;78:325–328. doi: 10.1292/jvms.15-0341. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang H., Liang S., Li X., Yang X., Long F., Yang X. Effects of encapsulated essential oils and organic acids on laying performance, egg quality, intestinal morphology, barrier function, and microflora count of hens during the early laying period. Poult. Sci. 2019;98:6751–6760. doi: 10.3382/ps/pez391. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang Y., Yang J., Wang W., Sanidad K.Z., Cinelli M.A., Wan D., Hwang S.H., Kim D., Lee K.S.S., Xiao H., Hammock B.D., Zhang G. Soluble epoxide hydrolase is an endogenous regulator of obesity-induced intestinal barrier dysfunction and bacterial translocation. Proc. Natl. Acad. Sci. U S A, 2020;117:8431–8436. doi: 10.1073/pnas.1916189117. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wannissorn B., Jarikasem S., Siriwangchai T., Thubthimthed S. Antibacterial properties of essential oils from Thai medicinal plants. Fitoterapia. 2005;76:233–236. doi: 10.1016/j.fitote.2004.12.009. [DOI] [PubMed] [Google Scholar]
Wu Y., Shao Y., Song B., Zhen W., Wang Z., Guo Y., Shahid M.S., Nie W. Effects of Bacillus coagulans supplementation on the growth performance and gut health of broiler chickens with clostridium perfringens-induced necrotic enteritis. J. Anim. Sci. Biotechnol. 2018;9:1–14. doi: 10.1186/s40104-017-0220-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Yang X., Liu Y., Yan F., Yang C., Yang X. Effects of encapsulated organic acids and essential oils on intestinal barrier, microbial count, and bacterial metabolites in broiler chickens. Poult. Sci. 2019;98:2858–2865. doi: 10.3382/ps/pez031. [DOI] [PubMed] [Google Scholar]
Yang X., Xin H., Yang C., Yang X. Impact of essential oils and organic acids on the growth performance, digestive functions and immunity of broiler chickens. Anim. Nutr. 2018;4:388–393. doi: 10.1016/j.aninu.2018.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
Yang Y., Wang Q., Diarra M.S., Yu H., Hua Y., Gong J. Functional assessment of encapsulated citral for controlling necrotic enteritis in broiler chickens. Poult. Sci. 2016;95:780–789. doi: 10.3382/ps/pev375. [DOI] [PubMed] [Google Scholar]
Youssef I.M.I., Männer K., Zentek J. Effect of essential oils or saponins alone or in combination on productive performance, intestinal morphology and digestive enzymes' activity of broiler chickens. J. Anim. Physiol. Anim. Nutr. (Berlin) 2021;105:99–107. doi: 10.1111/jpn.13431. [DOI] [PubMed] [Google Scholar]
Zeng Z., Zhang S., Wang H., Piao X. Correction to: essential oil and aromatic plants as feed additives in non-ruminant nutrition: a review. J. Anim. Sci. Biotechnol. 2020;11:50. doi: 10.1186/s40104-020-00467-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang L.Y., Peng Q.Y., Liu Y.R., Ma Q.G., Zhang J.Y., Guo Y.P., Xue Z., Zhao L.H. Effects of oregano essential oil as an antibiotic growth promoter alternative on growth performance, antioxidant status, and intestinal health of broilers. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101163. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang S., Shen Y.R., Wu S., Xiao Y.Q., He Q., Shi S.R. The dietary combination of essential oils and organic acids reduces Salmonella enteritidis in challenged chicks. Poult. Sci. 2019;98:6349–6355. doi: 10.3382/ps/pez457. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhu X., Zhang Y., Zhao Y., Tao L., Liu H., Dong W., Yang G., Li L. Effects of dietary supplementation with itaconic acid on the growth performance, nutrient digestibility, slaughter variables, blood biochemical parameters, and intestinal morphology of broiler chickens. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101732. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0001] Abd El-Hack M.E., El-Saadony M.T., Saad A.M., Salem H.M., Ashry N.M., Abo Ghanima M.M., Shukry M., Swelum A.A., Taha A.E., El-Tahan A.M., AbuQamar S.F., El-Tarabily K.A. Essential oils and their nanoemulsions as green alternatives to antibiotics in poultry nutrition: a comprehensive review. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101584. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0002] Abdelli N., Pérez J.F., Vilarrasa E., Cabeza Luna I., Melo-Duran D., D'Angelo M., Solà-Oriol D. Targeted-release organic acids and essential oils improve performance and digestive function in broilers under a necrotic enteritis challenge. Animals. (Basel) 2020;10:259. doi: 10.3390/ani10020259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0003] Abdelli N., Solà-Oriol D., Pérez J.F. Phytogenic feed additives in poultry: achievements, prospective and challenges. Animals. (Basel) 2021;11:3471. doi: 10.3390/ani11123471. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0004] Adewole D.I., Oladokun S., Santin E. Effect of organic acids-essential oils blend and oat fiber combination on broiler chicken growth performance, blood parameters, and intestinal health. Anim. Nutr. 2021;7:1039–1051. doi: 10.1016/j.aninu.2021.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0005] Ait-Ouazzou A., Cherrat L., Espina L., Lorán S., Rota C., Pagán R. The antimicrobial activity of hydrophobic essential oil constituents acting alone or in combined processes of food preservation. Innov. Food Sci. Emerg. Technol. 2011;12:320–329. [Google Scholar]

[bib0006] AOAC International . 18th ed. AOAC Int; 2005. Official Methods of Analysis. [Google Scholar]

[bib0007] Awad W.A., Hess C., Hess M. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins. (Basel) 2017;9:60. doi: 10.3390/toxins9020060. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0008] Basmacioğlu-Malayoğlu H., Ozdemir P., Bağriyanik H.A. Influence of an organic acid blend and essential oil blend, individually or in combination, on growth performance, carcass parameters, apparent digestibility, intestinal microflora and intestinal morphology of broilers. Br. Poult. Sci. 2016;57:227–234. doi: 10.1080/00071668.2016.1141171. [DOI] [PubMed] [Google Scholar]

[bib0009] Bortoluzzi C., Lahaye L., Oxford J., Detzler D., Eyng C., Barbieri N.L., Santin E., Kogut M.H. Protected organic acid and essential oils for broilers raised under field conditions: intestinal health biomarkers and cecal microbiota. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.722339. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0010] Broom L.J. Gut barrier function: effects of (antibiotic) growth promoters on key barrier components and associations with growth performance. Poult. Sci. 2018;97:1572–1578. doi: 10.3382/ps/pey021. [DOI] [PubMed] [Google Scholar]

[bib0011] Chen J., Tellez G., Richards J.D., Escobar J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front. Vet. Sci. 2015;2:14. doi: 10.3389/fvets.2015.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0012] Cross D.E., McDevitt R.M., Hillman K., Acamovic T. The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. Br. Poult. Sci. 2007;48:496–506. doi: 10.1080/00071660701463221. [DOI] [PubMed] [Google Scholar]

[bib0013] Diaz Carrasco J.M., Casanova N.A., Fernández Miyakawa M.E. Microbiota, gut health and chicken productivity: What is the connection? Microorganisms. 2019;7:374. doi: 10.3390/microorganisms7100374. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0014] Duan Y., Wang Y., Dong H., Ding X., Liu Q., Li H., Zhang J., Xiong D. Changes in the intestine microbial, digestive, and immune-related genes of litopenaeus vannamei in response to dietary probiotic clostridium butyricum supplementation. Front. Microbiol. 2018;9:2191. doi: 10.3389/fmicb.2018.02191. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0015] Elbaz A.M., Ashmawy E.S., Salama A.A., Abdel-Moneim A.E., Badri F.B., Thabet H.A. Effects of garlic and lemon essential oils on performance, digestibility, plasma metabolite, and intestinal health in broilers under environmental heat stress. BMC. Vet. Res. 2022;18:430. doi: 10.1186/s12917-022-03530-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0016] Fascina V.B., Pasquali G., Carvalho F., Muro E., Vercese F., Aoyagi M., Pezzato A., Gonzales E., Sartori J. Effects of phytogenic additives and organic acids, alone or in combination, on the performance, intestinal quality and immune responses of broiler chickens. Braz. J. Poult. Sci. 2017;19:497–508. [Google Scholar]

[bib0017] Fusco A., Savio V., Donniacuo M., Perfetto B., Donnarumma G. Antimicrobial peptides human beta-defensin-2 and -3 protect the gut during candida albicans infections enhancing the intestinal barrier integrity: In vitro study. Front. Cell Infect. Microbiol. 2021;11 doi: 10.3389/fcimb.2021.666900. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0018] Gill N., Wlodarska M., Finlay B.B. Roadblocks in the gut: barriers to enteric infection. Cell Microbiol. 2011;13:660–669. doi: 10.1111/j.1462-5822.2011.01578.x. [DOI] [PubMed] [Google Scholar]

[bib0019] Gómez-García M., Argüello H., Puente H., Mencía-Ares Ó., González S., Miranda R., Rubio P., Carvajal A. In-depth in vitro evaluation of the activity and mechanisms of action of organic acids and essential oils against swine enteropathogenic bacteria. Front. Vet. Sci. 2020;7 doi: 10.3389/fvets.2020.572947. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0020] Greene G., Koolman L., Whyte P., Lynch H., Coffey A., Lucey B., Egan J., O'Connor L., Bolton D. The efficacy of organic acid, medium chain fatty acid and essential oil-based broiler treatments; in vitro anti-campylobacter jejuni activity and the effect of these chemical-based treatments on broiler performance. J. Appl. Microbiol. 2022;132:687–695. doi: 10.1111/jam.15204. [DOI] [PubMed] [Google Scholar]

[bib0021] Hernández-Coronado A.C., Silva-Vázquez R., Rangel-Nava Z.E., Hernández-Martínez C.A., Kawas-Garza J.R., Hume M.E., Méndez-Zamora G. Mexican oregano essential oils given in drinking water on performance, carcass traits, and meat quality of broilers. Poult. Sci. 2019;98:3050–3058. doi: 10.3382/ps/pez094. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0022] Hu Z., Liu L., Guo F., Huang J., Qiao J., Bi R., Huang J., Zhang K., Guo Y., Wang Z. Dietary supplemental coated essential oils and organic acids mixture improves growth performance and gut health along with reduces salmonella load of broiler chickens infected with salmonella enteritidis. J. Anim. Sci. Biotechnol. 2023;14:95. doi: 10.1186/s40104-023-00889-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0023] Huang X., Lao Y., Pan Y., Chen Y., Zhao H., Gong L., Xie N., Mo C.H. Synergistic antimicrobial effectiveness of plant essential oil and its application in seafood preservation: a review. Molecules. 2021;26:307. doi: 10.3390/molecules26020307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0024] Iqbal Z., Metzger F., Singh M., Morgan N., Swick R.A., Perez-Maldonado R.A., M'Sadeq S.A., Zentek J., Ruhnke I. Enzymes and/or combination of organic acid and essential oils supplementation in pasture-fed free-range laying hens increased the digestibility of nutrients and non-starch polysaccharides. Poult. Sci. 2019;98:1410–1424. doi: 10.3382/ps/pey479. [DOI] [PubMed] [Google Scholar]

[bib0025] Kaldhusdal M., Benestad S.L., Lovland A. Epidemiologic aspects of necrotic enteritis in broiler chickens - disease occurrence and production performance. Avian Pathol. 2016;45:271–274. doi: 10.1080/03079457.2016.1163521. [DOI] [PubMed] [Google Scholar]

[bib0026] Kalia V.C., Shim W.Y., Patel S.K.S., Gong C., Lee J.K. Recent developments in antimicrobial growth promoters in chicken health: Opportunities and challenges. Sci. Total. Environ. 2022;834 doi: 10.1016/j.scitotenv.2022.155300. [DOI] [PubMed] [Google Scholar]

[bib0027] Liu Y., Yang X., Xin H., Chen S., Yang C., Duan Y., Yang X. Effects of a protected inclusion of organic acids and essential oils as antibiotic growth promoter alternative on growth performance, intestinal morphology and gut microflora in broilers. Anim. Sci. J. 2017;88:1414–1424. doi: 10.1111/asj.12782. [DOI] [PubMed] [Google Scholar]

[bib0028] Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

[bib0029] Ma J., Long S., Wang J., Gao J., Piao X. Microencapsulated essential oils combined with organic acids improves immune antioxidant capacity and intestinal barrier function as well as modulates the hindgut microbial community in piglets. J. Anim. Sci. Biotechnol. 2022;13:16. doi: 10.1186/s40104-021-00670-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0030] Manvatkar P.N., Kulkarni R.C., Awandkar S.P., Chavhan S.G., Durge S.M., Avhad S.R., Channa G.R., Kulkarni M.B. Performance of broiler chicken on dietary supplementation of protected organic acids blend. Br. Poult. Sci. 2022;63:633–640. doi: 10.1080/00071668.2022.2076211. [DOI] [PubMed] [Google Scholar]

[bib0031] Mehdi Y., Létourneau-Montminy M.P., Gaucher M.L., Chorfi Y., Suresh G., Rouissi T., Brar S.K., Côté C., Ramirez A.A., Godbout S. Use of antibiotics in broiler production: global impacts and alternatives. Anim. Nutr. 2018;4:170–178. doi: 10.1016/j.aninu.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0032] Mikulski D., Zdunczyk Z., Jankowski J., Juskiewicz J. Effects of organic acids or natural plant extracts added to diets for turkeys on growth performance, gastrointestinal tract metabolism and carcass characteristics. J. Anim. Feed Sci. 2008;17:233. [Google Scholar]

[bib0033] Miles R.D., Butcher G.D., Henry P.R., Littell R.C. Effect of antibiotic growth promoters on broiler performance, intestinal growth parameters, and quantitative morphology. Poult. Sci. 2006;85:476–485. doi: 10.1093/ps/85.3.476. [DOI] [PubMed] [Google Scholar]

[bib0034] Moharreri M., Vakili R., Oskoueian E., Rajabzadeh G. Evaluation of microencapsulated essential oils in broilers challenged with salmonella enteritidis: a focus on the body's antioxidant status, gut microbiology, and morphology. Arch. Razi. Inst. 2022;77:629–639. doi: 10.22092/ARI.2021.354334.1634. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0035] Mohebodini H., Jazi V., Ashayerizadeh A., Toghyani M., Tellez-Isaias G. Productive parameters, cecal microflora, nutrient digestibility, antioxidant status, and thigh muscle fatty acid profile in broiler chickens fed with eucalyptus globulus essential oil. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2020.12.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0036] Myers W.D., Ludden P.A., Nayigihugu V., Hess B.W. Technical note: a procedure for the preparation and quantitative analysis of samples for titanium dioxide. J. Anim. Sci. 2004;82:179–183. doi: 10.2527/2004.821179x. [DOI] [PubMed] [Google Scholar]

[bib0037] Nguyen D.H., Lee K.Y., Mohammadigheisar M., Kim I.H. Evaluation of the blend of organic acids and medium-chain fatty acids in matrix coating as antibiotic growth promoter alternative on growth performance, nutrient digestibility, blood profiles, excreta microflora, and carcass quality in broilers. Poult. Sci. 2018;97:4351–4358. doi: 10.3382/ps/pey339. [DOI] [PubMed] [Google Scholar]

[bib0038] Noruzi S., Torki M., Mohammadi H. Effects of supplementing diet with thyme (Thymus vulgaris L.) essential oil and/or selenium yeast on production performance and blood variables of broiler chickens. Vet. Med. Sci. 2022;8:1137–1145. doi: 10.1002/vms3.736. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0039] O'Garra A., Vieira P. T(h)1 cells control themselves by producing interleukin-10. Nat. Rev. Immunol. 2007;7:425–428. doi: 10.1038/nri2097. [DOI] [PubMed] [Google Scholar]

[bib0040] Pham V.H., Abbas W., Huang J., Guo F., Zhang K., Kong L., Zhen W., Guo Y., Wang Z. Dietary coated essential oil and organic acid mixture supplementation improves health of broilers infected with avian pathogenic Escherichia coli. Anim. Nutr. 2023;12:245–262. doi: 10.1016/j.aninu.2022.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0041] Pham V.H., Abbas W., Huang J., He Q., Zhen W., Guo Y., Wang Z. Effect of blending encapsulated essential oils and organic acids as an antibiotic growth promoter alternative on growth performance and intestinal health in broilers with necrotic enteritis. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101563. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0042] Pham V.H., Kan L., Huang J., Geng Y., Zhen W., Guo Y., Abbas W., Wang Z. Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis. J. Anim. Sci. Biotechnol. 2020;11:18. doi: 10.1186/s40104-019-0421-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0043] Remmal A., Achahbar S., Bouddine L., Chami N., Chami F. In vitro destruction of Eimeria oocysts by essential oils. Vet. Parasitol. 2011;182:121–126. doi: 10.1016/j.vetpar.2011.06.002. [DOI] [PubMed] [Google Scholar]

[bib0044] Saleem K., Saima A.R., Pasha T.N., Mahmud A., Hayat Z. Effects of dietary organic acids on performance, cecal microbiota, and gut morphology in broilers. Trop. Anim. Health Prod. 2020;52:3589–3596. doi: 10.1007/s11250-020-02396-2. [DOI] [PubMed] [Google Scholar]

[bib0045] Salim H.M., Huque K.S., Kamaruddin K.M., Beg M. Global restriction of using antibiotic growth promoters and alternative strategies in poultry production. Sci. Prog. 2018;101:52–75. doi: 10.3184/003685018X15173975498947. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0046] Scicutella F., Mannelli F., Daghio M., Viti C., Buccioni A. Polyphenols and organic acids as alternatives to antimicrobials in poultry rearing: a review. Antibiotics. (Basel) 2021;10:1010. doi: 10.3390/antibiotics10081010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0047] Smith A.J., Humphries S.E. Cytokine and cytokine receptor gene polymorphisms and their functionality. Cytokine Growth Factor Rev. 2009;20:43–59. doi: 10.1016/j.cytogfr.2008.11.006. [DOI] [PubMed] [Google Scholar]

[bib0048] Sobotik E.B., Ramirez S., Roth N., Tacconi A., Pender C., Murugesan R., Archer G.S. Evaluating the effects of a dietary synbiotic or synbiotic plus enhanced organic acid on broiler performance and cecal and carcass salmonella load. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101508. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0049] Sorbara M.T., Pamer E.G. Microbiome-based therapeutics. Nat. Rev. Microbiol. 2022;20:365–380. doi: 10.1038/s41579-021-00667-9. [DOI] [PubMed] [Google Scholar]

[bib0050] Stefanello C., Rosa D.P., Dalmoro Y.K., Segatto A.L., Vieira M.S., Moraes M.L., Santin E. Protected blend of organic acids and essential oils improves growth performance, nutrient digestibility, and intestinal health of broiler chickens undergoing an intestinal challenge. Front. Vet. Sci. 2019;6:491. doi: 10.3389/fvets.2019.00491. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0051] Sun Y., Ni A., Jiang Y., Li Y., Huang Z., Shi L., Xu H., Chen C., Li D., Han Y., Chen J. Effects of replacing in-feed antibiotics with synergistic organic acids on growth performance, health, carcass, and immune and oxidative statuses of broiler chickens under clostridium perfringens type a challenge. Avian Dis. 2020;64:393–400. doi: 10.1637/aviandiseases-D-19-00101. [DOI] [PubMed] [Google Scholar]

[bib0052] Teng P.Y., Kim W.K. Review: Roles of prebiotics in intestinal ecosystem of broilers. Front. Vet. Sci. 2018;5:245. doi: 10.3389/fvets.2018.00245. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0053] Turner J.R., Rill B.K., Carlson S.L., Carnes D., Kerner R., Mrsny R.J., Madara J.L. Physiological regulation of epithelial tight junctions is associated with myosin light-chain phosphorylation. Am. J. Physiol. 1997;273:C1378–C1385. doi: 10.1152/ajpcell.1997.273.4.C1378. [DOI] [PubMed] [Google Scholar]

[bib0054] van Eerden E., Santos R.R., Molist F., Dardi M., Pantoja-Millas L.A., Molist-Badiola J., Baratelli M., Pages M. Efficacy of an attenuated vaccine against avian coccidiosis in combination with feed additives based on organic acids and essential oils on production performance and intestinal lesions in broilers experimentally challenged with necrotic enteritis. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101848. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0055] Vande Maele L., Heyndrickx M., Maes D., De Pauw N., Mahu M., Verlinden M., Haesebrouck F., Martel A., Pasmans F., Boyen F. In vitro susceptibility of brachyspira hyodysenteriae to organic acids and essential oil components. J. Vet. Med. Sci. 2016;78:325–328. doi: 10.1292/jvms.15-0341. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0056] Wang H., Liang S., Li X., Yang X., Long F., Yang X. Effects of encapsulated essential oils and organic acids on laying performance, egg quality, intestinal morphology, barrier function, and microflora count of hens during the early laying period. Poult. Sci. 2019;98:6751–6760. doi: 10.3382/ps/pez391. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0057] Wang Y., Yang J., Wang W., Sanidad K.Z., Cinelli M.A., Wan D., Hwang S.H., Kim D., Lee K.S.S., Xiao H., Hammock B.D., Zhang G. Soluble epoxide hydrolase is an endogenous regulator of obesity-induced intestinal barrier dysfunction and bacterial translocation. Proc. Natl. Acad. Sci. U S A, 2020;117:8431–8436. doi: 10.1073/pnas.1916189117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0058] Wannissorn B., Jarikasem S., Siriwangchai T., Thubthimthed S. Antibacterial properties of essential oils from Thai medicinal plants. Fitoterapia. 2005;76:233–236. doi: 10.1016/j.fitote.2004.12.009. [DOI] [PubMed] [Google Scholar]

[bib0059] Wu Y., Shao Y., Song B., Zhen W., Wang Z., Guo Y., Shahid M.S., Nie W. Effects of Bacillus coagulans supplementation on the growth performance and gut health of broiler chickens with clostridium perfringens-induced necrotic enteritis. J. Anim. Sci. Biotechnol. 2018;9:1–14. doi: 10.1186/s40104-017-0220-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0060] Yang X., Liu Y., Yan F., Yang C., Yang X. Effects of encapsulated organic acids and essential oils on intestinal barrier, microbial count, and bacterial metabolites in broiler chickens. Poult. Sci. 2019;98:2858–2865. doi: 10.3382/ps/pez031. [DOI] [PubMed] [Google Scholar]

[bib0061] Yang X., Xin H., Yang C., Yang X. Impact of essential oils and organic acids on the growth performance, digestive functions and immunity of broiler chickens. Anim. Nutr. 2018;4:388–393. doi: 10.1016/j.aninu.2018.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0062] Yang Y., Wang Q., Diarra M.S., Yu H., Hua Y., Gong J. Functional assessment of encapsulated citral for controlling necrotic enteritis in broiler chickens. Poult. Sci. 2016;95:780–789. doi: 10.3382/ps/pev375. [DOI] [PubMed] [Google Scholar]

[bib0063] Youssef I.M.I., Männer K., Zentek J. Effect of essential oils or saponins alone or in combination on productive performance, intestinal morphology and digestive enzymes' activity of broiler chickens. J. Anim. Physiol. Anim. Nutr. (Berlin) 2021;105:99–107. doi: 10.1111/jpn.13431. [DOI] [PubMed] [Google Scholar]

[bib0064] Zeng Z., Zhang S., Wang H., Piao X. Correction to: essential oil and aromatic plants as feed additives in non-ruminant nutrition: a review. J. Anim. Sci. Biotechnol. 2020;11:50. doi: 10.1186/s40104-020-00467-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0065] Zhang L.Y., Peng Q.Y., Liu Y.R., Ma Q.G., Zhang J.Y., Guo Y.P., Xue Z., Zhao L.H. Effects of oregano essential oil as an antibiotic growth promoter alternative on growth performance, antioxidant status, and intestinal health of broilers. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101163. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0066] Zhang S., Shen Y.R., Wu S., Xiao Y.Q., He Q., Shi S.R. The dietary combination of essential oils and organic acids reduces Salmonella enteritidis in challenged chicks. Poult. Sci. 2019;98:6349–6355. doi: 10.3382/ps/pez457. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib0067] Zhu X., Zhang Y., Zhao Y., Tao L., Liu H., Dong W., Yang G., Li L. Effects of dietary supplementation with itaconic acid on the growth performance, nutrient digestibility, slaughter variables, blood biochemical parameters, and intestinal morphology of broiler chickens. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101732. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Effects of microencapsulated essential oils and organic acids preparation on growth performance, slaughter characteristics, nutrient digestibility and intestinal microenvironment of broiler chickens

Jia Huang

Fangshen Guo

Waseem Abbas

Zeqiong Hu

Lin Liu

Jianing Qiao

Ruichen Bi

Tiantian Xu

Kaichen Zhang

Jinyu Huang

Yuming Guo

Zhong Wang

Abstract

INTRODUCTION

MATERIALS AND METHODS

Broiler Chickens, Diets, and Experimental Design

Table 1.

Measurement of Growth Performance and Slaughter Traits

Samples Collection

Measurement of the Ileal Nutrient Apparent Digestibility

Assay of Morphology and Goblet Cells in the Ileum

Measurement of Enzyme Activity in Small Intestinal Mucosa

Determination of Secretary Immunoglobulin A (sIgA) Content in Ileal Mucosa

Measurement of Cecal Microbiota

Measurement of Short Chain Fatty Acid (SCFA) Content in Cecal Digesta

Measurement of Gene Expression in Ileum Using Quantitative Real-time PCR

Table 2.

Statistical Analysis

RESULTS

Growth Performance

Table 3.

Carcass Characteristics

Table 4.

Apparent Digestibility of Diet

Table 5.

Morphological Structure, Goblet Cell Density and sIgA Content in the Ileum

Table 6.

Figure 1.

Figure 2.

Enzyme Activity of Small Intestinal Mucosa

Table 7.

Table 8.

Bacterial Concentration in Cecal Digesta

Table 9.

Short Chain Fatty Acids Content in Cecal Digesta

Table 10.

Gene Expression in the Ileum

Table 11.

DISCUSSION

CONCLUSIONS

ACKNOWLEDGMENTS

DISCLOSURES

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases