Abstract
Plant growth-promoting bacteria (PGPB) play a role in stimulating plant growth through mechanisms such as the synthesis of the phytohormone indole-3-acetic acid (IAA). The aims of this study were the characterization of IAA synthesis and degradation by the model aromatic-degrading bacterium Paraburkholderia xenovorans LB400, and its growth promotion of the Nicotiana tabacum plant. Strain LB400 was able to synthesize IAA (measured by HPLC) during growth in the presence of tryptophan and at least one additional carbon source; synthesis of anthranilic acid was also observed. RT-PCR analysis indicates that under these conditions, strain LB400 expressed the ipdC gene, which encodes indole-3-pyruvate decarboxylase, suggesting that IAA biosynthesis proceeds through the indole-3-pyruvate pathway. In addition, strain LB400 degraded IAA and grew on IAA as a sole carbon and energy source. Strain LB400 expressed the iacC and catA genes, which encode the α subunit of the aromatic-ring-hydroxylating dioxygenase in the IAA catabolic pathway and the catechol 1,2-dioxygenase, respectively, which may suggest a peripheral IAA pathway leading to the central catechol pathway. Notably, P. xenovorans LB400 promoted the growth of tobacco seedlings, increasing the number and the length of the roots. In conclusion, this study indicates that the versatile bacterium P. xenovorans LB400 is a PGPB.
Keywords: indole-3-acetic acid (IAA), IAA synthesis, IAA degradation, Paraburkholderia xenovorans LB400, plant growth-promoting bacteria (PGPB)
1. Introduction
Plant growth-promoting bacteria (PGPB) are beneficial for plants, contributing to plant growth, health, and protection against phytopathogens via the synthesis of phytohormones, the increase of nutrient availability (e.g., nitrogen fixation, phosphorus solubilization, siderophore synthesis) and the control of plant pathogens [1,2]. Extensively studied in recent years, PGPB belong to various genera, including Acetobacter, Acinetobacter, Alcaligenes, Arthrobacter, Azoarcus, Azospirillum, Azotobacter, Bacillus, Beijerinckia, Burkholderia, Derxia, Enterobacter, Gluconacetobacter, Herbaspirillum, Klebsiella, Ochrobactrum, Pantoea, Paraburkholderia, Pseudomonas, Rhodococcus, Serratia, Stenotrophomonas, and Zoogloea [1,2,3].
Indole-3-acetic acid (IAA) is a phytohormone that serves as the primary endogenous auxin in higher plants, influencing various physiological processes such as cell division, elongation, tissue differentiation, phototropism, gravitropism, and defensive responses [4,5]. Plants but also bacteria, fungi, and algae are able to synthesize IAA, impacting plant growth and development [6,7]. Notably, IAA production is a distinguishing feature of both PGPB and phytopathogenic bacteria [8,9]. Five tryptophan-dependent IAA biosynthetic pathways have been reported in bacteria; the indole-3-pyruvate (IPyA) and indole-3-acetamide (IAM) pathways are the most important and widely distributed [10,11,12]. The IPyA pathway is prevalent in PGPB, while the IAM pathway is primarily associated with phytopathogenic bacteria. Anthranilic acid (AA) acts as a metabolic intermediate in tryptophan synthesis and degradation, which typically does not accumulate [13]. It has been reported that AA promotes the growth of maize plants [14], participating in phytohormone synthesis pathways (e.g., IAA), and exhibiting bacteriostatic activity against the phytopathogen Streptomyces sp. B-9-1 [15]. IAA-degrading bacteria are also associated with plants [4]. IAA is an aromatic compound that may be used as a carbon and nitrogen source for bacterial growth. Complete aerobic IAA degradation has been reported in bacterial genera Bradyrhizobium, Pseudomonas, Burkholderia, Paraburkholderia, Rhodococcus, Sphingomonas, Caballeronia, Enterobacter, and Acinetobacter [16,17,18]. The mineralization of IAA or its transformation into a biologically inactive molecule allows the bacterium to manipulate physiological activities related to IAA levels in plants [16]. The aerobic catabolic pathway that transforms IAA into catechol is codified by the iac gene cluster, which was first described in Pseudomonas putida 1290 [16,18].
Diverse Paraburkholderia species are plant-associated bacteria and rhizobia that present a multifaceted role in improving plant performance such as enhancement of nutrient mobilization and plant growth, tolerance to abiotic and biotic stress, reduction of oxidative stress, improvement of root architecture, and production of secondary metabolites [19,20]. Paraburkholderia xenovorans LB400 (previously named Burkholderia xenovorans LB400) is a non-pathogenic aerobic soil bacterium, with a large genome size of 9.73 Mbp, which is a model for the degradation of aromatic compounds [21]. Strain LB400 degrades an unusually wide range of aromatic compounds including polychlorobiphenyls (PCBs) and is capable of modifying flavonoids [21,22,23,24,25,26,27,28,29,30,31]. Other P. xenovorans strains have been isolated from coffee, corn, and tomato plant rhizospheres and human blood [32,33,34,35]. Caballero-Mellado et al. [35] reported that P. xenovorans strains TCo-382 and TCo-213 from tomato plants have the potential to improve plant growth, due to their 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, which lowers ethylene levels in plants. However, these strains are unable to degrade PCBs [32,35]. In this study, the aims were the characterization of the IAA synthesis and degradation by P. xenovorans LB400, and its growth promotion of the Nicotiana tabacum plant.
2. Results and Discussion
2.1. IAA Synthesis
2.1.1. P. xenovorans LB400 Possesses Genes for IAA Biosynthesis
Bioinformatic analysis of the P. xenovorans LB400 genome unveiled the presence of genes encoding two distinct pathways for IAA synthesis from tryptophan: the IPyA and IAM routes (Table 1). The IPyA pathway is primarily associated with plant growth-promoting bacteria (PGPB), while the IAM pathway is observed mainly in phytopathogenic bacteria [10,11]. The IPyA route involves three enzymatic steps. Initially, the precursor tryptophan undergoes transamination into IPyA via an aminotransferase. Thirty-nine genes encoding aminotransferases have been reported in the LB400 genome [21]. In the rate-limiting step, IPyA is decarboxylated to form indole-3-acetaldehyde (IAAld) by the indole-3-pyruvate decarboxylase (IpdC), encoded by the ipdC gene. Subsequently, IAAld is oxidized to IAA by the indole-3-acetaldehyde dehydrogenase, encoded by the iad1 gene. In strain LB400, the ipdC (Bxe_B0109) and iad1 (Bxe_B0108) genes are clustered on the minor chromosome (C2). Bioinformatic analysis suggests that the ipdC and iad1 genes form a transcriptional unit (Figure 1a). The products of the ipdC and iad1 genes in strain LB400 exhibit ≥ 37% amino acid sequence identity with IpdC and Iad1 proteins from the bacterium Pantoea agglomerans 299R and the fungus Ustilago maydis FB1, respectively [36,37] (Table 1).
Table 1.
Proteins associated to the IPyA and IAM pathways for IAA biosynthesis in P. xenovorans LB400.
| Pathway | Gene | ORF | aa | Related Gene Products | |||
|---|---|---|---|---|---|---|---|
| Protein | Function | Organism (Accession Number) | Identity (%) | ||||
| IPyA | ipdC | Bxe_B0109 | 550 | IpdC | Indole-3-pyruvate decarboxylase |
Pantoea agglomerans 299R (WP_003848906) | 229/539 (42) |
| iad1 | Bxe_B0108 | 497 | Iad1 | Indole-3-acetaldehyde dehydrogenase |
Ustilago maydis FB1 (AAC49575) |
176/481 (37) | |
| IAM | iaaM | Bxe_C1245 | 575 | IaaM | Tryptophan-2- monooxygenase |
Agrobacterium fabrum C58 (AAD30489) | 212/557 (38) |
| iaaH | Bxe_B1011 | 484 | IaaH | Indole-3-acetamide hydrolase | Agrobacterium fabrum C58 (AAD30488) | 200/466 (43) | |
Abbreviations: IPyA: indole-3-pyruvate; IAM: indole-3-acetamide; IAA: indole-3-acetic acid; ORF: open reading frame; aa: amino acid.
Figure 1.
Organization of genes in the IPyA and IAM IAA anabolic pathways in P. xenovorans LB400 and other bacteria. (a) Organization of the ipdC and iad1 genes of the indole-3-pyruvate (IPyA) pathway. (b) Organization of iaaH and iaaM genes of the indole-3-acetamide (IAM) pathway. Gene sizes and intergenic regions are accurately represented to scale. C2 denotes the minor chromosome, and MP represents the megaplasmid.
The ipdC gene has been studied in bacteria such as Azospirillum baldaniorum, Paenibacillus polymyxa, Bacillus cereus, Enterobacter cloacae, and Acinetobacter baumannii [38,39,40,41,42,43,44,45,46]. Recently, indole-3-acetaldehyde dehydrogenase (AldA) from Ps. syringae pv. tomato DC3000 has been described [47]. The indole-3-acetaldehyde dehydrogenase of the strain DC3000 showed 37% amino acid sequence identity with the Iad1 protein from strain LB400. The organization of the ipdC and iad1 genes in strain LB400 is interesting and differs from other bacteria possessing the IPyA pathway, since these genes are clustered on its genome (Figure 1a).
In the LB400 genome, adjacent to the ipdC and iad1 genes are located genes encoding an FMN-dependent dehydrogenase (Bxe_B0107), and a transcriptional regulator from the AsnC family (Bxe_B0110) that is also present in Acinetobacter baumannii strain AB307-0294 (Figure 1a). In A. baumannii AB307-0294, the gene encoding a transcriptional regulator from the AsnC family is positioned between the ipdC gene and a dehydrogenase gene (Figure 1a). AsnC proteins are part of the Lrp global transcriptional regulators [48], known to regulate the expression of amino acid anabolic and catabolic pathways and related processes [49]. The AsnC protein from P. xenovorans LB400 displays the characteristic helix-turn-helix (HTH) motif for DNA binding in the N-terminal and the effector-binding domain αβ-sandwich in the C-terminal. A potential Lrp-type regulatory binding sequence, CACTACATTGTAGTC, was identified upstream of the ipdC gene in strain LB400, exhibiting high identity (75%) with the consensus Lrp-type regulator binding sequence YAGHAWATTWTDCTR [50].
The IAM pathway for IAA synthesis involves two key enzymatic steps. Initially, tryptophan undergoes oxidation into IAM by tryptophan monooxygenase, which is encoded by the iaaM gene. Subsequently, IAM is hydrolyzed into IAA and ammonia by IAM hydrolase, which is encoded by the iaaH gene. In P. xenovorans LB400, the iaa genes are distributed across different replicons. Specifically, the iaaM gene (Bxe_C1245) is located on the megaplasmid (MP), while the iaaH gene (Bxe_B1011) is located on C2 (Figure 1b). The iaaM and iaaH gene products in strain LB400 exhibit ≥ 38% sequence identity with IaaM and IaaH proteins from Agrobacterium fabrum C58 [51] (Table 1). The gene organization of the iaa genes differs among bacteria (Figure 1b). In the PGPB P. phytofirmans PsJN, only the iaaH gene is present. In the phytopathogens Ps. savastanoi pv. savastanoi NCPPB 3335 (plasmid IAA1) [52], Liberibacter crescens BT-1 [53], and Dickeya dadantii 3937 [54], both iaaM and iaaH genes are clustered with the same orientation. In the phytopathogens Agrobacterium fabrum C58 and A. tumefaciens strains [51,55], the iaaM and iaaH genes are clustered in the T-DNA region of the Ti plasmid, with opposite orientations; the ipt gene is located next to these genes, which encodes an isopentenyltransferase involved in cytokinin production, thereby enhancing its virulence [56]. The ipt gene is absent in the P. xenovorans LB400 genome.
2.1.2. Synthesis of IAA by P. xenovorans LB400
In this study, P. xenovorans LB400 cells were cultivated in different media and reverse-phase liquid chromatography was used to evaluate and quantify IAA synthesis (Figure 2). Recently, Ghitti et al. [57] described the auxin production of P. xenovorans LB400 using the non-specific Salkowski method. The Salkowski method detects IAA but also IPyA and indole-3-acetamide, intermediate compounds in IAA production, and other auxins such as indole-3-butyric acid [10,57,58].
Figure 2.
Growth and indole-3-acetic acid (IAA)/anthranilic acid (AA) biosynthesis by P. xenovorans LB400. (a) Growth in the presence of tryptophan. Cells were cultivated in different media (M9 or LB) with glucose (30 mM) and/or tryptophan (10 mM). (b) IAA biosynthesis. (c) AA biosynthesis. Each value represents an average ± SD of three independent experiments. IAA/AA production were not detected in M9 medium with tryptophan or glucose as sole carbon and energy sources. Significant differences for each time point (24 h, 48 h, 72 h) between the conditions of IAA/AA biosynthesis were analyzed by one-way ANOVA followed by the LSD Fisher test. Means with different letters indicate significant differences (p ≤ 0.05).
P. xenovorans LB400 exhibited IAA synthesis in M9 medium with glucose supplemented with tryptophan, as well as in LB medium supplemented with tryptophan (Figure 2). In contrast, IAA production was not observed when strain LB400 was grown in M9 medium with sole glucose. In M9 medium with tryptophan as the sole carbon and energy source, LB400 growth and IAA production was not observed. However, the addition of glucose to M9 medium with tryptophan favored IAA production by strain LB400. Glucose supplementation enhances IAA production in Rhizobium, Bacillus, and Streptomyces strains grown with tryptophan [59,60,61,62,63]. IAA biosynthesis in strain LB400 was particularly prominent during the stationary growth phase (Figure 2a,b). Strain LB400 achieved its maximum IAA concentration (0.98 mM) after 72 h growth in M9 medium with both glucose and tryptophan (Figure 2a,b). Similar to strain LB400, other PGPB such as Burkholderia pyrrocinia JK-SH007, Serratia plymuthica UBCF_13, Azospirillum baldoniarum strains CBG 497 and Sp245, Pantoea agglomerans PVM, Arthrobacter globiformis A3, and Rhizobium spp. from nodule root of Roystonea regia and Cajanus cajan grown with tryptophan also showed higher IAA synthesis during the stationary phase [59,60,62,64,65,66,67,68,69,70]. By comparing the IAA production of strain LB400 with the IAA-producing bacterium Pseudomonas protegens CHA0 [71], which has the tryptophan side chain oxidase (TSO) IAA synthesis pathway, P. xenovorans strain LB400 exhibited higher IAA levels in all rich media (Luria-Bertani (LB), Yeast-Malt (YM), and King B (KB)) plus tryptophan (5 mM) than Ps. protegens strain CHA0 (Table 2). The YM medium plus tryptophan showed the highest IAA production for both strains, which has been also reported in Serratia [70]. The IAA production by P. xenovorans strain LB400 surpassed that of strain CHA0 reported in previous studies [71]. Pantoea agglomerans PVM, Enterobacter hormaechei VR2, and Bacillus aryabhattai MG9, and a Rhizobium spp. strain isolated from a nodule root of Cajanus cajan displayed high IAA production [57,60,65].
Table 2.
IAA and AA biosynthesis of P. xenovorans LB400 and Ps. protegens CHA0 grown in different culture media in the presence of tryptophan (5 mM) during 48 h.
| Bacterial Strain | Medium | Average IAA (mM) Synthesis (±SD) |
Average AA (mM) Synthesis (±SD) |
Average log (CFUs mL−1) (±SD) |
|---|---|---|---|---|
| P. xenovorans LB400 | LB | 0.193 (±0.012) | 0.141 (±0.034) | 5.349 (±0.494) |
| YM | 0.404 (±0.010) | 0.477 (±0.016) | 7.455 (±0.160) | |
| KB | 0.167 (±0.006) | 2.013 (±0.171) | 6.301 (±0.426) | |
| Ps. protegens CHA0 | LB | 0 | 0 | 7.331 (±0.142) |
| YM | 0.124 (±0.009) | 0.095 (±0.020) | 6.540 (±0.088) | |
| KB | 0 | 0.046 (±0.031) | 7.752 (±0.016) |
Abbreviations: IAA: indole-3-acetic acid; AA: anthranilic acid; CFUs: colony-forming units; SD: standard deviation.
2.1.3. Synthesis of Anthranilic Acid by P. xenovorans LB400
The observation of the accumulation of a secondary compound during the growth of strain LB400 in the presence of tryptophan and at least one additional carbon source led to the identification of anthranilic acid (AA) through HPLC analysis. The synthesis of AA by LB400 cells was observed in both LB medium with tryptophan and M9 medium with glucose and supplemented with tryptophan (Figure 2c), showing higher AA accumulation in LB medium with tryptophan. In LB medium supplemented with tryptophan, strain LB400 achieved an AA concentration of 1.67 mM after 72 h. Interestingly, LB400 cells in M9 medium with glucose and supplemented with tryptophan exhibited the highest IAA production with lower AA accumulation. In contrast, in LB medium supplemented with tryptophan, the highest AA production with lower IAA production was observed (Figure 2b,c). Since LB medium contains a higher tryptophan concentration than the M9 minimal medium due to the amino acid content of its composition provided by yeast extract and tryptone [72], the results suggest that in the presence of a high tryptophan concentration, strain LB400 favors AA accumulation, probably by activating the catabolism of tryptophan into AA. The comparison of AA production by P. xenovorans LB400 and the model PGPB Ps. protegens CHA0 in three rich media containing tryptophan (5 mM) indicated higher synthesis of AA by strain LB400 than by strain CHA0 under these conditions (Table 2). Specifically, P. xenovorans strain LB400 exhibited the highest AA synthesis (2.01 mM) in KB medium, which is the medium that has the highest concentration of digested peptides provided by peptone [73]. For strain CHA0, the highest AA (0.095 mM) levels were observed in YM medium. Notably, the AA synthesis by P. xenovorans LB400 was much higher than by Ps. protegens CHA0. This study highlights that P. xenovorans LB400 in the presence of tryptophan synthesized both IAA and AA. Simultaneous IAA and AA synthesis has been also described in Azospirillum brasilense CBG 497 and Bradyrhizobium japonicum BJBV-05 grown in LB medium with tryptophan [64,74].
P. xenovorans strain LB400 possesses the kynABU genes (Bxe_A0733, Bxe_A0734, and Bxe_B0735, respectively) clustered on C1, encoding the enzymes tryptophan 2,3-dioxygenase (tryptophan to formyl kynurenine), kynurenine formamidase (formyl kynurenine to kynurenine), and kynureninase (kynurenine to anthranilic acid) involved in the three-step degradation of tryptophan into AA [75]. In Escherichia coli, a high tryptophan concentration leads to the repression of trp operon transcription by the tryptophan-activated repressor protein TrpR, resulting in the attenuation of its transduction and the accumulation of its precursor AA [76,77]. In this study, we searched in the LB400 genome for genes involved in tryptophan synthesis. Strain LB400 possesses the trpE (Bxe_A0461), trpD1 (Bxe_A0460), trpD2 (Bxe_A0459), and trpC1 genes (Bxe_A0458) grouped in the trpED1D2C1 cluster on C1. The trpE gene encodes anthranilate synthase, which catalyzes the transformation of chorismate into anthranilate [78]. Additionally, the trpC2 (Bxe_B2882), trpB (Bxe_B2881), and trpA genes (Bxe_B2879) are clustered on C2. A putative trpR gene (Bxe_A1353) encoding a TrpR-type transcriptional repressor is located on C1. In strain LB400, a high concentration of tryptophan may repress the expression of the trpED1D2C genes, supporting the accumulation of AA. Interestingly, the chemical synthesis of AA from petroleum compounds is a costly process involving high temperature and pressure [13], converting the biological production of AA into an attractive alternative strategy. Future investigations should explore potential biotechnological applications of AA production by P. xenovorans strain LB400.
2.1.4. P. xenovorans Expressed the ipdC Gene but Not the iaaH Gene
Transcriptional analysis of key metabolic genes of strain LB400 was conducted, to establish a connection between IAA biosynthesis and the anabolic genes. The expression in strain LB400 of the ipdC gene, which encodes the enzyme indole-3-pyruvate decarboxylase (IPyA pathway), and the iaaH gene, responsible for indole-3-acetamide hydrolase (IAM pathway), were examined. The ipdC gene was transcribed in all tested conditions (Figure 3a,b). However, a notable increase in ipdC gene expression was observed in P. xenovorans LB400 cells after 24 and 48 h of growth in M9 medium supplemented with glucose and tryptophan compared with M9 medium supplemented with glucose. These results suggest that in M9 medium supplemented with glucose, tryptophan enhances the expression of the ipdC gene in strain LB400.
Figure 3.
Expression of the ipdC and iaaH genes in P. xenovorans LB400 grown with different carbon sources. (a) RT-PCR (15, 20, 25, and 30 amplification cycles) of ipdC gene after 24 h growth. (b) RT-PCR (25 and 30 amplification cycles) of ipdC gene after 48 h growth. (c) RT-PCR (30 amplification cycles) of iaaH gene after 48 h growth. RNA samples were purified from LB400 cells harvested at 24 and 48 h. The 16S rRNA gene was selected as a reference gene. MM, molecular markers; 1, cells grown in M9 medium supplemented with glucose (30 mM); 2, cells grown in M9 medium supplemented with glucose (30 mM) and tryptophan (10 mM); 3, cells grown in LB medium supplemented with tryptophan (10 mM).
The ipdC gene is upregulated in the presence of tryptophan in Bacillus thuringiensis RZ2MS9, Enterobacter cloacae UW5, E. xiangfangensis BWH6, E. asburiae STY10, Pseudomonas putida GR12-2, and Azospirillum baldoniarum Sp7, indicating its significance in IAA biosynthesis [8,41,47,79,80,81,82]. As tryptophan is prevalent in root exudates, plant tissues, and microbial debris, the observed upregulation of the ipdC gene in response to tryptophan may be involved in the adaptation to these specific environments. In Pantoea agglomerans 299R, the ipdC gene expression is plant-inducible, suggesting its involvement in plant–microbe interactions [69,83]. In strain LB400, the highest expression of the ipdC gene was observed in the stationary growth phase, correlating with higher IAA levels, which has also been described in Enterobacter cloacae UW5, Pseudomonas putida GR12-2, and Serratia plymuthica A153 [8,41,69,84]. In promoters of the ipdC gene from A. brasilense Sp245 and plant genes, cis elements with the consensus sequence TGTCNC that confer auxin responsiveness (auxin-response element or AuxRe) have been reported [10,85,86]. In P. xenovorans LB400, a potential auxin-response element (TGTCAC) located upstream of the ipdC gene and the gene that encodes the transcriptional regulator from the AsnC family has been observed, suggesting that IAA may regulate their gene expression.
In contrast, the iaaH gene from strain LB400, associated with the IAM pathway, showed no expression under the tested culture conditions (Figure 3c). This transcriptional analysis suggests the utilization of the IPyA pathway associated with PGPB for IAA biosynthesis in P. xenovorans LB400. Figure 4 shows the proposed biosynthetic pathways for IAA and AA production by strain LB400.
Figure 4.
Proposed P. xenovorans LB400 biosynthetic pathways for the indole-3-acetic acid (IAA) and anthranilic acid (AA). Strain LB400 probably employs the IPyA pathway for IAA synthesis. The key substrates, metabolites, and products include anthranilic acid (AA), tryptophan (Trp), indole-3-pyruvic acid (IPyA), indole-3-acetaldehyde (IAAld), and indole-3-acetic acid (IAA). The enzymes involved in the pathway are an aminotransferase, indole-3-pyruvate decarboxylase (IpdC), and indole-3-acetaldehyde dehydrogenase (Iad1). Additionally, enzymes related to the metabolism of tryptophan to AA are tryptophan 2,3-dioxygenase (KynA), kynurenine formamidase (KynB), and kynureninase (KynU). Enzymes involved in the conversion of chorismate via AA to tryptophan are anthranilate synthase components I and II (TrpE and TrpD), indole-3-glycerolphosphate synthase/N(-5-phosphoribosyl) anthranilate isomerase (TrpC), and tryptophan synthase subunits β and α (TrpB and TrpA). Compounds and genes measured in this study are highlighted in red. The synthesis of the compounds IAA and AA (determined by HPLC) and the expression of the ipdC gene that encodes the enzyme indole-3-pyruvate decarboxylase (determined by RT-PCR). The genes encoding enzymes not highlighted are also present in the genome of strain LB400. The gene locus of the genes corresponding to strain LB400 are shown in grey.
2.2. IAA Degradation
2.2.1. P. xenovorans LB400 Possesses Genes for IAA Degradation
The proposed IAA degradation pathway of P. xenovorans LB400 wherein the iac genes encoding the catabolic enzymes is shown in Figure 5a. The bioinformatic analysis of the iac genes involved in IAA catabolism in P. xenovorans LB400 showed high identity with the genes of the catabolic pathway from Paraburkholderia phytofirmans PsJN and Pseudomonas putida 1290 [16,17]. LB400 structural proteins exhibited ≥ 40% amino acid identity with reported proteins of the IAA catabolic pathway (Table 3). The IAA catabolic pathway is also present in Caballeronia glathei DSM 50014, Enterobacter soli LF7, Acinetobacter baumannii ATCC 19606, Aromatoleum evansii KB 740, and Aromatoleum aromaticum EbN1 [18]. The transcriptional regulator encoded by the P. xenovorans LB400 iacR gene showed high identity with the regulator of the LysR type from P. phytofirmans PsJN (Table 3), while no significant similarity is found in the genome of strain LB400 with the transcriptional regulator belonging to the family MarR from Ps. putida 1290. In the LB400 genome, nine genes were contiguous in C1, and the other three were clustered in C2. Within the cluster associated to IAA degradation, the cat operon involved in catechol degradation was identified. The organization of these genes on P. xenovorans LB400 C1 is the iacF–catCABR–iacRCDT1BIHE cluster (Figure 5b). Additionally, the iacT2AG cluster is located on C2. This organization of genes related to IAA and catechol degradation is also observed in P. phytofirmans strain PsJN [17]. In Ps. putida 1290 (Figure 5), A. baumanii ATCC19606, and E. soli LF7, the cat genes are located close to the iac genes. This genomic organization highlights the relationship between iac and cat genes in IAA degradation, wherein the iac genes are involved in the conversion of IAA to catechol, which is further metabolized by enzymes encoded by the cat genes [18]. Genomic analyses in Burkholderiales including diverse members of the Paraburkholderia and Burkholderia genera showed the genes of the catabolic pathway of IAA to catechol [87].
Figure 5.
Indole-3-acetic acid (IAA) aerobic degradation pathway and gene clusters involved in IAA catabolism in P. xenovorans LB400, P. phytofirmans PsJN, and Ps. putida 1290. (a) IAA degradation pathway wherein the iac genes encoding the catabolic enzymes are indicated. The IAA aerobic degradation pathway was adapted from Laird et al. [18]. (b) The iac and cat genes involved in peripheral IAA pathway and central catechol pathway. The iac genes (grey) encode enzymes involved in the conversion of IAA to catechol, which is further metabolized by enzymes encoded by the cat genes (black). Gene sizes and intergenic regions are accurately represented to scale. C1 and C2 denote the major and minor chromosomes, respectively.
Table 3.
Proteins associated to IAA degradation in P. xenovorans LB400.
| Gene | ORF | aa | Related Gene Products | ||
|---|---|---|---|---|---|
| Protein | Function | Identity (%) | |||
| iacA | Bxe_B2308 | 405 | IacA | Acyl-CoA dehydrogenase flavoprotein | 187/374 (50) * |
| iacB | Bxe_A2102 | 125 | IacB | Hypothetical conserved protein | 65/119 (55) * |
| iacC | Bxe_A2105 | 427 | IacC | Aromatic ring hydroxylation dioxygenase, α subunit | 256/418 (61) * |
| iacD | Bxe_A2104 | 166 | IacD | Aromatic ring hydroxylation dioxygenase, β subunit | 69/147 (47) * |
| iacE | Bxe_A2099 | 247 | IacE | Short-chain dehydrogenase | 129/245 (53) * |
| iacF | Bxe_A2111 | 325 | IacF | Ferredoxin reductase | 131/328 (40) * |
| iacG | Bxe_B2309 | 183 | IacG | Flavin reductase domain protein | 72/154 (47) * |
| iacH | Bxe_A2100 | 374 | IacH | Amidase | 193/376 (51) * |
| iacI | Bxe_A2101 | 180 | IacI | Hypothetical conserved protein | 67/151 (44) * |
| iacT1 | Bxe_A2103 | 438 | IacT1 | Transporter major facilitator superfamily (MFS) (DOAA transporter) | 420/438 (96) ** |
| iacT2 | Bxe_B2307 | 452 | IacT2 | Transporter major facilitator superfamily (MFS) (DOAA transporter) | 221/436 (51) ** |
| iacR | Bxe_A2106 | 317 | IacR | Transcriptional regulator LysR family | 301/315 (96) ** |
2.2.2. Degradation of IAA by P. xenovorans LB400
The IAA degradation pathway in P. xenovorans LB400 was first evaluated through growth assays using IAA as the sole carbon and energy source. Growth and IAA degradation analyses were carried out using three IAA concentrations (0.5, 1.5, and 3.0 mM). Figure 6a shows that P. xenovorans LB400 growth on IAA is lower compared to growth on glucose (5 mM). P. xenovorans LB400 growth on IAA reached a turbidity (600 nm) of 0.25, while the growth with glucose reached a turbidity (600 nm) of 1.0. P. xenovorans LB400 was able to degrade lower IAA concentration (0.5 mM), but not higher IAA concentrations (1.5 and 3.0 mM) (Figure 6b). Strain LB400 started the degradation late (120 h), correlating with slight growth. Similar growth (turbidity (600 nm) ~0.3) of Ps. putida 1290 and P. phytofirmans PsJN have been reported, but with a 10-fold higher IAA concentration (5 mM) and after 20 and 60 h of growth, respectively [16,17]. To possibly enhance the growth and degradation of IAA, culture was performed with IAA (0.5 mM) plus glucose (5 mM) (Figure 6c); however, despite the higher growth on glucose, the IAA degradation did not increase (Figure 6d).
Figure 6.
P. xenovorans LB400 growth on IAA and other carbon sources and IAA degradation. (a) LB400 growth on IAA (0.5, 1.5, and 3.0 mM). (b) Degradation of IAA (0.5, 1.5, and 3.0 mM). (c) LB400 growth on IAA (0.5 mM), IAA (0.5 mM) + glucose (5.0 mM), and glucose (5.0 mM). (d) Comparison of IAA (0.5 mM) degradation in co-culture with or without glucose (5.0 mM). Each value is a mean ± SD of three independent trials. Significant differences of the last three points of (d) were analyzed by one-way ANOVA followed by the LSD Fisher test. Means with different letters indicate significant differences (p ≤ 0.05).
Interestingly, IAA exerted an inhibitory effect on P. xenovorans LB400 growth on glucose. Lactobacillus, Saccharomyces cerevisiae, and Fusarium graminearum showed an inhibition on their growth in the presence of IAA [9,88,89,90]. IAA concentrations of 1.14 and 5.7 mM exhibited growth inhibition in Lactobacillus sp. strain 11201, attributed to the accumulation of the metabolic product 3-methylindole (skatole) [91]. Skatole showed bacteriostatic effects in Gram-negative bacteria [92], whereas catechol and other dehydroxylated aromatic metabolites are highly toxic for bacteria [93]. Therefore, IAA or its degradation products could inhibit the growth of P. xenovorans LB400.
To further study the degradation of IAA, P. xenovorans LB400 resting cells were incubated with IAA, resulting in almost complete degradation after 36 h (Figure 7). P. xenovorans LB400 exhibited the capability to degrade IAA and use it as sole carbon and energy source. However, this degradation might be more efficient under nutrient scarcity.
Figure 7.
Degradation of IAA by P. xenovorans LB400 resting cells. This assay was performed with concentrated LB400 cells (turbidity 600 nm = 8.0) incubated in phosphate buffer (5.0 mM, pH 7.0) with IAA (0.5 mM). Each value is a mean ± SD of three independent assays. Significant differences were analyzed by one-way ANOVA followed by the LSD Fisher test. Means with different letters indicate significant differences (p ≤ 0.05).
2.2.3. P. xenovorans Expressed the iacC and catA Genes
The expression of IAA catabolic genes in P. xenovorans LB400 was analyzed by assessing the expression of the iacC gene (Bxe_A2105), encoding the α subunit of the key dioxygenase in IAA catabolism, and the catA gene (Bxe_A2109), which encodes catechol 1,2-dioxygenase. The expression of the iacC and catA genes was measured by RT-PCR analysis in LB400 cells incubated with IAA and glucose (Figure 8). Growth in the presence of salicylate plus glucose was incorporated as a positive control, as salicylate is degraded via the central catechol pathway [21] The expression of the iacC gene was observed in resting cells incubated with IAA, and IAA plus glucose, but not with glucose or salicylate plus glucose (Figure 8a). On the other hand, the expression of the catA gene was observed in resting cells with IAA, IAA plus glucose, and salicylate plus glucose (Figure 8b). The expression of the catA gene in cells incubated with glucose might be attributed to the degradation of compounds such as tryptophan [21]. The expression of diverse iac genes and their convergence in the catechol degradation pathway has been described in Ps. putida 1290, Acinetobacter baumanii ATCC 19606, P. phytofirmans PsJN, Enterobacter soli LF7, and Caballeronia glathei DSM50014 [17,18,94,95,96]. The expression of the iacC gene is probably associated with the transformation of the metabolic intermediate 3-hydroxy-2-oxoindole 3-acetic acid (DOAA) into catechol [18] (Figure 5a). The expression of iacC and catA genes in P. xenovorans LB400 may suggest that this strain has an active catabolic pathway that converts IAA into catechol [18]. The IAA peripheral pathway is probably connected to the central catechol pathway, which is involved in the degradation of various compounds such as biphenyl, benzonitrile, benzaldehyde, benzamide, benzoate, mandelate, salicylate, anthranilate, and tryptophan [21].
Figure 8.
Expression of the iacC and catA genes in P. xenovorans LB400 cells incubated with different carbon sources. The expression was measured by RT-PCR. (a) Expression of the iacC gene. (b) Expression of the catA gene. (c) Expression of the 16S rRNA gene (reference gene). MM, molecular markers (UltraRanger 1 kb DNA ladder); 1, negative control; resting cells with 2, IAA (1 mM); 3, IAA (1 mM) + glucose (5 mM); 4, glucose (5 mM); 5, cells grown on salicylate (5 mM) + glucose (5 mM).
2.3. Promotion of Nicotiana Tabacum Plant Growth by P. xenovorans LB400
The growth promotion of P. xenovorans LB400 on the plant N. tabacum was studied. Strain LB400 (107 CFU mL−1) was applied on two-week-old Nicotiana tabacum seedlings by inoculating the bacterium into the first root. Plant analyses were conducted two weeks after strain LB400 application (Figure 9). Inoculation with strain LB400 significantly increased both the number and length of roots in N. tabacum seedlings. Specifically, the root number per seedling increased from 14 roots in the water-treated group to 21 roots per seedling in the strain LB400-treated plants (Figure 9b). In addition, strain LB400-treated seedlings exhibited longer roots (3.5 cm) compared to the water-treated group (2.7 cm) (Figure 9c). However, strain LB400 did not affect the stem length (Figure 9c). The plant growth-promoting effect of P. xenovorans LB400 may be associated with its IAA synthesis. Tryptophan, a precursor for IAA synthesis, is released by seeds, seedlings, and roots, allowing PGPB to enhance plant growth [97,98]. The growth-promoting effect of strain LB400 may arise from IAA production, directly stimulating plant cell elongation. The ipdC gene knock-out mutants of Azospirillum brasilense SM and Bacillus thuringiensis RZ2MS9 showed reduced growth-promoting effects on sorghum seeds and maize [39,82].
Figure 9.
Growth promotion of P. xenovorans LB400 on Nicotiana tabacum seedlings. (a) Representative N. tabacum seedlings post-treatment with strain LB400 and water, respectively. (b) Effects of strain LB400 on the number of roots in N. tabacum. (c) Effects of strain LB400 on root and stem length in N. tabacum. Each value is a mean ± SD of 12 biologically independent replicates. Significant differences were analyzed by one-way ANOVA followed by the LSD Fisher test. Means with different letters indicate significant differences (p ≤ 0.05).
Plant growth-promotion by P. xenovorans strains has been reported [35,99]. Recently, the ability of strain LB400 to promote in vitro Arabidopsis thaliana growth has been described [58]. Other properties may be involved in plant growth-promotion by strain LB400, such as the nitrogen-fixing activity, ACC deaminase activity, the synthesis of siderophores, volatile organic compounds, extracellular polymeric substances, and polyhydroxyalcanoates (PHAs) [35,58,100,101,102]. The role of PHAs in plant–bacteria interactions is poorly understood; however, studies with the bacterium Herbaspirillum seropedicae suggest that PHAs metabolism favors the expression of traits that promote plant growth [103]. On the other hand, the presence of genes related to different types of stress in bacteria could be associated to a robust adaptive response [104,105,106]. The oxidative stress protection response improves the plant growth promotion activity of bacteria under abiotic stress conditions [107,108]. In addition to its capability to degrade an unusually wide range of pollutants and aromatic compounds [21,22,23,24,27,28,29,30,106], P. xenovorans LB400 possesses an extraordinaire oxidative stress response [25,31,106,109] and the capability to synthesize PHAs from different carbon sources [100,102,110]. Its plant growth promotion activities reported in this study increase the potential biotechnological applications of the versatile bacterium P. xenovorans LB400 and highlighted the importance of opening new doors for the characterization of the potential biotechnological and ecosystemic services of a specific native bacterial strain.
3. Materials and Methods
3.1. Bacterial Strains
In this study, the bacterial strains P. xenovorans LB400, a PCB-degrading bacterium that was isolated from PCB-polluted soil in New York State [21], and Ps. protegens CHA0, a plant growth-promoting bacterium capable of synthesizing IAA and isolated from tobacco roots in Switzerland [71,111], were used. These strains were obtained from the culture collections of the Molecular Microbiology and Environmental Biotechnology Laboratory, Universidad Técnica Federico Santa María, Valparaíso, Chile.
3.2. Bioinformatic Analysis
Genes related to IAA synthesis and degradation were searched in the LB400 genome. The protein amino acid sequences were obtained through the EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/; accessed on 15 September 2024) and NCBI (http://www.ncbi.nlm.nih.gov/; accessed on 15 September 2024) servers. The sequences found were used as a template in the bioinformatic analysis using the complete genome sequence of P. xenovorans LB400 (https://www.genome.jp/kegg-bin/show_organism?org=bxe; accessed on 15 September 2024). Using the NCBI BLAST tool, specifically blastp, for the alignment of amino acid sequences, ≥30% amino acid identity was used for the identification of proteins of strain LB400 [106].
3.3. Synthesis of IAA
For IAA synthesis, P. xenovorans LB400 was cultured at 30 °C in mineral M9 medium supplemented with a trace solution [27] and glucose (30 mM), and in the absence and presence of DL-tryptophan (10 mM), and LB medium containing DL-tryptophan (10 mM) at 30 °C and 180 rpm. Samples were taken at 0, 24, 48, and 72 h. Comparative IAA production assays were performed with P. xenovorans strain LB400 and Ps. protegens CHA0. Both strains were cultured in LB, KB, and YM media with the addition of DL-tryptophan (5 mM) at 30 °C and 180 rpm. To assess bacterial growth, colony-forming units (CFUs) were determined. Aliquots extracted from the cultures were appropriately diluted and plated on LB agar medium for strain LB400 and on KB agar medium for strain CHA0. The CFUs per milliliter values were calculated as the mean ± SD, based on at least three independent experiments. Aliquots of 1 mL were taken and stored at −30 °C until further analysis.
3.4. Degradation of IAA
For IAA degradation, P. xenovorans LB400 was cultured in LB liquid medium at 30 °C at 180 rpm for 12 h, reaching a turbidity at 600 nm > 1. An inoculum of this culture was added to M9 minimal medium in the presence of IAA (0.5, 1.5, and 3.0 mM) as the sole carbon and energy source, and incubated for 7 days (in triplicate). As a growth control, strain LB400 was grown in glucose (5 mM) (in triplicate). In a second assay, a co-culture with glucose (5 mM) and IAA (0.5 mM) was incubated for 7 days (in triplicate), comparing it with growth on glucose and IAA as sole carbon and energy sources. To accelerate the IAA degradation, P. xenovorans resting cells assays [27] were performed. A first preculture (20 mL) was carried out in M9 medium with glucose (5 mM), which was incubated at 30 °C at 180 rpm for 24 h. The next day, this preculture was used as inoculum for a 200 mL culture. This second culture was carried out in M9 medium with glucose (5 mM) and IAA (0.5 mM), incubating it at 30 °C at 180 rpm for 48 h. Then, this culture was washed twice with sodium phosphate buffer (5 mM; pH 7) and centrifuged at 3500× g for 15 min at 4 °C. The pellet was then resuspended in sodium phosphate buffer (5 mM; pH 7) in a final volume of 8 mL, reaching a turbidity (600 nm) of 8.0. In this assay, two controls were performed, one with dead cells (autoclaved culture, 121 °C for 30 min) and one without cells. Only IAA (0.5 mM) was added to these three treatments, and they were incubated at a temperature of 30 °C at 180 rpm for 36 h. Samples were taken at 0, 6, 12, 24, and 36 h. The assays were performed in triplicate. Aliquots of 600 µL were taken and stored at −30 °C until further analysis.
3.5. Quantification of IAA and AA
The aliquots taken from the synthesis and degradation assays were centrifugated at 19,283× g for 2 min at 4 °C and the resulting cell-free supernatants underwent analysis through reverse-phase chromatography. Therefore, a Jasco liquid chromatograph, equipped with a diode array detector and a Whatman C-18 reversed phase column (5 µm; 4.6 × 100 mm), was used. Quantification of IAA was conducted following the protocol outlined by Lee et al. [6] with some modifications. The aqueous mobile phase consisted of 70% acetic acid (1.1%) and 30% acetonitrile, with a flow rate at 1 mL min−1. IAA was monitored at wavelengths of 221 and 280 nm, and its retention time under these conditions was 3.1 min. Anthranilic acid (AA) was detected at 221 nm with a retention time of 2.6 min. For the quantification of both IAA (0 to 2.0 mM) and AA (0 to 2.0 mM), calibration curves using commercial authentic standards were performed.
3.6. Isolation of RNA and RT-PCR
Total RNA extractions from LB400 cells were performed using the RNeasy mini kit (Qiagen, Hilden, Germany), following the manufacturer’s guidelines. To eliminate any residual DNA, DNase I treatment was carried out using the RNase-Free DNase Set (Qiagen, Hilden, Germany). The concentration of RNA was quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Lafayette, LA, USA), and RNA integrity was verified through 1% agarose gel electrophoresis. For RT-PCR, 1000 ng of total RNA was transcribed using the Verso cDNA kit (Thermo Scientific, Lafayette, LA, USA) according to the manufacturer’s instructions. The subsequent PCR was performed with GoTaq Green Master Mix (Promega, Madison, WI, USA), utilizing sequence-specific primers designed in this study for the ipdC (Bxe_B0109), iaaH (Bxe_B1011), iacC (Bxe_A2105), and catA (Bxe_A2109) genes.
3.7. RT-PCR of Genes Associated to IAA Metabolism
For the study of IAA synthesis, ipdC and iaaH genes were analyzed. The RNA extractions were performed after 24 and 48 h of cultures of strain LB400 under the following conditions: (i) M9 medium + glucose (30 mM), (ii) M9 medium + glucose (30 mM) + tryptophan (10 mM), and (iii) LB medium + tryptophan (10 mM). The Bxe_B0109 gene (ipdC) was amplified using the primers IPDC-f and IPDC-r (Table 4), whereas the Bxe_B1011 gene (iaaH) was amplified using the primers IAAH-f and IAAH-r (Table 4).
Table 4.
Primers used in this study.
| Primer | Gene | Sequence (5′–3′) | Reference |
|---|---|---|---|
| IPDC-f | ipdC | CATCGTTGAAGCCCTTGCGT | This study |
| IPDC-r | TCGCCGATGAACAGCAAATGG | This study | |
| IAAH-f | iaaH | TTCGTGCCGAAGACCAATGC | This study |
| IAAH-r | TCGTAACGCTCGCCGAAGATA | This study | |
| IACC-f | iacC | AGCGGAACTCGAACGCATTT | This study |
| IACC-r | TCGCCGATGAACAGCAAATGG | This study | |
| CATA-f | catA | TTGCTCCAGAAGATCAACGA | This study |
| CATA-r | GAAATCGATCAACGCGAAAT | This study | |
| 27f | 16S rRNA | AGAGTTTGATCMTGGCTCAG | [27] |
| 1492r | TACGGYTACCTTGTTACGACTT | [27] |
For the study of the IAA degradation pathway, iacC and catA genes were analyzed. The RNA extractions were performed after 24 h of cultures of strain LB400 under the following conditions: (i) resting cells + IAA (1 mM), (ii) resting cells + IAA (1 mM) + glucose (5 mM), (iii) resting cells + glucose (5 mM), and (iv) cells grown in salicylate (5 mM) + glucose (5 mM). The Bxe_A2105 gene (iacC) was amplified using the primers IACC-f and IACC-r (Table 4) and the Bxe_A2109 gene (catA) was amplified using the primers CATA-f and CATA-r (Table 4).
The PCR program for the amplification of ipdC, iaaH, iacC, and catA was initial denaturation at 94 °C for 5 min, following 30 cycles of 94 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min, and with a final elongation at 72 °C for 7 min. Each PCR assay included negative controls, and reproducibility was assessed through at least two independent RT-PCR reactions for each condition. For the study of the IAA synthesis pathway, different amplification cycles (30, 25, 20, and 15) were used. The primers designed in this study were tested through amplification of LB400 genomic DNA (Figure S1). The amplification of the 16S rRNA gene was used as a control for DNA contamination (Figures S2 and S3) and gene expression (Figure 3 and Figure 8), with the primers 27f and 1492r [27]. The PCR program used was an initial denaturation at 94 °C for 5 min, following 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min, and with a final elongation at 72 °C for 7 min.
3.8. Nicotiana tabacum Growth-Promoting Assay
Nicotiana tabacum seeds were subjected to a sterilization process involving a brief immersion in 70% ethanol for 30 s, followed by exposure to 1% sodium hypochlorite for 10 min, and subsequently rinsed twice with sterile distilled water. The sterilized seeds were germinated on Murashige–Skoog (MS) agar plates [112], containing macro- and micronutrients, 3% sucrose, and 8.0 g L−1 agar, during a two-week period. The germination process occurred under a photoperiod of 14 h light and 10 h dark at a temperature of 25 °C. For the experimental setup, 15 cm test tubes were utilized, each containing MS agar slant (5 mL) to provide an ample surface for seedling growth. Two distinct treatments were implemented, one with sterile distilled water and the other with 107 CFU mL−1 of LB400 cells. In each tube (12 tubes per treatment), 100 µL of sterile distilled water or LB400 cells suspension was added. Nicotiana tabacum seedlings were then carefully inserted into the agar, and the tubes were sealed with parafilm. The experiment continued for two weeks under a photoperiod of 14 h light and 10 h dark at a temperature of 25 °C.
3.9. Statistical Analysis
In the assessment of IAA synthesis, AA synthesis, IAA degradation, and plant growth-promoting assays, the mean and standard deviation values were based on a minimum of three independent assays. Comparative analyses were subjected to one-way ANOVA. After the ANOVA analysis, significant differences (p ≤ 0.05) between treatments were further examined utilizing the LSD Fisher mean difference test.
4. Conclusions
This study indicates that P. xenovorans LB400 has functional pathways for the synthesis and degradation of the phytohormone IAA. Strain LB400 cultured with the precursor tryptophan and another carbon source synthesized IAA. Under these conditions, strain LB400 also presented the ability to synthesize and accumulate anthranilic acid. P. xenovorans LB400 expressed the ipdC gene that codes for the enzyme indole-3-pyruvate decarboxylase, suggesting the IPyA pathway for the biosynthesis of IAA, a route that has been described mainly for plant growth-promoting bacteria. P. xenovorans LB400 showed the capability to degrade IAA, and to use this substrate as the sole carbon and energy source for its growth. During the incubation in the presence of IAA, strain LB400 expressed the iacC gene, which encodes the α subunit of the key dioxygenase in the catabolism of IAA, suggesting that it uses a specific catabolic route. In addition, strain LB400 expressed the catA gene, which encodes catechol 1,2-dioxygenase, suggesting that the peripheral IAA catabolic pathway converges into the catechol central pathway. However, additional assays are required to confirm these IAA synthesis and degradation pathways. Notably, strain LB400 promoted growth of Nicotiana tabacum seedlings, which may be associated with its capability to synthesize IAA; therefore, this versatile bacterium has been classified as a PGPB.
Acknowledgments
Paulina Vega Celedón dedicated this article with love to the memory of Juan Osvaldo Vega Castañeda (1956–2015), who always inspired her to go beyond the limits.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13243533/s1, Figure S1: Functionality test of the primers designed in this study for the ipdC, iaaH, iacC, and catA genes; Figure S2: Amplification of 16S rRNA gene of IAA synthesis RNA samples for control of DNA contamination; Figure S3: Amplification of 16S rRNA gene of IAA degradation RNA samples for control of DNA contamination.
Author Contributions
P.V.-C., G.B., F.C., M.J.R.-S. and M.S. conceived and designed the experiments; P.V.-C., D.C.-N., G.B., F.C. and M.J.R.-S. performed the experiments; P.V.-C., G.B. and M.S. analyzed the data; M.S. contributed reagents, materials, and analysis tools; P.V.-C., M.S., D.C.-N. and G.B. wrote the paper. All authors have read and agreed to the published version of the manuscript.
Data Availability Statement
Data are contained within the article and Supplementary Materials.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This research was funded by PhD ANID, PUCV and USM fellowships (P.V.-C., D.C-N., G.B., F.C.), ANID-Milenio-NCN2023_054 (M.S., P.V.-C, D.C.-N., G.B.), ANID PIA Ring Genomics and Applied Microbiology for Bioremediation and Bioproducts (GAMBIO) ACT172128 Chile (M.S., P.V.-C., G.B.), Fondecyt 1070507, 1110992 and 1200756 (M.S., P.V.-C.), Fondequip EQM 170194 (M.S., G.B.), PIIC USM (P.V.-C., G.B.) and USM (M.S., P.V.-C., D.C.-N., G.B.) grants.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Babalola O. Beneficial bacteria of agricultural importance. Biotechnol. Lett. 2010;32:1559–1570. doi: 10.1007/s10529-010-0347-0. [DOI] [PubMed] [Google Scholar]
- 2.Vega-Celedón P., Bravo G., Velásquez A., Cid F.P., Valenzuela M., Ramírez I., Vasconez I.N., Álvarez I., Jorquera M.A., Seeger M. Microbial diversity of psychrotolerant bacteria isolated from wild flora of Andes Mountains and Patagonia of Chile towards the selection of plant growth-promoting bacterial consortia to alleviate cold stress in plants. Microorganisms. 2021;9:538. doi: 10.3390/microorganisms9030538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Khoso M., Wagan S., Alam I., Hussain A., Qurban A., Sudipta S., Poudel T., Manghwar H., Liu F. Impact of plant growth-promoting rhizobacteria (PGPR) on plant nutrition and root characteristics: Current perspective. Plant Stress. 2024;11:10034. doi: 10.1016/j.stress.2023.100341. [DOI] [Google Scholar]
- 4.Leveau J., Lindow S. Utilization of the plant hormone indole-3-acetic acid for growth by Pseudomonas putida strain 1290. Appl. Environ. Microbiol. 2005;71:2365–2371. doi: 10.1128/AEM.71.5.2365-2371.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Santner A., Calderon-Villalobos L., Estelle M. Plant hormones are versatile chemical regulators of plant growth. Nat. Chem. Biol. 2009;5:301–307. doi: 10.1038/nchembio.165. [DOI] [PubMed] [Google Scholar]
- 6.Lee S., Flores-Encarnación M., Contreras-Zentella M., Garcia-Flores L., Escamilla J., Kennedy C. Indole-3-acetic acid biosynthesis is deficient in Gluconacetobacter diazotrophicus strains with mutations in cytochrome c biogenesis genes. J. Bacteriol. 2004;186:5384–5391. doi: 10.1128/JB.186.16.5384-5391.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Shih-Feng F., Jyuan-Yu W., Hung-Wei C., Yen-Yu L., Hsueh-Yu L., Jui-Yu C. Indole-3-acetic acid: A widespread physiological code in interactions of fungi with other organisms. Plant Signal Behav. 2015;10:e1048052. doi: 10.1080/15592324.2015.1048052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Patten C.L., Glick B.R. Regulation of indoleacetic acid production in Pseudomonas putida GR12-2 by tryptophan and the stationary-phase sigma factor RpoS. Can. J. Microbiol. 2002;48:635–642. doi: 10.1139/w02-053. [DOI] [PubMed] [Google Scholar]
- 9.Tang J., Li Y., Zhang L., Mu J., Jiang Y., Fu H., Zhang Y., Cui H., Yu X., Ye Z. Biosynthetic pathways and functions of indole-3-acetic acid in microorganisms. Microorganisms. 2023;11:2077. doi: 10.3390/microorganisms11082077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Spaepen S., Vanderleyden J. Auxin and plant-microbe interactions. CSH Perspect. Biol. 2011;3:a001438. doi: 10.1101/cshperspect.a001438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Vega-Celedón P., Martínez H., Vergara M., Seeger M. Biosíntesis de ácido indol-3-acético y promoción del crecimiento de plantas por bacterias. Cultiv. Trop. 2016;37:33–39. [Google Scholar]
- 12.Zhang P., Jin T., Kumar S., Xu J., Shi Q., Liu H., Wang Y. The distribution of tryptophan-dependent indole-3-acetic acid synthesis pathways in bacteria unraveled by large-scale genomic analysis. Molecules. 2019;24:1411. doi: 10.3390/molecules24071411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Balderas-Hernández V.E., Sabido-Ramos A., Silva P., Cabrera-Valladares N., Hernández-Chávez G., Báez-Viveros J.L., Martínez A., Bolívar F., Gosset G. Metabolic engineering for improving anthranilate synthesis from glucose in Escherichia coli. Microb. Cell Fact. 2009;8:19. doi: 10.1186/1475-2859-8-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hernández-Mendoza J., Moreno-Medina V., Quiroz-Velásquez J., García-Olivares J., Mayek-Pérez N. Efecto de diferentes concentraciones de ácido antranílico en el crecimiento del maíz. Rev. Colomb. Biotecnol. 2010;12:57–63. [Google Scholar]
- 15.Aoki Y., Yoshida Y., Yoshida M., Kawaide H., Abe H., Natsume M. Anthranilic acid, a spore germination inhibitor of phytopathogenic Streptomyces sp. B-9-1 causing root tumor of melon. Actinomycetologica. 2005;19:48–54. doi: 10.3209/saj.19.48. [DOI] [Google Scholar]
- 16.Leveau J., Gerards S. Discovery of a bacterial gene cluster for catabolism of the plant hormone indole 3-acetic acid. FEMS Microbiol. Ecol. 2008;65:238–250. doi: 10.1111/j.1574-6941.2008.00436.x. [DOI] [PubMed] [Google Scholar]
- 17.Donoso R., Leiva-Novoa P., Zúñiga A., Timmermann T., Recabarren-Gajardo G., González B. Biochemical and genetic bases of indole-3-acetic acid (auxin phytohormone) degradation by the plant- growth-promoting rhizobacterium Paraburkholderia phytofirmans PsJN. Appl. Environ. Microbiol. 2017;83:e01991-16. doi: 10.1128/AEM.01991-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Laird T.S., Flores N., Leveau J.H.J. Bacterial catabolism of indole-3-acetic acid. Appl. Microbiol. Biotechnol. 2020;104:9535–9550. doi: 10.1007/s00253-020-10938-9. [DOI] [PubMed] [Google Scholar]
- 19.Pal G., Saxena S., Kumar K., Verma A., Sahu P.K., Pandey A., White J.F., Verma S.K. Endophytic Burkholderia: Multifunctional roles in plant growth promotion and stress tolerance. Microbiol. Res. 2022;265:127201. doi: 10.1016/j.micres.2022.127201. [DOI] [PubMed] [Google Scholar]
- 20.Bellés-Sancho P., Liu Y., Heiniger B., von Salis E., Eberl L., Ahrens C.H., Zamboni N., Bailly A., Pessi G. A novel function of the key nitrogen-fixation activator NifA in beta-rhizobia: Repression of bacterial auxin synthesis during symbiosis. Front. Plant Sci. 2022;13:991548. doi: 10.3389/fpls.2022.991548. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chain P., Denef V., Konstantinidis K., Vergez L., Agulló L., Latorre V., Hauseri L., Córdova M., Gómez L., González M., et al. Burkholderia xenovorans LB400 harbors a multi-replicon, 9.73-Mbp genome shaped for versatility. Proc. Natl. Acad. Sci. USA. 2006;103:15280–15287. doi: 10.1073/pnas.0606924103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Seeger M., Zielinski M., Timmis K., Hofer B. Regiospecificity of dioxygenation of di-to pentachlorobiphenyls and their degradation to chlorobenzoates by the bph-encoded catabolic pathway of Burkholderia sp. strain LB400. Appl. Environ. Microbiol. 1999;65:3614–3621. doi: 10.1128/AEM.65.8.3614-3621.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Seeger M., Cámara B., Hofer B. Dehalogenation, denitration, dehydroxylation, and angular attack on substituted biphenyls and related compounds by a biphenyl dioxygenase. J. Bacteriol. 2001;183:3548–3555. doi: 10.1128/JB.183.12.3548-3555.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Seeger M., González M., Cámara B., Muñoz L., Ponce E., Mejías L., Macayano C., Vásquez Y., Sepúlveda-Boza S. Biotransformation of natural and synthetic isoflavonoids by two recombinant microbial enzymes. Appl. Environ. Microbiol. 2003;69:5045–5050. doi: 10.1128/AEM.69.9.5045-5050.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Agulló L., Cámara B., Martínez P., Latorre V., Seeger M. Response to (chloro)biphenyls of the polychlorobiphenyl-degrader Burkholderia xenovorans LB400 involves stress proteins also induced by heat shock and oxidative stress. Microbiol. Lett. 2007;267:167–175. doi: 10.1111/j.1574-6968.2006.00554.x. [DOI] [PubMed] [Google Scholar]
- 26.Martínez P., Agulló L., Hernández M., Seeger M. Chlorobenzoate inhibits growth and induces stress proteins in the PCB-degrading bacterium Burkholderia xenovorans LB400. Arch. Microbiol. 2007;188:289–297. doi: 10.1007/s00203-007-0247-4. [DOI] [PubMed] [Google Scholar]
- 27.Méndez V., Agulló L., González M., Seeger M. The homogentisate and homoprotocatechuate central pathways are involved in 3- and 4-hydroxyphenylacetate degradation by Burkholderia xenovorans LB400. PLoS ONE. 2011;6:e17583. doi: 10.1371/journal.pone.0017583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ponce B., Latorre V., González M., Seeger M. Antioxidant compounds improved PCB-degradation by Burkholderia xenovorans strain LB400. Enzyme Microb. Technol. 2011;49:509–516. doi: 10.1016/j.enzmictec.2011.04.021. [DOI] [PubMed] [Google Scholar]
- 29.Romero-Silva M.J., Méndez V., Agulló L., Seeger M. Genomic and functional analyses of the gentisate and protocatechuate ring-cleavage pathways and related 3-hydroxybenzoate and 4-hydroxybenzoate peripheral pathways in Burkholderia xenovorans LB400. PLoS ONE. 2013;8:e56038. doi: 10.1371/journal.pone.0056038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Agulló L., Romero-Silva M.J., Domenech M., Seeger M. p-Cymene promotes its catabolism through the p-cymene and the p-cumate pathways, activates a stress response and reduces the biofilm formation in Burkholderia xenovorans LB400. PLoS ONE. 2017;12:e0169544. doi: 10.1371/journal.pone.0169544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rodríguez-Castro L., Durán R.E., Méndez V., Dorochesi F., Zühlke D., Riedel K., Seeger M. The long-chain flavodoxin FldX1 improves the biodegradation of 4-hydroxyphenylacetate and 3-hydroxyphenylacetate and counteracts the oxidative stress associated to aromatic catabolism in Paraburkholderia xenovorans. Biol. Res. 2024;57:12. doi: 10.1186/s40659-024-00491-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Goris J., De Vos P., Caballero-Mellado J., Park J., Falsen W., Quensen J.F., Tiedje J., Vandamme P. Classification of the biphenyl- and polychlorinated biphenyl-degrading strain LB400T and relatives as Burkholderia xenovorans sp. nov. Int. J. Syst. Ecol. Microbiol. 2004;54:1677–1681. doi: 10.1099/ijs.0.63101-0. [DOI] [PubMed] [Google Scholar]
- 33.Estrada-de Los Santos P., Bustillos-Cristales R., Caballero-Mellado J. Burkholderia, a genus rich in plant-associated nitrogen fixers with wide environmental and geographic distribution. Appl. Environ. Microbiol. 2001;67:2790–2798. doi: 10.1128/AEM.67.6.2790-2798.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Salles J.F., van Veen J.A., van Elsas J.D. Multivariate analyses of Burkholderia species in soil: Effect of crop and land use history. Appl. Environ. Microbiol. 2004;70:4012–4020. doi: 10.1128/AEM.70.7.4012-4020.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Caballero-Mellado J., Onofre-Lemus J., Estrada-de Los Santos P., Martínez-Aguilar L. The tomato rhizosphere, an environment rich in nitrogen-fixing Burkholderia species with capabilities of interest for agriculture and bioremediation. Appl. Environ. Microbiol. 2007;73:5308–5319. doi: 10.1128/AEM.00324-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Schütz A., Sandalova T., Ricagno S., Hübner G., König S., Schneider G. Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid. Eur. J. Biochem. 2003;270:2312–2321. doi: 10.1046/j.1432-1033.2003.03601.x. [DOI] [PubMed] [Google Scholar]
- 37.Basse C.W., Lottspeich F., Steglich W., Kahmann R. Two potential indole-3-acetaldehyde dehydrogenases in the phytopathogenic fungus Ustilago maydis. Eur. J. Biochem. 1996;242:648–656. doi: 10.1111/j.1432-1033.1996.0648r.x. [DOI] [PubMed] [Google Scholar]
- 38.Vande A., Gysegom P., Ona O., Hendrickx N., Prinsen E., Van Impe J., Vanderleyden J. Transcriptional analysis of the Azospirillum brasilense indole-3-pyruvate decarboxylase gene and identification of a cis-acting sequence involved in auxin responsive expression. Mol. Plant Microbe Interact. 2005;4:311–323. doi: 10.1094/MPMI-18-0311. [DOI] [PubMed] [Google Scholar]
- 39.Malhotra M., Srivastava S. An ipdC gene knock-out of Azospirillum brasilense strain SM and its implications on indole-3-acetic acid biosynthesis and plant growth promotion. Antonie Leeuwenhoek. 2008;93:425–433. doi: 10.1007/s10482-007-9207-x. [DOI] [PubMed] [Google Scholar]
- 40.Phi Q.T., Park Y.M., Ryu C.M., Park S.H., Ghim S.Y. Functional identification and expression of indole-3-pyruvate decarboxylase from Paenibacillus polymyxa E681. J. Microbiol. Biotechnol. 2008;18:1235–1244. [PubMed] [Google Scholar]
- 41.Ryu R.J., Patten C.L. Aromatic amino acid-dependent expression of indole-3-pyruvate decarboxylase is regulated by TyrR in Enterobacter cloacae UW5. J. Bacteriol. 2008;190:7200–7208. doi: 10.1128/JB.00804-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lin H., Shu H., Lin G.H. Biological roles of indole-3-acetic acid in Acinetobacter baumannii. Microbiol. Res. 2018;216:30–39. doi: 10.1016/j.micres.2018.08.004. [DOI] [PubMed] [Google Scholar]
- 43.Romasi E.F., Lee J. Development of indole-3-acetic acid-producing Escherichia coli by functional expression of IpdC, AspC, and Iad1. Microb. Biotechnol. 2013;23:1726–1736. doi: 10.4014/jmb.1308.08082. [DOI] [PubMed] [Google Scholar]
- 44.Zeng Q., Xie J., Li Y., Gao T., Xu C., Wang Q. Comparative genomic and functional analyses of four sequenced Bacillus cereus genomes reveal conservation of genes relevant to plant-growth-promoting traits. Sci. Rep. 2018;8:17009. doi: 10.1038/s41598-018-35300-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ali M.A., Lou Y., Hafeez R., Li X., Hossain A., Xie T., Lin L., Li B., Yin Y., Yan J., et al. Functional analysis and genome mining reveal high potential of biocontrol and plant growth promotion in nodule-inhabiting bacteria within Paenibacillus polymyxa complex. Front. Microbiol. 2021;11:618601. doi: 10.3389/fmicb.2020.618601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Shah G., Fiaz S., Attia K.A., Khan N., Jamil M., Abbas A., Yang S.H., Jumin T. Indole pyruvate decarboxylase gene regulates the auxin synthesis pathway in rice by interacting with the indole-3-acetic acid–amido synthetase gene, promoting root hair development under cadmium stress. Front. Plant Sci. 2022;13:1023723. doi: 10.3389/fpls.2022.1023723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhang B., Li P.S., Wang Y.Y., Wang J.J., Liu X.L., Wang X.Y., Hu X.M. Characterization and synthesis of indole-3-acetic acid in plant growth promoting Enterobacter sp. RSC Adv. 2021;11:31601–31607. doi: 10.1039/D1RA05659J. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.de Los Ríos S., Perona J.J. Structure of the Escherichia coli leucine-responsive regulatory protein Lrp reveals a novel octameric assembly. J. Mol. Biol. 2007;366:1589–1602. doi: 10.1016/j.jmb.2006.12.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Brinkman A., Ettema T., de Vos W., Van der Oost J. The Lrp family of transcriptional regulators. Mol. Microbiol. 2003;48:287–294. doi: 10.1046/j.1365-2958.2003.03442.x. [DOI] [PubMed] [Google Scholar]
- 50.Cui Y., Wang Q., Stormo G.D., Calvo J.M. A consensus sequence for binding of Lrp to DNA. J. Bacteriol. 1995;177:4872–4880. doi: 10.1128/jb.177.17.4872-4880.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Otten L., Salomone J.Y., Helfer A., Schmidt J., Hammann P., De Ruffray P. Sequence and functional analysis of the left-hand part of the T-region from the nopaline-type Ti plasmid, pTiC58. Plant Mol. Biol. 1999;41:765–776. doi: 10.1023/A:1006370207379. [DOI] [PubMed] [Google Scholar]
- 52.Rodríguez-Palenzuela P., Matas I.M., Murillo J., López-Solanilla E., Bardaji L., Pérez-Martínez I., Rodriguez-Moskera M., Penyalver R., López M., Quesada J., et al. Annotation and overview of the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 draft genome reveals the virulence gene complement of a tumour-inducing pathogen of woody hosts. Environ. Microbiol. 2010;12:1604–1620. doi: 10.1111/j.1462-2920.2010.02207.x. [DOI] [PubMed] [Google Scholar]
- 53.Fagen J.R., Leonard M.T., McCullough C.M., Edirisinghe J.N., Henry C.S., Davis M.J., Triplett E.W. Comparative genomics of cultured and uncultured strains suggests genes essential for free-living growth of Liberibacter. PLoS ONE. 2014;9:e84469. doi: 10.1371/journal.pone.0084469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Glasner J.D., Yang C.H., Reverchon S., Hugouvieux-Cotte-Pattat N., Condemine G., Bohin J.P., Van Gijsegem F., Yang S., Franza T., Expert D., et al. Genome sequence of the plant-pathogenic bacterium Dickeya dadantii 3937. J. Bacteriol. 2011;193:2076–2077. doi: 10.1128/JB.01513-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zhang Y., Lee C.W., Wehner N., Imdahl F., Svetlana V., Weiste C., Imdahl F., Svetlana V., Weiste C., Dröge-Laser W., et al. Regulation of oncogene expression in T-DNA-transformed host plant cells. PLoS Pathog. 2015;11:e1004620. doi: 10.1371/journal.ppat.1004620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Hooykaas P.J.J., Beijersbergen A.G.M. The virulence system of Agrobacterium tumefaciens. Ann. Rev. Phytopathol. 1994;32:157–179. doi: 10.1146/annurev.py.32.090194.001105. [DOI] [Google Scholar]
- 57.Khianngam S., Meetum P., Chiangmai P.N., Tanasupawat S. Identification and optimisation of indole-3-acetic acid production of endophytic bacteria and their effects on plant growth. Trop. Life Sci. Res. 2023;34:219–239. doi: 10.21315/tlsr2023.34.1.12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Ghitti E., Rolli E., Vergani L., Borin S. Flavonoids influence key rhizocompetence traits for early root colonization and PCB degradation potential of Paraburkholderia xenovorans LB400. Front. Plant Sci. 2024;15:1325048. doi: 10.3389/fpls.2024.1325048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Basu P.S., Ghosh A. Production of indole acetic acid in culture by a Rhizobium species from the root nodules of a monocotyledonous tree, Roystonea regia. Acta Biotechnol. 2001;21:65–72. doi: 10.1002/1521-3846(200102)21:1<65::AID-ABIO65>3.0.CO;2-#. [DOI] [Google Scholar]
- 60.Datta C., Basu P.S. Indole acetic acid production by a Rhizobium species from root nodules of a leguminous shrub, Cajanus cajan. Microbiol. Res. 2000;155:123–127. doi: 10.1016/S0944-5013(00)80047-6. [DOI] [PubMed] [Google Scholar]
- 61.Mohite B. Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth. J. Soil Sci. Plant Nutr. 2013;13:638–649. doi: 10.4067/S0718-95162013005000051. [DOI] [Google Scholar]
- 62.Özdal M., Özdal Z.G., Sezen A., Algur M.F. Biosynthesis of indole-3-acetic acid by Bacillus cereus immobilized cells. Cumhur. Sci. J. 2016;37:212. doi: 10.17776/csj.34085. [DOI] [Google Scholar]
- 63.Boondaeng A., Vaithanomsat P., Apiwatanapiwat W., Trakunjae C., Janchai P., Suriyachai N., Kreetachat T., Wongcharee S., Imman S. Biological conversion of agricultural wastes into indole-3-acetic acid by Streptomyces lavenduligriseus BS50-1 using a response surface methodology (RSM) ACS Omega. 2023;8:40433–40441. doi: 10.1021/acsomega.3c05004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Hernández-Mendoza J., Quiroz-Velásquez J., Moreno-Medina V., Mayek-Pérez N. Biosynthesis of anthranilic and indolacetic acids from tryptophan by one Azospirillum brasilense strain native from Tamaulipas, México. Rev. Investig. Agropecu. 2008;12:57–67. [Google Scholar]
- 65.Apine O., Jadhav J. Optimization of medium for indole-3-acetic acid production using Pantoea agglomerans strain PVM. J. Appl. Microbiol. 2011;110:1235–1244. doi: 10.1111/j.1365-2672.2011.04976.x. [DOI] [PubMed] [Google Scholar]
- 66.Forni C., Riov J., Grilli M., Tel-Or E. Indole-3-acetic acid (IAA) production by Arthrobacter species isolated from Azolla. J. Gen. Microbiol. 1992;138:377–881. doi: 10.1099/00221287-138-2-377. [DOI] [PubMed] [Google Scholar]
- 67.Ona O., Impe J., Prinsen E., Vanderleyden J. Growth and indole-3-acetic acid biosynthesis of Azospirillum brasilense Sp245 is environmentally controlled. Microbiol. Lett. 2005;246:125–132. doi: 10.1016/j.femsle.2005.03.048. [DOI] [PubMed] [Google Scholar]
- 68.Liu W.H., Chen F.F., Wang C.E., Fu H.H., Fang X.Q., Ye J.R., Shi J.R. Indole-3-acetic acid in Burkholderia pyrrocinia JK-SH007: Enzymatic identification of the indole-3-acetamide synthesis pathway. Front. Microbiol. 2019;10:2559. doi: 10.3389/fmicb.2019.02559. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Duca D.R., Glick B.R. Indole-3-acetic acid biosynthesis and its regulation in plant-associated bacteria. Appl. Microbiol. Biotechnol. 2020;104:8607–8619. doi: 10.1007/s00253-020-10869-5. [DOI] [PubMed] [Google Scholar]
- 70.Yusfi L.A., Tjong D.H., Chaniago I., Salsabilla A., Jamsari J. Growth phase influence the gene expression and metabolite production related to indole-3-acetic acid (IAA) biosynthesis by Serratia plymuthica UBCF_13. Pak. J. Biol. Sci. 2022;25:1047–1057. doi: 10.3923/pjbs.2022.1047.1057. [DOI] [PubMed] [Google Scholar]
- 71.Oberhänsli T., Défago G., Haas D. Indole-3-acetic acid (IAA) synthesis in the biocontrol strain CHA0 of Pseudomonas fluorescens: Role of tryptophan side chain oxidase. J. Gen. Microbiol. 1991;137:2273–2279. doi: 10.1099/00221287-137-10-2273. [DOI] [PubMed] [Google Scholar]
- 72.Sambrook J., Fritsch E.F., Maniatis T. Molecular Cloning: A Laboratory Mannual. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY, USA: 1989. [Google Scholar]
- 73.King E.O., Ward M.K., Raney D.E. Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 1954;44:301–307. [PubMed] [Google Scholar]
- 74.González S.A.C., Rodríguez G., Lizarazo-Ortega C., Cano E., Sánchez-Yáñez J., Hernández-Jiménez M.C., Hernández-Mendoza J.L. Study of Indole 3 acetic acid biosynthesis pathways in Bradyrhizobium japonicum BJBV-05. Interciencia. 2021;46:198–203. [Google Scholar]
- 75.Farrow J.M., III, Pesci E.C. Two distinct pathways supply anthranilate as a precursor of the Pseudomonas quinolone signal. J. Bacteriol. 2007;189:3425–3433. doi: 10.1128/JB.00209-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Yanofsky C. Attenuation in the control of expression of bacterial operons. Nature. 1981;289:751–758. doi: 10.1038/289751a0. [DOI] [PubMed] [Google Scholar]
- 77.Merino E., Jensen R.A., Yanofsky C. Evolution of bacterial trp operons and their regulation. Curr. Opin. Microbiol. 2008;11:78–86. doi: 10.1016/j.mib.2008.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Ma Z., Qu Y. Biodegradation and biotransformation of indole: Advances and perspectives. Front. Microbiol. 2018;9:2625. doi: 10.3389/fmicb.2018.02625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Zimmer W., Wesche M., Timmermans L. Identification and isolation of the indole-3-pyruvate decarboxylase gene from Azospirillum brasilense Sp7: Sequencing and functional analysis of the gene locus. Curr. Microbiol. 1998;36:327–331. doi: 10.1007/s002849900317. [DOI] [PubMed] [Google Scholar]
- 80.Rothballer M., Schmid M., Fekete A., Hartmann A. Comparative in situ analysis of ipdC-gfpmut3 promoter fusions of Azospirillum brasilense strains Sp7 and Sp245. Environ. Microbiol. 2005;7:1839–1846. doi: 10.1111/j.1462-2920.2005.00848.x. [DOI] [PubMed] [Google Scholar]
- 81.Parsons C.V., Harris D.M., Patten C.L. Regulation of indole-3-acetic acid biosynthesis by branched-chain amino acids in Enterobacter cloacae UW5. Microbiol. Lett. 2015;362:fnv153. doi: 10.1093/femsle/fnv153. [DOI] [PubMed] [Google Scholar]
- 82.Figueredo E.F., Da Cruz T.A., De Almeida J.R., Batista B.D., Marcon J., De Andrade P.M., De Almeida Hayashibara C.A., Rosa M.S., Azevedo J.L., Quecine M.C. The key role of indole-3-acetic acid biosynthesis by Bacillus thuringiensis RZ2MS9 in promoting maize growth revealed by the ipdC gene knockout mediated by the CRISPR-Cas9 system. Microbiol. Res. 2023;266:127218. doi: 10.1016/j.micres.2022.127218. [DOI] [PubMed] [Google Scholar]
- 83.Brandl M.T., Lindow S.E. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola. Appl. Environ. Microbiol. 1996;62:4121–4128. doi: 10.1128/aem.62.11.4121-4128.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Rico-Jiménez M., Muñoz-Mira S., Lomas-Martínez C., Krell T., Matilla M.A. Regulation of indole-3-acetic acid biosynthesis and consequences of auxin production deficiency in Serratia plymuthica. Microb. Biotechnol. 2023;16:1671–1689. doi: 10.1111/1751-7915.14296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Ulmasov T., Liu Z.-B., Hagen G., Guilfoyle T.J. Composite structure of auxin response elements. Plant Cell. 1995;7:1611–1623. doi: 10.1105/tpc.7.10.1611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Vande Broek A., Lambrecht M., Eggermont K., Vanderleyden J. Auxins upregulate expression of the indole-3-pyruvate decarboxylase gene in Azospirillum brasilense. J. Bacteriol. 1999;181:1338–1342. doi: 10.1128/JB.181.4.1338-1342.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Pérez-Pantoja D., Donoso R., Agulló L., Córdova M., Seeger M., Pieper D.H., González B. Genomic analysis of the potential for aromatic compounds biodegradation in Burkholderiales. Environ. Microbiol. 2012;14:1091–1117. doi: 10.1111/j.1462-2920.2011.02613.x. [DOI] [PubMed] [Google Scholar]
- 88.Honeyfield D.C., Carlson J.R. Effect of indoleacetic acid and related indoles on Lactobacillus sp. strain 11201 growth, indoleacetic acid catabolism, and 3-methylindole formation. Appl. Environ. Microbiol. 1990;56:1373–1377. doi: 10.1128/aem.56.5.1373-1377.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Sun P.F., Fang W.T., Shin L.Y., Wei J.Y., Fu S.F., Chou J.Y. Indole-3-acetic acid-producing yeasts in the phyllosphere of the carnivorous plant Drosera indica L. PLoS ONE. 2014;9:e114196. doi: 10.1371/journal.pone.0114196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Luo K., Rocheleau H., Qi P.F., Zheng Y.L., Zhao H.Y., Ouellet T. Indole-3-acetic acid in Fusarium graminearum: Identification of biosynthetic pathways and characterization of physiological effects. Fungal Biol. 2016;120:1135–1145. doi: 10.1016/j.funbio.2016.06.002. [DOI] [PubMed] [Google Scholar]
- 91.Honeyfield D.C., Carlson J.R. Assay for the enzymatic conversion of indoleacetic acid to 3-methylindole in a ruminal Lactobacillus species. Appl. Environ. Microbiol. 1990;56:724–729. doi: 10.1128/aem.56.3.724-729.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Liu D., Wei Y., Liu X., Zhou Y., Jiang L., Yin J., Wang F., Hu Y., Nanjaraj Urs A.N., Liu Y., et al. Indoleacetate decarboxylase is a glycyl radical enzyme catalysing the formation of malodorant skatole. Nat. Commun. 2018;9:4224. doi: 10.1038/s41467-018-06627-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Cámara B., Herrera C., González M., Couve E., Hofer B., Seeger M. From PCBs to highly toxic metabolites by the biphenyl pathway. Environ. Microbiol. 2004;6:842–850. doi: 10.1111/j.1462-2920.2004.00630.x. [DOI] [PubMed] [Google Scholar]
- 94.Lin G.H., Chen H.P., Huang J.H., Liu T.T., Lin T.K., Wang S.J., Tseng C.H., Shu H.Y. Identification and characterization of an indigo-producing oxygenase involved in indole 3-acetic acid utilization by Acinetobacter baumannii. Antonie Leeuwenhoek. 2012;101:881–890. doi: 10.1007/s10482-012-9704-4. [DOI] [PubMed] [Google Scholar]
- 95.Greenhut I.V., Slezak B.L., Leveau J.H.J. Iac gene expression in the indole-3-acetic acid-degrading soil bacterium Enterobacter soli LF7. Appl. Environ. Microbiol. 2018;84:e01057-18. doi: 10.1128/AEM.01057-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Sadauskas M., Statkevičiūtė R., Vaitekūnas J., Meškys R. Bioconversion of biologically active indole derivatives with indole-3-acetic acid-degrading enzymes from Caballeronia glathei DSM50014. Biomolecules. 2020;10:663. doi: 10.3390/biom10040663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Jaeger C.H., III, Lindow S.E., Miller W., Clark E., Firestone M.K. Mapping of sugar and amino acid availability in soil around roots with bacterial sensors of sucrose and tryptophan. Appl. Environ. Microbiol. 1999;65:2685–2690. doi: 10.1128/AEM.65.6.2685-2690.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Kamilova F., Kravchenko L., Shaposhnikov A., Azarova T., Makarova N., Lugtenberg B. Organic acids, sugars, and L-tryptophan in exudates of vegetables growing on stonewool and their effects on activities of rhizosphere bacteria. Mol. Plant Microbe Interact. 2006;19:250–256. doi: 10.1094/MPMI-19-0250. [DOI] [PubMed] [Google Scholar]
- 99.Suárez-Moreno Z., Devescovi G., Myers M., Hallack L., Mendonca-Previato L., Caballero-Mellado J., Venturi V. Commonalities and differences in regulation of N-acyl homoserine lactone quorum sensing in the beneficial plant-associated Burkholderia species cluster. Appl. Environ. Microbiol. 2010;76:4302–4317. doi: 10.1128/AEM.03086-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Urtuvia V., Villegas P., González M., Seeger M. Bacterial production of the biodegradable plastics polyhydroxyalkanoates. Int. J. Biol. Macromol. 2014;70:208–213. doi: 10.1016/j.ijbiomac.2014.06.001. [DOI] [PubMed] [Google Scholar]
- 101.Vargas-Straube M.J., Cámara B., Tello M., Montero-Silva F., Cárdenas F., Seeger M. Genetic and functional analysis of the biosynthesis of a non-ribosomal peptide siderophore in Burkholderia xenovorans LB400. PLoS ONE. 2016;11:e0151273. doi: 10.1371/journal.pone.0151273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Urtuvia V., Villegas P., Fuentes S., González M., Seeger M. Burkholderia xenovorans LB400 possesses a functional polyhydroxyalkanoate anabolic pathway encoded by the pha genes and synthesizes poly(3-hydroxybutyrate) under nitrogen-limiting conditions. Int. Microbiol. 2018;21:47–57. doi: 10.1007/s10123-018-0004-3. [DOI] [PubMed] [Google Scholar]
- 103.Silveira L.P.A., Amaral F.P.D., Kim D., Bom M.T., Gavídia M.P., Teixeira C.S., Holthman F., De Oliveira Pedrosa F., De Souza E.M., Chubatsu L.S., et al. Importance of poly-3-hydroxybutyrate metabolism to the ability of Herbaspirillum seropedicae to promote plant growth. Appl. Environ. Microbiol. 2019;85:e02586-18. doi: 10.1128/AEM.02586-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Ito F., Tamiya T., Ohtsu I., Fujimura M., Fukumori F. Genetic and phenotypic characterization of the heat shock response in Pseudomonas putida. Microbiologyopen. 2014;3:922–936. doi: 10.1002/mbo3.217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Durán R.E., Barra-Sanhueza B., Salvà-Serra F., Méndez V., Jaén-Luchoro D., Moore E.R.B., Seeger M. Complete genome sequence of the marine hydrocarbon degrader Alcaligenes aquatilis QD168, isolated from crude oil-polluted sediment of Quintero Bay, Central Chile. Microbiol. Resour. Announc. 2019;8:e01664-18. doi: 10.1128/MRA.01664-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Méndez V., Rodríguez-Castro L., Durán R.E., Padrón G., Seeger M. The OxyR and SoxR transcriptional regulators are involved in a broad oxidative stress response in Paraburkholderia xenovorans LB400. Biol. Res. 2022;55:7. doi: 10.1186/s40659-022-00373-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107.González-Reguero D., Robas-Mora M., Probanza A., Jiménez P.A. Evaluation of the oxidative stress alleviation in Lupinus albus var. orden Dorado by the inoculation of four plant growth-promoting bacteria and their mixtures in mercury-polluted soils. Front. Microbiol. 2022;13:907557. doi: 10.3389/fmicb.2022.907557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108.Robas M., Fernández V.M., González D., Gutiérrez L.L., Probanza A., Jiménez P.A. Oxidative stress protection and growth promotion activity of Pseudomonas mercuritolerans sp. nov., in forage plants under mercury abiotic stress conditions. Front. Microbiol. 2022;13:1032901. doi: 10.3389/fmicb.2022.1032901. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Rodríguez-Castro L., Méndez V., Durán R.E., Seeger M. Long-chain flavodoxin FldX1 improves Paraburkholderia xenovorans LB400 tolerance to oxidative stress caused by paraquat and H2O2. PLoS ONE. 2019;14:e0221881. doi: 10.1371/journal.pone.0221881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.Alvarez-Santullano N., Villegas P., Sepúlveda Mardones M., Durán R.E., Donoso R., González A., Sanhueza C., Navia R., Acevedo F., Pérez-Pantoja D., et al. Genome-wide metabolic reconstruction of the synthesis of polyhydroxyalkanoates from sugars and fatty acids by Burkholderia sensu lato species. Microorganisms. 2021;9:1290. doi: 10.3390/microorganisms9061290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 111.Jousset A., Schuldes J., Keel C., Maurhofer M., Daniel R., Scheu S., Thuermer A. Full-genome sequence of the plant growth-promoting bacterium Pseudomonas protegens CHA0. Genome Announc. 2014;2:e00322-14. doi: 10.1128/genomeA.00322-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Murashige T., Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962;15:473–497. doi: 10.1111/j.1399-3054.1962.tb08052.x. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are contained within the article and Supplementary Materials.









