DNA Barcode, chemical analysis, and antioxidant activity of Psidium guineense from Ecuador

Joel Eduardo Vielma-Puente; Efrén Santos-Ordóñez; Xavier Cornejo; Iván Chóez-Guaranda; Ricardo Pacheco-Coello; Liliana Villao-Uzho; Christian Moreno-Alvarado; Natalia Mendoza-Samaniego; Yuraima Fonseca

doi:10.1371/journal.pone.0319524

. 2025 Mar 19;20(3):e0319524. doi: 10.1371/journal.pone.0319524

DNA Barcode, chemical analysis, and antioxidant activity of Psidium guineense from Ecuador

Joel Eduardo Vielma-Puente ^1,^*,^#, Efrén Santos-Ordóñez ^2,^3,^#, Xavier Cornejo ^4,^‡, Iván Chóez-Guaranda ^2,^‡, Ricardo Pacheco-Coello ^2,^‡, Liliana Villao-Uzho ^2,^‡, Christian Moreno-Alvarado ^1,^‡, Natalia Mendoza-Samaniego ^1,^‡, Yuraima Fonseca ^5,^‡

Editor: Hope Onohuean⁶

PMCID: PMC11922285 PMID: 40106513

Abstract

This study investigates the phytochemical, genetic, and antioxidant properties of Psidium guineense, a species native to the tropical dry forests of Ecuador. Leaves were collected, preserved in recognized herbaria, and subjected to Soxhlet extraction using polar and non-polar solvents. Phytochemical screening revealed the presence of secondary metabolites, while GC-MS analysis detected chemical compounds in the extracts. Antioxidant assays demonstrated high phenolic (54.34 ± 0.49 mg GAE/g) and flavonoid (6.43 ± 0.38 mg QE/g) content, with significant antioxidant activity in DPPH (0.57 ± 0.04 mg TE/g), FRAP (105.52 ± 6.85), and ABTS (1.25 ± 0.01 mg TE/g) assays. DNA barcoding of nine loci, (seven from the chloroplast genome and two nuclear genome) using a CTAB extraction protocol and PCR, provides the first genetic characterization of this species, contributing to genetic diversity assessments and phylogenetic studies. These findings underscore the importance of P. guineense as a source of potent bioactive compounds with significant antioxidant potential, highlighting its applicability in nutritional and pharmaceutical industries. Additionally, the genetic insights gained support efforts to expand DNA barcoding databases for tropical biodiversity conservation.

Introduction

Ecuador is known as a megadiverse country [1] and has an important number of ecosystems and endemic vascular plant species [2,3]. One of the most important ecosystems is the tropical dry forest, located in the center and south of the western region of Los Andes, in the provinces of Guayas, Esmeraldas, Manabí, Loja, Imbabura, and El Oro [4].

Species of the genus Psidium belonging to the Myrtaceae family, are found from Southern Mexico to Northern Argentina and Brazil [5] and are widely distributed in the Ecuadorian tropical dry forest, some species are considered endemic and could be of great interest in the pharmaceutical industry. Many Ecuadorian endemic plants are used traditionally by natives like medicinal plants to treat diseases [6].

Psidium guineense, commonly known as Brazilian guava or guayabilla, is a small tree or shrub native to tropical dry forests and mesophilic mountain forests [7]. The leaves are evergreen, oblong to ovate, or obovate, measuring between 3.5 to 14 cm in length and 2.5 to 8 cm in width. The upper surface of the leaves is somewhat hairy, while the underside is covered with pale or rusty hair and dotted with glands, giving them a greyish-green color. Flowers are white, typically borne singly or in clusters of three in the leaf axils, with numerous prominent stamens (150 to 200) that give them a bushy appearance [8]. The fruit is small, round, or pear-shaped, measuring between 1.0 to 2.5 cm in diameter, with a yellow skin and pale-yellowish flesh surrounding a white central pulp. The flavor is slightly acidic and resinous, reminiscent of strawberries or pineapple jam, and each fruit contains numerous small, hard seeds dispersed by birds and mammals [8].

Psidium guineense grows best in temperatures ranging from 23°C to 28°C (73°F to 82°F) and is sensitive to frost, with young trees affected at temperatures below -3°C (27°F) [9]. The species is adapted to a range of altitudes, from coastal areas to higher terrains, and can grow in various soil types, making it capable of thriving in diverse environmental conditions [10].

Psidium species have been studied and shown pharmacological potential, reported in the treatment of diseases of diarrhea [11,12], dysentery [12], digestive system diseases [13], stomach pain [12], antimalarial [14], antiplasmodial [15], anti-inflammatory [16], antiparasitic [17], antimicrobial [16], larvicide [16] and others. Additionally, a high antioxidant potential has been documented in different species of the genus Psidium such as, Psidium guajava [16], Psidium friedrichsthalianum [18], Psidium cattleianum [19,20], Psidium guineense Swartz [21], Psidium acutangulum [22], Psidium laruotteanum [23], Psidium salutare [24], Psidium sobralianum [24], Psidium bahianum [25] is known.

Oxidative stress is a major factor in the development of many diseases such as diabetes [26,27], cancer [27], cardiovascular [28], neurological [29], and respiratory diseases [30].

Antioxidants have been proven to have an essential role in diseases by clearing reactive species in the body [31]. Polyphenols are known for their antioxidant properties [32], have gained significant attention in recent years as natural compounds that can mitigate oxidative stress. The genus Psidium is particularly notable for its chemical composition, which includes a wide variety of polyphenols [32,24], flavonoids [33], tannins [34], alkaloids [33], triterpenes [33], carotenoids [33], carbohydrates [20], fatty acids [20], and other bioactive compounds [35]. These components contribute to the genus pharmacological potential, including antioxidant activity, which is critical in addressing oxidative stress-related conditions.

Previous studies have identified that P. guineense leaf extracts possess bioactive compounds such as phenolics, and flavonoids [36,37]. Their antioxidant, anti-inflammatory, antiproliferative, and antimycobacterial properties have also been evaluated [36–39]. The compounds may vary in their levels of bioactivity due to the environmental conditions to which each plant was exposed [40].

On the other hand, DNA barcodes could offer several benefits. This methodology is more accurate than morphological characteristics for identifying plant species, and more importantly, it could serve as a complement analysis for taxonomic identification. This is mainly because many plant species appear similar but could differ genetically. DNA barcodes allow scientists to overcome this problem and accurately and cost-effectively identify plant species. DNA barcoding can aid in conserving rare and endangered species and support research on plant evolution, ecology, and conservation, especially given the threats to biodiversity from human activities, pollution, deforestation, and resource depletion [41].

Thisstudy aims aphylogenetic identification ofPsidium guineense, analyze its chemical composition, and evaluate its antioxidant activity to assess its pharmaceutical potential. The study involve a comprehensive analysis of the chemical composition, phenolic and flavonoid content, and antioxidant activity of Psidium guineense, a species native to the tropical dry forests of Ecuador. Furthermore, for the first time, DNA barcodes were determined for nine loci (seven from the chloroplast genome and two for the nuclear genome). This achievement represents a significant fact for recognizing the phylogeny of the species, tracing its evolutionary origin, and predicting potential genetic variations.

Methods

Reagents

Methanol (99.9%), ethyl acetate (> 99.5%), dichloromethane (99.7%), and hexanes (95%) were obtained from Fisher Chemical. Hydrochloric acid (10 N) and ferric chloride hexahydrite (97%) were obtained from Fisher Scientific. 2,2,2-trifluoro-N-(trimethylsilyl) acetimidate (BSTFA) (98%), and Trolox (97%) were obtained from Thermo Scientific^TM. 2,2-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) (99.4%) was obtained from Thermo Fisher Scientific. Folin & Ciocalteu´s phenol reagent was obtained from OttoKemi (2 N). Sodium carbonate anhydrous (99.5%), aluminum chloride (99%), 2,2-diphenyl-1pycrilhydrazyl (DPPH) (95%), potassium acetate (99%), and quercetin hydrate (97%) were obtained from Merck. Gallic acid (98%) was obtained from Titan Biotech. 2,4,6-tri(2-pyridyl)-1,3,5-triazine (TPTZ) (98.5%) was obtained from J&K Scientific. All reagents were used without prior purification.

Plant material

Leaves from P. guineense were collected on July 16, 2022, during the dry season in Colimes, Guayas Province-Ecuador (1°32´S, 80°0´W); the samples were collected in areas not protected by government entities; therefore, collection permits were not required. A part of them was frozen for DNA extraction and another part was cut into 1x1 cm squares, dried in an industrial try-dryer to 60°C, with airflow during 8 h, and used for extraction with different solvents. Voucher specimens are deposited in the Herbario GUAY, Faculty of Natural Sciences, University of Guayaquil, Ecuador, and New York Botanical Garden (NYBG) STEERE HERBARIUM, New York, USA [42].

Morphological analysis

Measurements are from the field, cultivated and GUAY herbarium specimens, morphological observations were performed with a stereoscope Olympus SZ51. The botanical terms used in the description of species follow Jackson B.D. [43].

Solvent extraction by Soxhlet apparatus

Chemical compounds were extracted using polar solvents (methanol, ethyl acetate, and dichloromethane) and a non-polar solvent (Hexane). Experiments were conducted to qualitatively and quantitatively analyze the chemical compounds present in the leaves of the Psidium species under study. In the Soxhlet apparatus, 20 g of dry leaves and 200 mL of solvent were used. The extraction was performed for 2 hours at the reflux temperature of different solvents. The extract obtained was filtered and stored in a refrigerator at 3°C [44].

Qualitative phytochemical screening

For the phytochemical screening, 30 g of dried material was mixed with 90 mL of distilled water and macerated for 48 hours. The aqueous extracts were then divided into fractions for subsequent determination of secondary metabolites that might be present in the aqueous extract [45].

GC-MS analysis

P. guineense extracts were analyzed in a gas chromatography-mass spectrometry equipment Agilent Technologies (7890A GC system and 5975C inert XL MSD with triple axis detector) as described in previous studies [46]. A fused-silica capillary column DB-5MS (30 m × 0.25 mm) with phenyl dimethylpolysiloxane was used as the stationary phase (0.25-micron film thickness), and helium as the carrier gas (1.2 mL/min). Hexane, dichloromethane, and ethyl acetate extracts were injected directly. Methanol extracts were dried using a vacuum centrifuge concentrator, mixed with BSTFA, and incubated in a water bath at 80°C for 2 hours. After that, 1 µL of the samples was injected using the splitless mode at 250°C. The oven temperature was started at 70°C for 2 minutes, then it was increased to 285°C at 5°C/min. The MSD transfer line was 300°C, and the ion source temperature was 230°C. An electron ionization of 70 eV was used, and the compounds data was collected with the full scan mode (40-600 amu) in the quadrupole mass analyzer. Finally, compound identification was done by matching the mass spectra information with data available in Wiley 9, and NIST 2011 libraries.

DNA extraction and PCR

Leaves from collected samples from three specimens (biological replicates, coded as CIBE-019, CIBE-020, and CIBE021) were ground using liquid nitrogen in the grinder MM400 (Retsch, Haan, Germany) and stored at −80°C upon DNA extraction.

Approximately, 100 mg of leaf was used for DNA extraction using a CTAB protocol with some modifications [47]. PCR was conducted using the 2× GoTaq master mix (Cat. # M7123; Promega, Madison, WI, USA) using 0.5 μM of each primer (Table 1). The final volume was 30 μL per reaction. PCR conditions consisted of first 95°C for denaturation; followed by 35 cycles of: 95°C for 30 s, 60°C (for rbcL, psbA-trnH, rpoC1), 56°C (for matK, psbK-psbI, atpF-atpH, and ITS2), or 50°C (for rpoB and ITS1) for 30 s, 72°C for 90 s, with a final extension of 72°C for 5 min. Five microliters of PCR reaction were loaded on a 1.5% gel to check for the presence of amplicons. The remaining 25 μL were sequenced commercially after purification of PCR product (Macrogen, Rockville, MD, USA). At least two technical replicates were sequenced, and a consensus was constructed for each biological replicate.

Table 1. Primers used for PCR amplification of the DNA barcodes psbA-trnH spacer, psbK-psbI spacer, rpoB, rpoC1, atpF-atpH spacer, rbcL, matK, and ITS2.

Locups	Primer pairs	Sequence	Annealing temperature	Reference
psbA-trnH	trnHf_05	CGCGCATGGTGGATTCACAATCC	60°C	[48]
	psbA3_f	GTTATGCATGAACGTAATGCTC
psbK-psbI	psbK_F	TTAGCCTTTGTTTGGCAAG	56°C	[48]
	psbI_R	AGAGTTTGAGAGTAAGCAT		[48]
rpoB	rpoB_2F	ATGCAACGTCAAGCAGTTCC	50°C	[48]
	rpoB_3R	CCGTATGTGAAAAGAAGTATA		[48]
rpoC1	rpoC1_2F	GGCAAAGAGGGAAGATTTCG	60°C	[48]
	rpoC1_4R	CCATAAGCATATCTTGAGTTGG
atpF-atpH	atpF_F	ACTCGCACACACTCCCTTTCC	56°C	[49,50]
	atpH_R	GCTTTTATGGAAGCTTTAACAAT
rbcL	rbcLA_F	ATGTCACCACAAACAGAGACTAAAGC	60°C	[51]
	rbcLA_R	GTAAAATCAAGTCCACCRCG		[51]
matK	matK_3F_KIMF	CGTACAGTACTTTTGTGTTTACGAG	56°C	[50,48]
	matK_1R_KIMR	ACCCAGTCCATCTGGAAATCTTGGTTC		[50,48]
ITS1	ITS 5a F	CCTTATCATTTAGAGGAAGGAG	50°C	[52]
	ITS 4 R	TCCTCCGCTTATTGATATGC		[52]
ITS2	S2F	ATGCGATACTTGGTGTGAAT	56°C	[52]
	S3R	GACGCTTCTCCAGACTACAAT

Open in a new tab

Bioinformatics analysis of sequences

Sequences were trimmed manually using MEGAX after alignment [51]. Processed sequences were blasted (25^th September 2023) in the GenBank using the nucleotide database [52]. Sequences from the blast analysis were selected for phylogenetic analysis using MEGAX. For each barcode, the recommended model from the MEGAX was used for phylogenetic analysis after alignment with MUSCLE. The aligned sequences were trimmed at the ends to allow for all sequences to maintain the same range. For the phylogenetic analysis, the Maximum Likelihood method was used for each barcode using a bootstrap test (1000 replicates).

Total phenolic content

The total phenolic content was estimated by the Folin-Ciocalteu method reported by Avramova et al. 2017 with modifications [53]. In this procedure, 20 μL of aqueous extract or standard was mixed with 100 μL of 10% (v/v) Folin-Ciocalteu reagent solution, and 80 μL of 7.5% (w/v) sodium carbonate into a 96-well plate. The reaction was incubated for 1 hour in darkness, and the absorbance was measured at 765 nm against a blank in a Biotek Synergy HTX multi-mode microplate reader with a UV-VIS detector (Vermont, USA). The results were expressed as milligrams of gallic acid equivalents (GAE) per gram of dry weight according to the equation $y = 0.0059 x - 0.0006$ (R² = 0.9992) obtained from the standard gallic acid calibration curve (10 – 200 μg/mL).

Total flavonoid content

The total flavonoid content was estimated by the aluminum chloride method reported by Avramova et al. 2017 with modifications [54]. For this, 20 μL of aqueous extract or standard was mixed with 10 μL of 10% (w/v) aluminum chloride, 10 μL of 1M potassium acetate, 60 μL of methanol, and 120 μL of distilled water into a 96-well plate. The reaction was incubated for 30 minutes in darkness, and the absorbance was measured at 415 nm against a blank in a Biotek Synergy HTX multi-mode microplate reader with a UV-VIS detector (Vermont, USA). The results were expressed as milligrams of quercetin equivalents (GAE) per gram of dry weight according to the equation $y = 0.0051 x - 0.0275$ (R² = 0.9909) obtained from the quercetin calibration curve (10 – 100 μg/mL).

Antioxidant activity

ABTS radical cation inhibition assay.

The ABTS radical cation inhibition activity was measured according to the methodology described by Viteri et al. 2022 [54]. An aliquot of 50 μL of the aqueous extract or standard was mixed with 150 µL of a 156 μM ABTS radical cation solution. The reaction was incubated in darkness for 30 minutes and the absorbance was measured at 732 nm against a blank in a Biotek Synergy HTX multi-mode microplate reader with a UV-VIS detector (Vermont, USA). The ABTS radical cation stock solution was prepared by reacting 7 mM ABTS with 3.6 mM potassium persulfate and incubating it in darkness for 24 hours before use. Then, the stock solution was diluted in water to obtain a final concentration of 156 μM. The results were expressed as milligrams of Trolox equivalents (TE) per gram of dry weight according to the equation $y = 0.5808 x - 0.1467$ (R² = 0.9936) obtained from the Trolox calibration curve (20 – 180 μmol/L).

DPPH radical scavenging assay.

The DPPH radical scavenging activity was measured following the procedure described by Viteri et al. 2022 with some modifications [54]. Briefly, 50 μL of the aqueous extract or standard was mixed with 150 µL of a 0.1 mM DPPH solution in a 96-well plate. The reaction was incubated in darkness for 30 minutes, and the absorbance was measured at 517 nm against a blank in a Biotek Synergy HTX multi-mode microplate reader with a UV-VIS detector (Vermont, USA). The results were expressed as milligrams of Trolox equivalents (TE) per gram of dry weight according to the equation $y = 0.7853 x - 35.622$ (R² = 0.9868) obtained from the Trolox calibration curve (60 – 180 μmol/L).

Ferric reducing antioxidant power (FRAP) assay.

The ferric-reducing antioxidant power (FRAP) was measured according to the methodology described by Hozzein et al. 2020 with some modifications [55]. Briefly, 20 μL of the aqueous extract or standard was mixed with 180 μL of FRAP reagent mix in a 96-well plate. The FRAP reagent mix was prepared the day of the reaction using a 10:1:1 (v/v/v) proportion of 300 mM acetate buffer (pH 3.6), 10 mM TPTZ solution dissolved in 40 mM hydrochloric acid, and 20 mM ferric chloride dissolved in water. The reaction was incubated in darkness for 20 minutes, and the absorbance was measured at 600 nm against a blank in a Biotek Synergy HTX multi-mode microplate reader with a UV-VIS detector (Vermont, USA). The results were expressed as milligrams of Trolox equivalents (TE) per gram of dry weight according to the equation $y = 0.0024 x + 0.1274$ (R² = 0.9897) obtained from the Trolox calibration curve (50 – 1000 μmol/L).

Results and discussion

Morphological evaluation

Shrubs to low trees up to 5 meters high, with tomentulose or subtomentose twigs, lower leaf surfaces, and flower buds; young twigs terete to complanate, but not angled. LEAVES simple, opposite, the blade elliptic to oblong, 7–11 x 3–7 cm, the margins entire; apex shortly acuminate to broadly obtuse; base inconspicuously subcordate to broadly cuneate; petiole 4–8 mm long, more or less channeled; venation brochidodromous, the lateral veins 7–11 pairs. FLOWER BUDS conspicuously constricted, ovate to globose in the distal half. CALYX closed in the bud, acuminate at apex, longitudinally tearing in distal half, tomentulose to subtomentose without; petals white, glabrous to pilose without; stamens 150–300. FRUIT obovate to subglobose, 1–3 cm in diameter, epicarp 1–2.5 mm thick.

Qualitative phytochemical screening

The identification of phytochemicals in P. guineense leaves is a fundamental starting point for evaluating their nutritional and biological properties. Phytochemical screening detected catechins, saponins, triterpenoids, steroids, flavonoids, alkaloids, reducing sugars, tannins, phenolic compounds, and oils and fats (Table 2). Ethereal, alcoholic, and aqueous extracts had high alkaloid content, these compounds are useful as diet ingredients [56], supplements, and pharmaceuticals [57,58], in medicine and other biological applications.

Table 2. Qualitative phytochemical screening of P. guineense in ethereal, alcoholic, and aqueous extracts.

Compound detected	Inference
Compound detected	Ethereal extract	Alcoholic extract	Aqueous extract
Catechins	ND	+	ND
Coumarins and lactones	-	ND	ND
Resins	ND	-	ND
Lactones	ND	-	ND
Oils and fats	+	ND	ND
Saponins	ND	-	+
Quinones	ND	-	ND
Triterpenoids and steroids	+	+	ND
Flavonoids	ND	-	+
Anthocyanidins	ND	-	ND
Alkaloids (Dragendorff)	++	+++	-
Alkaloids (Wagner)	++	-	+++
Alkaloids (Mayer)	-	-	+++
Reducing sugars	ND	+	-
Tannins and phenolic compounds	ND	+c	+f
Mucilages	ND	ND	-

Open in a new tab

- = Absent; + = Present; ++ = Moderate amount; +++= Highly Present.

+^f = Present in form of phenolic compounds; +^c = Present in form of pyrocatechol tannins.

ND = Not determined.

Table 2 highlights the presence of key bioactive compounds associated with antioxidant activity, particularly in the alcoholic and aqueous extracts. Flavonoids, phenolic compounds, tannins, and catechins—detected predominantly in these extracts—are well-documented for their ability to neutralize free radicals, prevent lipid peroxidation, and protect against oxidative damage at the cellular level [59,60]. For example, flavonoids detected in the aqueous extract are known to play a vital role in scavenging reactive oxygen species (ROS), thereby mitigating oxidative stress and its associated health implications, such as chronic inflammation and degenerative diseases [61].

The high presence of phenolic compounds in both the alcoholic and aqueous extracts further supports their strong antioxidant potential. The tannins detected in these extracts are also crucial contributors to antioxidant activity, with evidence suggesting their role in chelating metal ions [62,63] and scavenging free radicals effectively neutralizing them and preventing oxidative damage [63,64].

Catechins were detected in the alcoholic extract. Catechins are significant contributors to antioxidant activity due to their ability to scavenge free radicals and inhibit lipid peroxidation [65,66]. Their potency often exceeds that of other polyphenols, making them valuable for health promotion and disease prevention [66,67].

Ethereal extract showed lower levels of antioxidant-related phytochemicals. It primarily contained compounds such as oils and fats, triterpenoids, and steroids. Although these compounds are not direct antioxidants, they contribute to enhancing antioxidant pathways. The ability of triterpenoids and steroids to interact with biological pathways related to lipid metabolism positions them as potential treatments for metabolic disorders [68,69]. They are associated with anti-inflammatory and membrane-protective effects, attributed to their ability to stabilize cell membranes and mitigate oxidative stress [68,70,71].

The absence or non-detection (ND) of certain compounds in specific extracts reflects the limitations of each solvent in extracting compounds beyond its polarity spectrum. This underscores the importance of using multiple extraction methods to comprehensively profile the phytochemical composition of P. guineense and to maximize the recovery of compounds with desired antioxidant activities. The alcoholic extract appears to offer the most balanced profile, combining lipophilic and hydrophilic antioxidants, while the aqueous extract emphasizes hydrophilic compounds with potent ROS-scavenging abilities.

GC-MS analysis

A total of 65 compounds were identified in the extract of P. guineense leaves by GC-MS analysis applying different solvents which are shown in Table 3. Among these compounds, alkanes, alkenes, monoterpenes, diterpenes, carboxylic acids, sesquiterpenes, and oxygenated sesquiterpenes were with their peak area values and retention times reported for each solvent. It was experimentally identified that the only sesquiterpene obtained with at least three solvents (hexane, dichloromethane, and ethyl acetate) was alpha-copaene.

Table 3. Compounds detected by GC-MS.

Solvents		Hexane		Dichloromethane		Ethyl Acetate		Methanol
N°	Compound Detected	Peak area (%)	Retention Time (estimated)	Peak area (%)	Retention Time (estimated)	Peak area (%)	Retention Time (estimated)	Peak area (%)	Retention Time (estimated)
1	α-Copaene	10.26	15.174	8.91	11.987	1.36	15.123	Nd	Nd
2	Caryophyllene	6.79	16.319	1.05	15.161	Nd	Nd	0.60	16.294
3	α-Curcumene	1.37	17.814	Nd	Nd	Nd	Nd	Nd	Nd
4	β-Bisabolene	3.18	18.457	Nd	Nd	Nd	Nd	Nd	Nd
5	2, 6, 10-Dodecatrienoic Acid	Nd	24.577	Nd	Nd	Nd	Nd	Nd	Nd
6	Neophytadiene	2.36	25.799	5.04	25.824	2.73	25.760	Nd	Nd
7	Dibutyl Phthalate	2.50	28.063	Nd	Nd	Nd	Nd	Nd	Nd
8	Hexadecanoic Acid	3.14	28.382	2.95	28.445	13.76	28.324	Nd	Nd
9	Phytol	4.54	31.054	Nd	Nd	Nd	Nd	Nd	Nd
10	Nonadecane	1.21	34.413	Nd	Nd	Nd	Nd	Nd	Nd
11	9-Octadecenamide	14.16	35.348	Nd	Nd	Nd	Nd	Nd	Nd
12	Docosane	1.73	36.060	0.61	32.688	Nd	Nd	Nd	Nd
13	Heneicosane	1.77	37.651	Nd	Nd	Nd	Nd	Nd	Nd
14	Hexacosane	2.02	39.178	Nd	Nd	Nd	Nd	Nd	Nd
15	Heptacosane	1.73	40.686	0.76	40.654	Nd	Nd	Nd	Nd
16	Eicosane	1.12	42.079	Nd	Nd	Nd	Nd	Nd	Nd
17	Benzeneacetic Acid	Nd	Nd	2.21	11.987	Nd	Nd	Nd	Nd
18	Alloaromadendrene	Nd	Nd	1.24	17.254	Nd	Nd	Nd	Nd
19	α-Amorphene	Nd	Nd	0.82	17.611	Nd	Nd	Nd	Nd
20	β-Selinene	Nd	Nd	1.06	18.018	Nd	Nd	Nd	Nd
21	α-Muurolene	Nd	Nd	0.60	18.190	Nd	Nd	Nd	Nd
22	γ-Muurolene	Nd	Nd	0.35	18.539	Nd	Nd	Nd	Nd
23	1s,Cis-Calamenene	Nd	Nd	1.22	18.737	Nd	Nd	Nd	Nd
24	α-Calacorene	Nd	Nd	0.87	19.201	Nd	Nd	Nd	Nd
25	Caryophyllene Oxide	Nd	Nd	2.92	20.206	Nd	Nd	Nd	Nd
26	β-Copaen-4-α-Ol	Nd	Nd	1.78	21.650	Nd	Nd	Nd	Nd
27	Copaene	Nd	Nd	1.78	21.650	Nd	Nd	Nd	Nd
28	2-(1,1-dimethylethyl)-4- (1-methyl-1-phenylethyl)phenol,	Nd	Nd	0.63	29.355			Nd	Nd
29	Phytol	Nd	Nd	0.48	31.022	1.64	31.022	Nd	Nd
30	Octadecanoic Acid	Nd	Nd	0.75	32.084	1.85	31.995	Nd	Nd
31	Tricosane	Nd	Nd	0.84	34.406	Nd	Nd	Nd	Nd
32	Eicosanoic Acid	Nd	Nd	0.45	35.437	Nd	Nd	Nd	Nd
33	Tetracosane	Nd	Nd	1.00	36.060	Nd	Nd	Nd	Nd
34	Pentacosane	Nd	Nd	1.06	37.651	Nd	Nd	Nd	Nd
35	Tricosane	Nd	Nd	1.50	39.178	Nd	Nd	Nd	Nd
36	Octacosane	Nd	Nd	1.03	42.072	Nd	Nd	Nd	Nd
37	Triacontane	Nd	Nd	0.28	44.783	Nd	Nd	Nd	Nd
38	Vitamin E	Nd	Nd	0.37	47.232	Nd	Nd	Nd	Nd
39	γ-Sitosterol	Nd	Nd	1.66	48.498	5.40	48.498	Nd	Nd
40	8-Methyl(6)(2,4)Thiophenophane	Nd	Nd	Nd	Nd	2.69	19.615	Nd	Nd
41	(-)-Loliolide	Nd	Nd	Nd	Nd	1.22	24.297	Nd	Nd
42	9-Octadecenoic Acid	Nd	Nd	Nd	Nd	3.15	31.537	Nd	Nd
43	9-Octadecenamide	Nd	Nd	Nd	Nd	7.55	35.310	20.51	35.481
44	Heptanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.05	9.811
45	Benzoic Acid Trimethylsilyl Ester	Nd	Nd	Nd	Nd	Nd	Nd	0.34	11.764
46	Butanedioic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.17	13.558
47	Propanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.10	13.984
48	Butanedioic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.30	17.992
49	L-Threonic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.15	19.742
50	Hexadecane	Nd	Nd	Nd	Nd	Nd	Nd	0.08	20.652
51	Dodecanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.14	21.816
52	Benzoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	1.30	25.391
53	Tetradecanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.98	26.040
54	7,9-ditertbutyl-1-oxaspiro [4.5]deca-6,9-diene-2,8-dione	Nd	Nd	Nd	Nd	Nd	Nd	2.26	27.115
55	N-Pentadecanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.11	28.006
56	Oleanitrile	Nd	Nd	Nd	Nd	Nd	Nd	0.83	30.494
57	Octadecoxy-Trimethylsilane	Nd	Nd	Nd	Nd	Nd	Nd	0.66	31.951
58	Hexadecanamide	Nd	Nd	Nd	Nd	Nd	Nd	1.26	32.275
59	Oleic Acid	Nd	Nd	Nd	Nd	Nd	Nd	1.94	32.968
60	11-Trans-Octadecenoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.53	33.089
61	Octadecanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	16.05	33.496
62	Nonadecanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.11	35.125
63	Eicosanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.25	36.735
64	Docosanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.93	39.782
65	Tetracosanoic Acid	Nd	Nd	Nd	Nd	Nd	Nd	0.17	42.613
Total		57.94		44.98		41.35		55.53
Sesquiterpene		21.6		17.9		1.36		0.60
Sesquiterpene oxygenated				3.44		5.40

Open in a new tab

ND = Not determinated

Based on the GC-MS data, the solvents yielding the highest percentages of sesquiterpenes were as follows: Hexane (21.6%), Dichloromethane (17.9%), Ethyl Acetate (1.36%), and Methanol (0.60%). Among these, alpha-copaene was the most prominent chemical constituent, accounting for 10.26%, followed by caryophyllene at 6.79%. Other studies performed in Sri Lanka have reported a lower amount of sesquiterpenes (6.1%) in P. guineense using hexane as the solvent, with caryophyllene (1.4%) and copaene (1.4%) being the most prominent constituents [72]. In contrast, the only oxygenated sesquiterpene identified with at least two solvents (dichloromethane at 1.66% and ethyl acetate at 5.40%) was gamma-sitosterol. Another study conducted in Egypt, which compared the chemical profiles of different Psidium guajava varieties, reported low amounts of caryophyllene oxide (< 0.96%) [73], while for P. guineense native of Ecuador, a value of 2.92% was identified in its composition.

The many properties identified in the numerous bioactive compounds are valuable for a range of applications. Copaene has demonstrated antioxidant [74], anticancer, and antigenotoxic effects. Caryophyllene has been reported to possess anticancer, analgesic [74], anti-inflammatory [74], antioxidant [74], antimicrobial [74] activities. There is variability in the quantity and quality of chemical constituents among different P. guineense species, which can be attributed to exogenous factors such as climatic conditions [40], and soil properties [72]; in addition to endogenous variables such as physiological [73], genetic [24], and anatomical factors [73].

DNA barcode analysis

PCR amplification was detected for all the nine DNA barcodes tested. The best hit for all sequences for each barcode is indicated (S1 Table). BLAST analysis indicated the presence of Psidium spp. using the sequences available in the nr database, including plastid genomes and single locus sequences.

The best model for nucleotide substitution, obtained after alignment of the sequences, which were: T92 (psbA-trnH, psbK-psbI, atpF-atpH, and matK), JC (rpoB, rpoC1, and rbcL), T92+G (ITS1), and K2+G (ITS2). Phylogenetic analysis for psbA-trnH showed that all the Psidium spp. are in a clade with a bootstrap value of 90 (Fig 1). For the DNA barcode psbK-psbI, the three biological replicates of P. guineense are in a clade with a bootstrap value of 99 (S1 Fig). Furthermore, the atpF-atpH phylogenetic tree showed that the three P. guineense from Ecuador are grouped in a clade with other Psidium species with a bootstrap value of 93 (S1 Fig). For the rpoB, the phylogenetic tree revealed that differentiation between different Psidium species and even other genera could not be achieved (Fig 2).

The phylogenetic tree of rpoC1 showed that the three P. guineense are grouped in a clade but due to the absence of Psidium spp. sequences in the GenBank for rpoC1 is not possible to determine genetic diversity between species of the same genera (S1 Fig). The phylogenetic tree with the rbcL barcode shows that all accessions from the genus Psidium are in one clade, indicating that rbcL could be used to discriminate between different genera but not different species from the genus Psidium (Fig 3). On the other hand, the barcode matK could be used to differentiate between different species of Psidium, as different clades are formed, especially of P. guajava and P. guineense, except for the accession of P. guineense JQ588513 (Fig 4). The ITS1 barcode showed different clades for different species of Psidium, where the P. guineense from Ecuador are in clades with 99 and 98 bootstrap values (Fig 5). For the ITS2 barcode, the P. guineense from Ecuador are grouped with bootstrap values of 99 and 98 (S1 Fig); however, not all Psidium species from the Genbank were clustered in a clade (S1 Fig).

Genetic analysis has emerged as a crucial tool in the standardization of medicinal plants. Characterization of plant species at the genotypic level is essential, as many plants can exhibit significant variations in their physical characteristics even within the same genus and species. DNA analysis is a valuable method for identifying cells, individuals, or species, with the potential to distinguish authentic from adulterated drugs, as discussed by Kumari and Kotecha’s study [75]. Various techniques could be employed for genotyping in plants. These include microsatellite markers [76–78], as well as molecular techniques such as genome-wide approaches [79], and transcriptome analysis [80].

Our findings indicate that the rpoB and rbcL barcodes lack accuracy to differentiate at the species level, while for rpoC1 there are no sequences at the GenBank from Psidium species and therefore, could not be concluded that this barcode could be used for different at the species level. For the barcodes psbA-trnH, psbK-psbI and atpF-atpH showed differentiation with other Psidium species, although more Psidium sequences should be available at the Genbank for a better analysis. The matK barcode showed differences at the Psidium species but for some species, they did not form a clade.

In contrast, the ITS1 and ITS2 exhibit improved species-level resolution for Psidium species. Other reports suggest that ITS2 provides superior resolution for identifying species in medicinal plants [81–85].

Future research efforts should involve the sequencing of specific genetic markers for various Psidium species located in Ecuador, while including biological replicates. Subsequent investigations should focus on establishing a robust DNA barcode analysis and exploring various combinations of two genetic loci to determine the most effective barcode for species identification within the Psidium species.

Total phenolics and flavonoids content and antioxidant activity

Phenolic compounds, such as phenolic acids, tannins, flavonoids, and others, are considered the most important phytochemical compounds produced by plants. These compounds exist in various parts of the plant, and their amounts depend significantly on factors such as the type of plant organ, climate, variety, and location. The leaf extract of P. guineense native to the tropical dry forest of Ecuador presents high phenolic and flavonoid content: 54.34 ± 0.49 mg of GAE/g of dried weight and 6.43 ± 0.38 mg QE/g dry weight respectively (Table 4). In a previous study conducted in Ecuador on thirteen native plants of Guayas, phenolic content values of Psidium guayaquilense and Psidium rostratum leaf extracts were reported, obtaining values of 941.97 ± 30.60 mg GAE/ g dry extract and 591.34 ± 24.31 mg GAE/g dry extract, respectively. However, the P. guineense variety was not analyzed [86].

Table 4. Antioxidant activity of Psidium species aqueous extracts.

ABTS radical cation inhibition activity (mg TE/g)	DPPH radical scavenging activity (mg TE/g)	Ferric reducing antioxidant power (mg TE/g)	Total phenolic content (mg GAE/g)	Total flavonoid content (mg QE/g)
1.25 ± 0.01	0.57 ± 0.04	105.52 ± 4.84	54.34 ± 0.49	6.43 ± 0.27

Open in a new tab

The study carried out in the western province of Sri Lanka reported that the total phenol content in P. guineense leaf extract is 195.25 ± 9.56 mg GAE/g [87].

All values are mean ± standard deviation (n=3). ABTS radical cation inhibition activity, DPPH radical scavenging activity, and Ferric reducing antioxidant power values are expressed as mg of Trolox equivalent/g of dried weight. Total phenolic content values are expressed as mg of gallic acid equivalent/g of dried weight. Total ﬂavonoid content values are expressed as mg of quercetin equivalent/g of dried weight. All Data for the calibration curves and results obtained from the samples are available as Supporting Information (S2 Table).

On the other hand, the antioxidant activity of P. guineense found in its study is summarized in Table 4, which shows a high antioxidant activity based on the Trolox standard [88]

Conclusion

This study provides valuable insights into the bioactive potential of Psidium guineense leaf extract through a comprehensive analysis of its chemical profile, phenolic and flavonoid content, and antioxidant activity. The high phenolic content observed in the extract support the established correlation between phenolic compounds and antioxidant activity, confirming the extract’s potential health-promoting properties.

In terms of genetic characterization, the matK and ITS1 barcodes have demonstrated their utility in distinguishing P. guineense at species levels when compared with available GenBank sequences. However, further studies incorporating additional Psidium species area required to evaluate the effectiveness of the psbK-psbI, atpF-atpH, rpoC1, and ITS2 barcodes for species level identification. The rbcL barcode, on the other hand, proves to be reliable for differentiation at the genus level.

Supporting information

S1 Table. Blastn analysis for nine different DNA barcodes of Psidium guineense plants (CIBE-019, CIBE-020, CIBE-021). Results were ranked for the first two with the highest percentage of identity.

(XLSX)

pone.0319524.s001.xls^{(49.5KB, xls)}

S1 Fig. Phylogenetic trees of Psidium guineense from Ecuador.

(TIF)

pone.0319524.s002.tif^{(468.7KB, tif)}

S2 Table. Total Phenolic and Flavonoid Content-Antioxidant Activity of Psidium guineense.

(XLSX)

pone.0319524.s003.xlsx^{(57.9KB, xlsx)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

Funding was provided by the Research Dean of ESPOL, Project: FCNM-17-2018. Received by the Project Director J. Vielma.

References

1.Mittermeier RA, Turner WR, Larsen FW, Brooks TM, Gascon C. Global Biodiversity Conservation: The Critical Role of Hotspots. Biodiversity Hotspots. Springer Berlin Heidelberg; 2011. pp. 3–22. doi: 10.1007/978-3-642-20992-5_1 [DOI] [Google Scholar]
2.Kleemann J, Koo H, Hensen I, Mendieta-Leiva G, Kahnt B, Kurze C, et al. Priorities of action and research for the protection of biodiversity and ecosystem services in continental Ecuador. Biological Conservation. 2022;265:109404. doi: 10.1016/j.biocon.2021.109404 [DOI] [Google Scholar]
3.Cuesta F, Peralvo M, Merino-Viteri A, Bustamante M, Baquero F, Freile JF, et al. Priority areas for biodiversity conservation in mainland Ecuador. Neotropical Biodiversity. 2017;3(1):93–106. doi: 10.1080/23766808.2017.1295705 [DOI] [Google Scholar]
4.Torri MC. Perceptions and uses of plants for reproductive health among traditional midwives in Ecuador: moving towards intercultural pharmacological practices. Midwifery. 2013;29(7):809–17. doi: 10.1016/j.midw.2012.06.018 [DOI] [PubMed] [Google Scholar]
5.Nybg, Herbarium S. No Title. 2016. Available from: http://sweetgum.nybg.org/science/vh/specimen-details/?irn=3156114 [Google Scholar]
6.López-Bascón MA, Luque de Castro MD. Soxhlet Extraction. Liquid-Phase Extraction. 2020:327–54. doi: 10.1016/b978-0-12-816911-7.00011-6 [DOI] [Google Scholar]
7.Valera-Montero LL, Enríquez-Nava S, Silos-Espino H, Padilla-Ramírez JS, Perales Segovia C, Flores-Benítez S. Propiedades fisicoquímicas de guayabilla (Psidium guineense), arrayán (Psidium sartorianum) y guayaba (Psidium guajava). Remexca. 2018;9(6):1099–108. doi: 10.29312/remexca.v9i6.1576 [DOI] [Google Scholar]
8.Barroso AS, Massing LT, Suemitsu C, Mourão RHV, Figueiredo PLB, Maia JGS. Volatile Constituents of Some Myrtaceous Edible and Medicinal Fruits from the Brazilian Amazon. Foods. 2024;13(10):1490. doi: 10.3390/foods13101490 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.French B, Maynard A. Food Plants International Database. 2022 Nov. Available from: https://foodplantsinternational.com/ [Google Scholar]
10.Eladio J, Loría-Coto M. Illustrative guide to brazilian guava (Psidium guineense). 2023. doi: 10.13140/RG.2.2.11648.92168 [DOI] [Google Scholar]
11.Lu J, Mao D, Li X, Ma Y, Luan Y, Cao Y, et al. Changes of intestinal microflora diversity in diarrhea model of KM mice and effects of Psidium guajava L. as the treatment agent for diarrhea. J Infect Public Health. 2020;13(1):16–26. doi: 10.1016/j.jiph.2019.04.015 [DOI] [PubMed] [Google Scholar]
12.Gutiérrez RMP, Mitchell S, Solis RV. Psidium guajava: a review of its traditional uses, phytochemistry and pharmacology. J Ethnopharmacol. 2008;117(1):1–27. doi: 10.1016/j.jep.2008.01.025 [DOI] [PubMed] [Google Scholar]
13.Durán-Castañeda AC, Cardenas-Castro AP, Pérez-Jiménez J, Pérez-Carvajal AM, Sánchez-Burgos JA, Mateos R, et al. Bioaccessibility of phenolic compounds in Psidium guajava L. varieties and P. friedrichsthalianum Nied. after gastrointestinal digestion. Food Chem. 2023;400:134046. doi: 10.1016/j.foodchem.2022.134046 [DOI] [PubMed] [Google Scholar]
14.Dike IP, Obembe OO, Adebiyi FE. Ethnobotanical survey for potential anti-malarial plants in south-western Nigeria. J Ethnopharmacol. 2012;144(3):618–26. doi: 10.1016/j.jep.2012.10.002 [DOI] [PubMed] [Google Scholar]
15.Rajendran C, Begam M, Kumar D, Baruah I, Gogoi HK, Srivastava RB, et al. Antiplasmodial activity of certain medicinal plants against chloroquine resistant Plasmodium berghei infected white albino BALB/c mice. J Parasit Dis. 2014;38(2):148–52. doi: 10.1007/s12639-013-0252-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Amadike Ugbogu E, Emmanuel O, Ebubechi Uche M, Dike Dike E, Chukwuebuka Okoro B, Ibe C, et al. The ethnobotanical, phytochemistry and pharmacological activities of Psidium guajava L. Arabian Journal of Chemistry. 2022;15(5):103759. doi: 10.1016/j.arabjc.2022.103759 [DOI] [Google Scholar]
17.Machado AJT, Santos ATL, Martins GMAB, Cruz RP, Costa M do S, Campina FF, et al. Antiparasitic effect of the Psidium guajava L. (guava) and Psidium brownianum MART. EX DC. (araçá-de-veado) extracts. Food Chem Toxicol. 2018;119:275–80. doi: 10.1016/j.fct.2018.03.018 [DOI] [PubMed] [Google Scholar]
18.Flores G, Dastmalchi K, Wu S-B, Whalen K, Dabo AJ, Reynertson KA, et al. Phenolic-rich extract from the Costa Rican guava (Psidium friedrichsthalianum) pulp with antioxidant and anti-inflammatory activity. Potential for COPD therapy. Food Chem. 2013;141(2):889–95. doi: 10.1016/j.foodchem.2013.03.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Medina AL, Haas LIR, Chaves FC, Salvador M, Zambiazi RC, da Silva WP, et al. Araçá (Psidium cattleianum Sabine) fruit extracts with antioxidant and antimicrobial activities and antiproliferative effect on human cancer cells. Food Chemistry. 2011;128(4):916–22. doi: 10.1016/j.foodchem.2011.03.119 [DOI] [Google Scholar]
20.Pereira E dos S, Vinholes JR, Camargo TM, Nora FR, Crizel RL, Chaves F, et al. Characterization of araçá fruits (Psidium cattleianum Sabine): Phenolic composition, antioxidant activity and inhibition of α-amylase and α-glucosidase. Food Bioscience. 2020;37:100665. doi: 10.1016/j.fbio.2020.100665 [DOI] [Google Scholar]
21.Felipe do Nascimento K, Leite Kassuya CA, Pereira Cabral MR, Carvalho Souza RI, Marangoni JA, Mussury Franco Silva RM, et al. Chemical analysis and antioxidant, anti-inflammatory and toxicological evaluations of the hydromethanolic extract of Psidium guineense Swartz leaves. J Ethnopharmacol. 2021;281:114492. doi: 10.1016/j.jep.2021.114492 [DOI] [PubMed] [Google Scholar]
22.Ramos AS, Souza ROS, Boleti AP de A, Bruginski ERD, Lima ES, Campos FR, et al. Chemical characterization and antioxidant capacity of the araçá-pera (Psidium acutangulum): An exotic Amazon fruit. Food Res Int. 2015;75:315–27. doi: 10.1016/j.foodres.2015.06.026 [DOI] [PubMed] [Google Scholar]
23.Takao LK, Imatomi M, Gualtieri SCJ. Antioxidant activity and phenolic content of leaf infusions of Myrtaceae species from Cerrado (Brazilian Savanna). Braz J Biol. 2015;75(4):948–52. doi: 10.1590/1519-6984.03314 [DOI] [PubMed] [Google Scholar]
24.Ferreira Macedo JG, de Oliveira Santos M, Nonato C de FA, Torres Salazar GJ, Galvão Rodrigues FF, Almeida-Bezerra JW, et al. Chemical composition, antioxidant, antibacterial and modulating activity of the essential oil of psidium L. species (Myrtaceae Juss.). Biocatalysis and Agricultural Biotechnology. 2022;42:102363. doi: 10.1016/j.bcab.2022.102363 [DOI] [Google Scholar]
25.dos Santos Rocha T, de Jesus Marques E, do Nascimento CM, Souza RRM, da Costa Silva M, de Souza Neta LC, et al. Chemical and biological profile of Psidium bahianum landrum & funch (Myrtaceae). Braz J Bot. 2021;44(3):537–47. doi: 10.1007/s40415-021-00727-7 [DOI] [Google Scholar]
26.Halim M, Halim A. The effects of inflammation, aging and oxidative stress on the pathogenesis of diabetes mellitus (type 2 diabetes). Diabetes Metab Syndr. 2019;13(2):1165–72. doi: 10.1016/j.dsx.2019.01.040 [DOI] [PubMed] [Google Scholar]
27.Abudawood M, Tabassum H, Almaarik B, Aljohi A. Interrelationship between oxidative stress, DNA damage and cancer risk in diabetes (Type 2) in Riyadh, KSA. Saudi J Biol Sci. 2020;27(1):177–83. doi: 10.1016/j.sjbs.2019.06.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Andreadi A, Bellia A, Di Daniele N, Meloni M, Lauro R, Della-Morte D, et al. The molecular link between oxidative stress, insulin resistance, and type 2 diabetes: A target for new therapies against cardiovascular diseases. Curr Opin Pharmacol. 2022;62:85–96. doi: 10.1016/j.coph.2021.11.010 [DOI] [PubMed] [Google Scholar]
29.Briyal S, Ranjan AK, Gulati A. Oxidative stress: A target to treat Alzheimer’s disease and stroke. Neurochem Int. 2023;165:105509. doi: 10.1016/j.neuint.2023.105509 [DOI] [PubMed] [Google Scholar]
30.Park HS, Kim SR, Lee YC. Impact of oxidative stress on lung diseases. Respirology. 2009;14(1):27–38. doi: 10.1111/j.1440-1843.2008.01447.x [DOI] [PubMed] [Google Scholar]
31.Demirel Ozbek Y, Saral O, Turker PF. Modern and traditional cooking methods affect the antioxidant activity and phenolic compounds content of Trachystemon Orientalis (L.) G. Don. PLoS One. 2024;19(2):e0299037. doi: 10.1371/journal.pone.0299037 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Aryee A, Agyei D, Akanbi T. Food for oxidative stress relief: Polyphenols. 2018. doi: 10.1016/B978-0-12-814026-0.21779-4 [DOI] [Google Scholar]
33.Ferreira Macedo JG, Linhares Rangel JM, de Oliveira Santos M, Camilo CJ, Martins da Costa JG, Maria de Almeida Souza M. Therapeutic indications, chemical composition and biological activity of native Brazilian species from Psidium genus (Myrtaceae): A review. J Ethnopharmacol. 2021;278114248. doi: 10.1016/j.jep.2021.114248 [DOI] [PubMed] [Google Scholar]
34.Macaúbas-Silva C, Félix MDG, Aquino AKS de, Pereira-Júnior PG, Brito EV de O, Oliveira-Filho AA de, et al. Araçain, a tyrosol derivative and other phytochemicals from Psidium guineense Sw. Nat Prod Res. 2021;35(14):2424–8. doi: 10.1080/14786419.2019.1672683 [DOI] [PubMed] [Google Scholar]
35.Venkatachalam RN, Singh K, Marar T. Phytochemical screening in vitro antioxidant activity of psidium guajava. Free Radicals and Antioxidants. 2012;2(1):31–6. doi: 10.5530/ax.2012.2.7 [DOI] [Google Scholar]
36.da Fonsêca BMB, Costa WK, Guimarães Silva VB, Assunção Ferreira MR, Soares LAL, de Oliveira AM, et al. Extract from Psidium guineense Sw leaves: An alternative against resistant strains of Staphylococcus aureus. South African Journal of Botany. 2024;174:850–5. doi: 10.1016/j.sajb.2024.09.017 [DOI] [Google Scholar]
37.Abrao FY, Costa HM da, Fiuza T de S, Romano CA, Ferreira HD, Cunha LC da, et al. Anatomical study of the leaves and evaluation of the chemical composition of the volatile oils from Psidium guineense Swartz leaves and fruits. RSD. 2021;10(6):e49110615929. doi: 10.33448/rsd-v10i6.15929 [DOI] [Google Scholar]
38.Fernandes TG, de Mesquita ARC, Randau KP, Franchitti AA, Ximenes EA. In vitro synergistic effect of Psidium guineense (Swartz) in combination with antimicrobial agents against methicillin-resistant Staphylococcus aureus strains. ScientificWorldJournal. 2012;2012:158237. doi: 10.1100/2012/158237 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.da Veiga Correia VT, da Silva PR, Ribeiro CMS, Ramos ALCC, Mazzinghy AC do C, Silva VDM, et al. An Integrative Review on the Main Flavonoids Found in Some Species of the Myrtaceae Family: Phytochemical Characterization, Health Benefits and Development of Products. Plants (Basel). 2022;11(20):2796. doi: 10.3390/plants11202796 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.do Nascimento KF, Moreira FMF, Alencar Santos J, Kassuya CAL, Croda JHR, Cardoso CAL, et al. Antioxidant, anti-inflammatory, antiproliferative and antimycobacterial activities of the essential oil of Psidium guineense Sw. and spathulenol. J Ethnopharmacol. 2018;210:351–8. doi: 10.1016/j.jep.2017.08.030 [DOI] [PubMed] [Google Scholar]
41.Safhi FA, Alshamrani SM, Bogmaza AFM, El-Moneim DA. DNA Barcoding of Wild Plants with Potential Medicinal Properties from Faifa Mountains in Saudi Arabia. Genes (Basel). 2023;14(2):469. doi: 10.3390/genes14020469 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Cornejo X. Specimen Details - The William & Lynda Steere Herbarium. In: New York Botanical Garden [Internet]. 6 Jun 2015. [cited 5 Jun 2024]. Available from: https://sweetgum.nybg.org/science/vh/specimen-details/?irn=3156114 [Google Scholar]
43.Jackson BD. A Glossary of Botanic Terms with their Derivation and Accent. Nature. 1900;63(1619):28–28. doi: 10.1038/063028b0 [DOI] [Google Scholar]
44.López-Bascón MA MD, L de C. Soxhlet Extraction. 1st ed. In: Poole CF, editor. Liquid-phase extraction. 1st ed. Amsterdam, Netherlands: Elsevier; 2020. p. 796. [Google Scholar]
45.Cuéllar Cuéllar A. y Miranda Martínez M. Farmacognosia y productos naturales. 1st ed. La Habana: Empresa Editorial Poligráfica Félix Varela; 2014. [Google Scholar]
46.Nasrollahi S, Ghoreishi SM, Ebrahimabadi AH, Khoobi A. Gas chromatography-mass spectrometry analysis and antimicrobial, antioxidant and anti-cancer activities of essential oils and extracts of Stachys schtschegleevii plant as biological macromolecules. Int J Biol Macromol. 2019;128:718–23. doi: 10.1016/j.ijbiomac.2019.01.165 [DOI] [PubMed] [Google Scholar]
47.Pacheco Coello R, Pestana Justo J, Factos Mendoza A, Santos Ordoñez E. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food. BMC Res Notes. 2017;10(1):758. doi: 10.1186/s13104-017-3083-x [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One. 2010;5(1):e8613. doi: 10.1371/journal.pone.0008613 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Basak S, Aadi Moolam R, Parida A, Mitra S, Rangan L. Evaluation of rapid molecular diagnostics for differentiating medicinal Kaempferia species from its adulterants. Plant Divers. 2019;41(3):206–11. doi: 10.1016/j.pld.2019.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Costion C, Ford A, Cross H, Crayn D, Harrington M, Lowe A. Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS One. 2011;6(11):e26841. doi: 10.1371/journal.pone.0026841 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Stecher G, Tamura K, Kumar S. Molecular Evolutionary Genetics Analysis (MEGA) for macOS. Mol Biol Evol. 2020;37(4):1237–9. doi: 10.1093/molbev/msz312 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7(1–2):203–14. doi: 10.1089/10665270050081478 [DOI] [PubMed] [Google Scholar]
53.Avramova V, AbdElgawad H, Vasileva I, Petrova AS, Holek A, Mariën J, et al. High Antioxidant Activity Facilitates Maintenance of Cell Division in Leaves of Drought Tolerant Maize Hybrids. Front Plant Sci. 2017;884. doi: 10.3389/fpls.2017.00084 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Viteri R, Giordano A, Montenegro G, Zacconi F. Eucryphia cordifolia extracts: Phytochemical screening, antibacterial and antioxidant activities. Nat Prod Res. 2022;36(16):4177–81. doi: 10.1080/14786419.2021.1960525 [DOI] [PubMed] [Google Scholar]
55.Hozzein WN, Saleh AM, Habeeb TH, Wadaan MAM, AbdElgawad H. CO2 treatment improves the hypocholesterolemic and antioxidant properties of fenugreek seeds. Food Chem. 2020;308:125661. doi: 10.1016/j.foodchem.2019.125661 [DOI] [PubMed] [Google Scholar]
56.Santos JRA, Pereira MLA, Pereira TCJ, Silva HGO, Santos OO, Carvalho GGP, et al. Supplementation with mesquite alkaloids extract in diets for lambs fed Bermuda grass improves growth performance. Small Ruminant Research. 2021;205:106560. doi: 10.1016/j.smallrumres.2021.106560 [DOI] [Google Scholar]
57.de Araújo RL, de Pinho CLC, Farias FO, Igarashi-Mafra L, Mafra MR. Crinum L. species as a potential source of alkaloids: Extraction methods and relevance for medicinal and pharmacological applications. South African Journal of Botany. 2022;151:720–34. doi: 10.1016/j.sajb.2022.10.053 [DOI] [Google Scholar]
58.Gañán J, Martínez-García G, Morante-Zarcero S, Pérez-Quintanilla D, Sierra I. Nanomaterials-modified electrochemical sensors for sensitive determination of alkaloids: Recent trends in the application to biological, pharmaceutical and agri-food samples. Microchemical Journal. 2023;184:108136. doi: 10.1016/j.microc.2022.108136 [DOI] [Google Scholar]
59.Formagio ASN, Volobuff CRF, Santiago M, Cardoso CAL, Vieira M do C, Valdevina Pereira Z. Evaluation of Antioxidant Activity, Total Flavonoids, Tannins and Phenolic Compounds in Psychotria Leaf Extracts. Antioxidants (Basel). 2014;3(4):745–57. doi: 10.3390/antiox3040745 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Kopjar M, Tadić M, Piližota V. Phenol content and antioxidant activity of green, yellow and black tea leaves. Chem Biol Techn Agric. 2015;2(1):1. doi: 10.1186/s40538-014-0028-7 [DOI] [Google Scholar]
61.Tungmunnithum D, Thongboonyou A, Pholboon A, Yangsabai A. Flavonoids and Other Phenolic Compounds from Medicinal Plants for Pharmaceutical and Medical Aspects: An Overview. Medicines (Basel). 2018;5(3):93. doi: 10.3390/medicines5030093 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Abdul M, Taleb M, Asadujjaman M, Tabassum F, Harun M. A review study on the pharmacological effects and mechanism of action of tannins. European Journal of Pharmaceutical and Medical Research. 2021;8. Available from: https://www.researchgate.net/publication/354163529 [Google Scholar]
63.Tong Z, He W, Fan X, Guo A. Biological Function of Plant Tannin and Its Application in Animal Health. Front Vet Sci. 2022;8:803657. doi: 10.3389/fvets.2021.803657 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Sieniawska E. Activities of tannins-from in vitro studies to clinical trials. Natural Products Communications. 2015;10(11). [PubMed] [Google Scholar]
65.Munteanu IG, Apetrei C. Assessment of the Antioxidant Activity of Catechin in Nutraceuticals: Comparison between a Newly Developed Electrochemical Method and Spectrophotometric Methods. Int J Mol Sci. 2022;23(15):8110. doi: 10.3390/ijms23158110 [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Nain CW, Mignolet E, Herent M-F, Quetin-Leclercq J, Debier C, Page MM, et al. The Catechins Profile of Green Tea Extracts Affects the Antioxidant Activity and Degradation of Catechins in DHA-Rich Oil. Antioxidants (Basel). 2022;11(9):1844. doi: 10.3390/antiox11091844 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Sutherland BA, Rahman RMA, Appleton I. Mechanisms of action of green tea catechins, with a focus on ischemia-induced neurodegeneration. J Nutr Biochem. 2006;17(5):291–306. doi: 10.1016/j.jnutbio.2005.10.005 [DOI] [PubMed] [Google Scholar]
68.Saher S, Rehman MH-U-, Imran M, Nadeem M, Abbas F, Atta Khan F, et al. Fatty acids profile, antioxidant activity, lipid oxidation, induction period, and sensory properties of burgers produced from blends of fish and mango kernel oils. International Journal of Food Properties. 2023;26(2):2811–25. doi: 10.1080/10942912.2023.2252206 [DOI] [Google Scholar]
69.Taghvaei M, Jafari SM. Application and stability of natural antioxidants in edible oils in order to substitute synthetic additives. J Food Sci Technol. 2015;52(3):1272–82. doi: 10.1007/s13197-013-1080-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Jordamovc N, Pehlivanovic B, Niksic H, Gusic I, Koric E, Dedic M, et al. Anti-proliferative and anti-inflammatory activity of triterpene extracts from plant species belonging to Lamiaceae family. BLACPMA. 2023;22(6):864–78. doi: 10.37360/blacpma.23.22.6.58 [DOI] [Google Scholar]
71.Nguyen T-D, Nguyen T-H-A, Do T-H, Tran VT-H, Nguyen H-A, Pham D-V. Anti-inflammatory effect of a triterpenoid from Balanophora laxiflora: results of bioactivity-guided isolation. Heliyon. 2022;8(3):e09070. doi: 10.1016/j.heliyon.2022.e09070 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Kokilananthan S, Bulugahapitiya VP, Manawadu H, Gangabadage CS. Sesquiterpenes and monoterpenes from different varieties of guava leaf essential oils and their antioxidant potential. Heliyon. 2022;8(12):e12104. doi: 10.1016/j.heliyon.2022.e12104 [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Hassan EM, El Gendy AE-NG, Abd-ElGawad AM, Elshamy AI, Farag MA, Alamery SF, et al. Comparative Chemical Profiles of the Essential Oils from Different Varieties of Psidium guajava L. Molecules. 2020;26(1):119. doi: 10.3390/molecules26010119 [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Hajam TA, H S. Phytochemistry, biological activities, industrial and traditional uses of fig (Ficus carica): A review. Chem Biol Interact. 2022;368:110237. doi: 10.1016/j.cbi.2022.110237 [DOI] [PubMed] [Google Scholar]
75.Singh R, Kotecha M. A review on the Standardization of herbal medicines. Article in International Journal of Pharma Sciences and Research. 2016. Available from: https://www.researchgate.net/publication/298426911 [Google Scholar]
76.Rai MK, Phulwaria M, Shekhawat NS. Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Mol Biol Rep. 2013;40(8):5067–71. doi: 10.1007/s11033-013-2608-1 [DOI] [PubMed] [Google Scholar]
77.Urquía D, Gutierrez B, Pozo G, Pozo MJ, Espín A, Torres M de L. Psidium guajava in the Galapagos Islands: Population genetics and history of an invasive species. PLoS One. 2019;14(3):e0203737. doi: 10.1371/journal.pone.0203737 [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Kumar C, Kumar R, Singh SK, Goswami AK, Nagaraja A, Paliwal R, et al. Development of novel g-SSR markers in guava (Psidium guajava L.) cv. Allahabad Safeda and their application in genetic diversity, population structure and cross species transferability studies. PLoS One. 2020;15(8):e0237538. doi: 10.1371/journal.pone.0237538 [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Thakur S, Yadav IS, Jindal M, Sharma PK, Dhillon GS, Boora RS, et al. Development of Genome-Wide Functional Markers Using Draft Genome Assembly of Guava (Psidium guajava L.) cv. Allahabad Safeda to Expedite Molecular Breeding. Front Plant Sci. 2021;12:708332. doi: 10.3389/fpls.2021.708332 [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Mittal A, Yadav IS, Arora NK, Boora RS, Mittal M, Kaur P, et al. RNA-sequencing based gene expression landscape of guava cv. Allahabad Safeda and comparative analysis to colored cultivars. BMC Genomics. 2020;21(1):484. doi: 10.1186/s12864-020-06883-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Techen N, Parveen I, Pan Z, Khan IA. DNA barcoding of medicinal plant material for identification. Curr Opin Biotechnol. 2014;25103–10. doi: 10.1016/j.copbio.2013.09.010 [DOI] [PubMed] [Google Scholar]
82.Zhang D, Jiang B, Duan L, Zhou N. Internal transcribed spacer (ITS), an ideal DNA barcode for species discrimination in crawfurdia wall. (GENTIANACEAE). Afr J Tradit Complement Altern Med. 2016;101–106. doi: 10.21010/ajtcam [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Bustamante K, Santos-Ordóñez E, Miranda M, Pacheco R, Gutiérrez Y, Scull R. Morphological and molecular barcode analysis of the medicinal tree Mimusops coriacea (A.DC.) Miq. collected in Ecuador. PeerJ. 2019;7:e7789. doi: 10.7717/peerj.7789 [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Sarmiento-Tomalá G, Santos-Ordóñez E, Miranda-Martínez M, Pacheco-Coello R, Scull-Lizama R, Gutiérrez-Gaitén Y, et al. Short Communication: Molecular barcode and morphology analysis of Malva pseudolavatera Webb & Berthel and Malva sylvestris L. from Ecuador. Biodiversitas. 2020;21(8). doi: 10.13057/biodiv/d210818 [DOI] [Google Scholar]
85.Soledispa P, Santos-Ordóñez E, Miranda M, Pacheco R, Gutiérrez Gaiten YI, Scull R. Molecular barcode and morphological analysis of Smilax purhampuy Ruiz, Ecuador. PeerJ. 2021;9:e11028. doi: 10.7717/peerj.11028 [DOI] [PMC free article] [PubMed] [Google Scholar]
86.María R, Shirley M, Xavier C, Jaime S, David V, Rosa S, et al. Preliminary phytochemical screening, total phenolic content and antibacterial activity of thirteen native species from Guayas province Ecuador. Journal of King Saud University - Science. 2018;30(4):500–5. doi: 10.1016/j.jksus.2017.03.009 [DOI] [Google Scholar]
87.Senanayake CM, Hapugaswatta H, Jayathilaka N, Seneviratne KN. Phenolic extracts of the leaves ofPsidium guineenseSw. improve the shelf life of sunflower oil and baked cake and antioxidant status of Wistar rats. J Food Biochem. 2018;42(6). doi: 10.1111/jfbc.12632 [DOI] [Google Scholar]
88.Wołosiak R, Drużyńska B, Derewiaka D, Piecyk M, Majewska E, Ciecierska M, et al. Verification of the Conditions for Determination of Antioxidant Activity by ABTS and DPPH Assays-A Practical Approach. Molecules. 2021;27(1):50. doi: 10.3390/molecules27010050 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Blastn analysis for nine different DNA barcodes of Psidium guineense plants (CIBE-019, CIBE-020, CIBE-021). Results were ranked for the first two with the highest percentage of identity.

(XLSX)

pone.0319524.s001.xls^{(49.5KB, xls)}

S1 Fig. Phylogenetic trees of Psidium guineense from Ecuador.

(TIF)

pone.0319524.s002.tif^{(468.7KB, tif)}

S2 Table. Total Phenolic and Flavonoid Content-Antioxidant Activity of Psidium guineense.

(XLSX)

pone.0319524.s003.xlsx^{(57.9KB, xlsx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0319524.ref001] 1.Mittermeier RA, Turner WR, Larsen FW, Brooks TM, Gascon C. Global Biodiversity Conservation: The Critical Role of Hotspots. Biodiversity Hotspots. Springer Berlin Heidelberg; 2011. pp. 3–22. doi: 10.1007/978-3-642-20992-5_1 [DOI] [Google Scholar]

[pone.0319524.ref002] 2.Kleemann J, Koo H, Hensen I, Mendieta-Leiva G, Kahnt B, Kurze C, et al. Priorities of action and research for the protection of biodiversity and ecosystem services in continental Ecuador. Biological Conservation. 2022;265:109404. doi: 10.1016/j.biocon.2021.109404 [DOI] [Google Scholar]

[pone.0319524.ref003] 3.Cuesta F, Peralvo M, Merino-Viteri A, Bustamante M, Baquero F, Freile JF, et al. Priority areas for biodiversity conservation in mainland Ecuador. Neotropical Biodiversity. 2017;3(1):93–106. doi: 10.1080/23766808.2017.1295705 [DOI] [Google Scholar]

[pone.0319524.ref004] 4.Torri MC. Perceptions and uses of plants for reproductive health among traditional midwives in Ecuador: moving towards intercultural pharmacological practices. Midwifery. 2013;29(7):809–17. doi: 10.1016/j.midw.2012.06.018 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref005] 5.Nybg, Herbarium S. No Title. 2016. Available from: http://sweetgum.nybg.org/science/vh/specimen-details/?irn=3156114 [Google Scholar]

[pone.0319524.ref006] 6.López-Bascón MA, Luque de Castro MD. Soxhlet Extraction. Liquid-Phase Extraction. 2020:327–54. doi: 10.1016/b978-0-12-816911-7.00011-6 [DOI] [Google Scholar]

[pone.0319524.ref007] 7.Valera-Montero LL, Enríquez-Nava S, Silos-Espino H, Padilla-Ramírez JS, Perales Segovia C, Flores-Benítez S. Propiedades fisicoquímicas de guayabilla (Psidium guineense), arrayán (Psidium sartorianum) y guayaba (Psidium guajava). Remexca. 2018;9(6):1099–108. doi: 10.29312/remexca.v9i6.1576 [DOI] [Google Scholar]

[pone.0319524.ref008] 8.Barroso AS, Massing LT, Suemitsu C, Mourão RHV, Figueiredo PLB, Maia JGS. Volatile Constituents of Some Myrtaceous Edible and Medicinal Fruits from the Brazilian Amazon. Foods. 2024;13(10):1490. doi: 10.3390/foods13101490 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref009] 9.French B, Maynard A. Food Plants International Database. 2022 Nov. Available from: https://foodplantsinternational.com/ [Google Scholar]

[pone.0319524.ref010] 10.Eladio J, Loría-Coto M. Illustrative guide to brazilian guava (Psidium guineense). 2023. doi: 10.13140/RG.2.2.11648.92168 [DOI] [Google Scholar]

[pone.0319524.ref011] 11.Lu J, Mao D, Li X, Ma Y, Luan Y, Cao Y, et al. Changes of intestinal microflora diversity in diarrhea model of KM mice and effects of Psidium guajava L. as the treatment agent for diarrhea. J Infect Public Health. 2020;13(1):16–26. doi: 10.1016/j.jiph.2019.04.015 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref012] 12.Gutiérrez RMP, Mitchell S, Solis RV. Psidium guajava: a review of its traditional uses, phytochemistry and pharmacology. J Ethnopharmacol. 2008;117(1):1–27. doi: 10.1016/j.jep.2008.01.025 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref013] 13.Durán-Castañeda AC, Cardenas-Castro AP, Pérez-Jiménez J, Pérez-Carvajal AM, Sánchez-Burgos JA, Mateos R, et al. Bioaccessibility of phenolic compounds in Psidium guajava L. varieties and P. friedrichsthalianum Nied. after gastrointestinal digestion. Food Chem. 2023;400:134046. doi: 10.1016/j.foodchem.2022.134046 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref014] 14.Dike IP, Obembe OO, Adebiyi FE. Ethnobotanical survey for potential anti-malarial plants in south-western Nigeria. J Ethnopharmacol. 2012;144(3):618–26. doi: 10.1016/j.jep.2012.10.002 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref015] 15.Rajendran C, Begam M, Kumar D, Baruah I, Gogoi HK, Srivastava RB, et al. Antiplasmodial activity of certain medicinal plants against chloroquine resistant Plasmodium berghei infected white albino BALB/c mice. J Parasit Dis. 2014;38(2):148–52. doi: 10.1007/s12639-013-0252-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref016] 16.Amadike Ugbogu E, Emmanuel O, Ebubechi Uche M, Dike Dike E, Chukwuebuka Okoro B, Ibe C, et al. The ethnobotanical, phytochemistry and pharmacological activities of Psidium guajava L. Arabian Journal of Chemistry. 2022;15(5):103759. doi: 10.1016/j.arabjc.2022.103759 [DOI] [Google Scholar]

[pone.0319524.ref017] 17.Machado AJT, Santos ATL, Martins GMAB, Cruz RP, Costa M do S, Campina FF, et al. Antiparasitic effect of the Psidium guajava L. (guava) and Psidium brownianum MART. EX DC. (araçá-de-veado) extracts. Food Chem Toxicol. 2018;119:275–80. doi: 10.1016/j.fct.2018.03.018 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref018] 18.Flores G, Dastmalchi K, Wu S-B, Whalen K, Dabo AJ, Reynertson KA, et al. Phenolic-rich extract from the Costa Rican guava (Psidium friedrichsthalianum) pulp with antioxidant and anti-inflammatory activity. Potential for COPD therapy. Food Chem. 2013;141(2):889–95. doi: 10.1016/j.foodchem.2013.03.025 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref019] 19.Medina AL, Haas LIR, Chaves FC, Salvador M, Zambiazi RC, da Silva WP, et al. Araçá (Psidium cattleianum Sabine) fruit extracts with antioxidant and antimicrobial activities and antiproliferative effect on human cancer cells. Food Chemistry. 2011;128(4):916–22. doi: 10.1016/j.foodchem.2011.03.119 [DOI] [Google Scholar]

[pone.0319524.ref020] 20.Pereira E dos S, Vinholes JR, Camargo TM, Nora FR, Crizel RL, Chaves F, et al. Characterization of araçá fruits (Psidium cattleianum Sabine): Phenolic composition, antioxidant activity and inhibition of α-amylase and α-glucosidase. Food Bioscience. 2020;37:100665. doi: 10.1016/j.fbio.2020.100665 [DOI] [Google Scholar]

[pone.0319524.ref021] 21.Felipe do Nascimento K, Leite Kassuya CA, Pereira Cabral MR, Carvalho Souza RI, Marangoni JA, Mussury Franco Silva RM, et al. Chemical analysis and antioxidant, anti-inflammatory and toxicological evaluations of the hydromethanolic extract of Psidium guineense Swartz leaves. J Ethnopharmacol. 2021;281:114492. doi: 10.1016/j.jep.2021.114492 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref022] 22.Ramos AS, Souza ROS, Boleti AP de A, Bruginski ERD, Lima ES, Campos FR, et al. Chemical characterization and antioxidant capacity of the araçá-pera (Psidium acutangulum): An exotic Amazon fruit. Food Res Int. 2015;75:315–27. doi: 10.1016/j.foodres.2015.06.026 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref023] 23.Takao LK, Imatomi M, Gualtieri SCJ. Antioxidant activity and phenolic content of leaf infusions of Myrtaceae species from Cerrado (Brazilian Savanna). Braz J Biol. 2015;75(4):948–52. doi: 10.1590/1519-6984.03314 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref024] 24.Ferreira Macedo JG, de Oliveira Santos M, Nonato C de FA, Torres Salazar GJ, Galvão Rodrigues FF, Almeida-Bezerra JW, et al. Chemical composition, antioxidant, antibacterial and modulating activity of the essential oil of psidium L. species (Myrtaceae Juss.). Biocatalysis and Agricultural Biotechnology. 2022;42:102363. doi: 10.1016/j.bcab.2022.102363 [DOI] [Google Scholar]

[pone.0319524.ref025] 25.dos Santos Rocha T, de Jesus Marques E, do Nascimento CM, Souza RRM, da Costa Silva M, de Souza Neta LC, et al. Chemical and biological profile of Psidium bahianum landrum & funch (Myrtaceae). Braz J Bot. 2021;44(3):537–47. doi: 10.1007/s40415-021-00727-7 [DOI] [Google Scholar]

[pone.0319524.ref026] 26.Halim M, Halim A. The effects of inflammation, aging and oxidative stress on the pathogenesis of diabetes mellitus (type 2 diabetes). Diabetes Metab Syndr. 2019;13(2):1165–72. doi: 10.1016/j.dsx.2019.01.040 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref027] 27.Abudawood M, Tabassum H, Almaarik B, Aljohi A. Interrelationship between oxidative stress, DNA damage and cancer risk in diabetes (Type 2) in Riyadh, KSA. Saudi J Biol Sci. 2020;27(1):177–83. doi: 10.1016/j.sjbs.2019.06.015 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref028] 28.Andreadi A, Bellia A, Di Daniele N, Meloni M, Lauro R, Della-Morte D, et al. The molecular link between oxidative stress, insulin resistance, and type 2 diabetes: A target for new therapies against cardiovascular diseases. Curr Opin Pharmacol. 2022;62:85–96. doi: 10.1016/j.coph.2021.11.010 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref029] 29.Briyal S, Ranjan AK, Gulati A. Oxidative stress: A target to treat Alzheimer’s disease and stroke. Neurochem Int. 2023;165:105509. doi: 10.1016/j.neuint.2023.105509 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref030] 30.Park HS, Kim SR, Lee YC. Impact of oxidative stress on lung diseases. Respirology. 2009;14(1):27–38. doi: 10.1111/j.1440-1843.2008.01447.x [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref031] 31.Demirel Ozbek Y, Saral O, Turker PF. Modern and traditional cooking methods affect the antioxidant activity and phenolic compounds content of Trachystemon Orientalis (L.) G. Don. PLoS One. 2024;19(2):e0299037. doi: 10.1371/journal.pone.0299037 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref032] 32.Aryee A, Agyei D, Akanbi T. Food for oxidative stress relief: Polyphenols. 2018. doi: 10.1016/B978-0-12-814026-0.21779-4 [DOI] [Google Scholar]

[pone.0319524.ref033] 33.Ferreira Macedo JG, Linhares Rangel JM, de Oliveira Santos M, Camilo CJ, Martins da Costa JG, Maria de Almeida Souza M. Therapeutic indications, chemical composition and biological activity of native Brazilian species from Psidium genus (Myrtaceae): A review. J Ethnopharmacol. 2021;278114248. doi: 10.1016/j.jep.2021.114248 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref034] 34.Macaúbas-Silva C, Félix MDG, Aquino AKS de, Pereira-Júnior PG, Brito EV de O, Oliveira-Filho AA de, et al. Araçain, a tyrosol derivative and other phytochemicals from Psidium guineense Sw. Nat Prod Res. 2021;35(14):2424–8. doi: 10.1080/14786419.2019.1672683 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref035] 35.Venkatachalam RN, Singh K, Marar T. Phytochemical screening in vitro antioxidant activity of psidium guajava. Free Radicals and Antioxidants. 2012;2(1):31–6. doi: 10.5530/ax.2012.2.7 [DOI] [Google Scholar]

[pone.0319524.ref036] 36.da Fonsêca BMB, Costa WK, Guimarães Silva VB, Assunção Ferreira MR, Soares LAL, de Oliveira AM, et al. Extract from Psidium guineense Sw leaves: An alternative against resistant strains of Staphylococcus aureus. South African Journal of Botany. 2024;174:850–5. doi: 10.1016/j.sajb.2024.09.017 [DOI] [Google Scholar]

[pone.0319524.ref037] 37.Abrao FY, Costa HM da, Fiuza T de S, Romano CA, Ferreira HD, Cunha LC da, et al. Anatomical study of the leaves and evaluation of the chemical composition of the volatile oils from Psidium guineense Swartz leaves and fruits. RSD. 2021;10(6):e49110615929. doi: 10.33448/rsd-v10i6.15929 [DOI] [Google Scholar]

[pone.0319524.ref038] 38.Fernandes TG, de Mesquita ARC, Randau KP, Franchitti AA, Ximenes EA. In vitro synergistic effect of Psidium guineense (Swartz) in combination with antimicrobial agents against methicillin-resistant Staphylococcus aureus strains. ScientificWorldJournal. 2012;2012:158237. doi: 10.1100/2012/158237 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref039] 39.da Veiga Correia VT, da Silva PR, Ribeiro CMS, Ramos ALCC, Mazzinghy AC do C, Silva VDM, et al. An Integrative Review on the Main Flavonoids Found in Some Species of the Myrtaceae Family: Phytochemical Characterization, Health Benefits and Development of Products. Plants (Basel). 2022;11(20):2796. doi: 10.3390/plants11202796 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref040] 40.do Nascimento KF, Moreira FMF, Alencar Santos J, Kassuya CAL, Croda JHR, Cardoso CAL, et al. Antioxidant, anti-inflammatory, antiproliferative and antimycobacterial activities of the essential oil of Psidium guineense Sw. and spathulenol. J Ethnopharmacol. 2018;210:351–8. doi: 10.1016/j.jep.2017.08.030 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref041] 41.Safhi FA, Alshamrani SM, Bogmaza AFM, El-Moneim DA. DNA Barcoding of Wild Plants with Potential Medicinal Properties from Faifa Mountains in Saudi Arabia. Genes (Basel). 2023;14(2):469. doi: 10.3390/genes14020469 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref042] 42.Cornejo X. Specimen Details - The William & Lynda Steere Herbarium. In: New York Botanical Garden [Internet]. 6 Jun 2015. [cited 5 Jun 2024]. Available from: https://sweetgum.nybg.org/science/vh/specimen-details/?irn=3156114 [Google Scholar]

[pone.0319524.ref043] 43.Jackson BD. A Glossary of Botanic Terms with their Derivation and Accent. Nature. 1900;63(1619):28–28. doi: 10.1038/063028b0 [DOI] [Google Scholar]

[pone.0319524.ref044] 44.López-Bascón MA MD, L de C. Soxhlet Extraction. 1st ed. In: Poole CF, editor. Liquid-phase extraction. 1st ed. Amsterdam, Netherlands: Elsevier; 2020. p. 796. [Google Scholar]

[pone.0319524.ref045] 45.Cuéllar Cuéllar A. y Miranda Martínez M. Farmacognosia y productos naturales. 1st ed. La Habana: Empresa Editorial Poligráfica Félix Varela; 2014. [Google Scholar]

[pone.0319524.ref046] 46.Nasrollahi S, Ghoreishi SM, Ebrahimabadi AH, Khoobi A. Gas chromatography-mass spectrometry analysis and antimicrobial, antioxidant and anti-cancer activities of essential oils and extracts of Stachys schtschegleevii plant as biological macromolecules. Int J Biol Macromol. 2019;128:718–23. doi: 10.1016/j.ijbiomac.2019.01.165 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref047] 47.Pacheco Coello R, Pestana Justo J, Factos Mendoza A, Santos Ordoñez E. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food. BMC Res Notes. 2017;10(1):758. doi: 10.1186/s13104-017-3083-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref048] 48.Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One. 2010;5(1):e8613. doi: 10.1371/journal.pone.0008613 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref049] 49.Basak S, Aadi Moolam R, Parida A, Mitra S, Rangan L. Evaluation of rapid molecular diagnostics for differentiating medicinal Kaempferia species from its adulterants. Plant Divers. 2019;41(3):206–11. doi: 10.1016/j.pld.2019.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref050] 50.Costion C, Ford A, Cross H, Crayn D, Harrington M, Lowe A. Plant DNA barcodes can accurately estimate species richness in poorly known floras. PLoS One. 2011;6(11):e26841. doi: 10.1371/journal.pone.0026841 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref051] 51.Stecher G, Tamura K, Kumar S. Molecular Evolutionary Genetics Analysis (MEGA) for macOS. Mol Biol Evol. 2020;37(4):1237–9. doi: 10.1093/molbev/msz312 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref052] 52.Zhang Z, Schwartz S, Wagner L, Miller W. A greedy algorithm for aligning DNA sequences. J Comput Biol. 2000;7(1–2):203–14. doi: 10.1089/10665270050081478 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref053] 53.Avramova V, AbdElgawad H, Vasileva I, Petrova AS, Holek A, Mariën J, et al. High Antioxidant Activity Facilitates Maintenance of Cell Division in Leaves of Drought Tolerant Maize Hybrids. Front Plant Sci. 2017;884. doi: 10.3389/fpls.2017.00084 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref054] 54.Viteri R, Giordano A, Montenegro G, Zacconi F. Eucryphia cordifolia extracts: Phytochemical screening, antibacterial and antioxidant activities. Nat Prod Res. 2022;36(16):4177–81. doi: 10.1080/14786419.2021.1960525 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref055] 55.Hozzein WN, Saleh AM, Habeeb TH, Wadaan MAM, AbdElgawad H. CO2 treatment improves the hypocholesterolemic and antioxidant properties of fenugreek seeds. Food Chem. 2020;308:125661. doi: 10.1016/j.foodchem.2019.125661 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref056] 56.Santos JRA, Pereira MLA, Pereira TCJ, Silva HGO, Santos OO, Carvalho GGP, et al. Supplementation with mesquite alkaloids extract in diets for lambs fed Bermuda grass improves growth performance. Small Ruminant Research. 2021;205:106560. doi: 10.1016/j.smallrumres.2021.106560 [DOI] [Google Scholar]

[pone.0319524.ref057] 57.de Araújo RL, de Pinho CLC, Farias FO, Igarashi-Mafra L, Mafra MR. Crinum L. species as a potential source of alkaloids: Extraction methods and relevance for medicinal and pharmacological applications. South African Journal of Botany. 2022;151:720–34. doi: 10.1016/j.sajb.2022.10.053 [DOI] [Google Scholar]

[pone.0319524.ref058] 58.Gañán J, Martínez-García G, Morante-Zarcero S, Pérez-Quintanilla D, Sierra I. Nanomaterials-modified electrochemical sensors for sensitive determination of alkaloids: Recent trends in the application to biological, pharmaceutical and agri-food samples. Microchemical Journal. 2023;184:108136. doi: 10.1016/j.microc.2022.108136 [DOI] [Google Scholar]

[pone.0319524.ref059] 59.Formagio ASN, Volobuff CRF, Santiago M, Cardoso CAL, Vieira M do C, Valdevina Pereira Z. Evaluation of Antioxidant Activity, Total Flavonoids, Tannins and Phenolic Compounds in Psychotria Leaf Extracts. Antioxidants (Basel). 2014;3(4):745–57. doi: 10.3390/antiox3040745 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref060] 60.Kopjar M, Tadić M, Piližota V. Phenol content and antioxidant activity of green, yellow and black tea leaves. Chem Biol Techn Agric. 2015;2(1):1. doi: 10.1186/s40538-014-0028-7 [DOI] [Google Scholar]

[pone.0319524.ref061] 61.Tungmunnithum D, Thongboonyou A, Pholboon A, Yangsabai A. Flavonoids and Other Phenolic Compounds from Medicinal Plants for Pharmaceutical and Medical Aspects: An Overview. Medicines (Basel). 2018;5(3):93. doi: 10.3390/medicines5030093 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref062] 62.Abdul M, Taleb M, Asadujjaman M, Tabassum F, Harun M. A review study on the pharmacological effects and mechanism of action of tannins. European Journal of Pharmaceutical and Medical Research. 2021;8. Available from: https://www.researchgate.net/publication/354163529 [Google Scholar]

[pone.0319524.ref063] 63.Tong Z, He W, Fan X, Guo A. Biological Function of Plant Tannin and Its Application in Animal Health. Front Vet Sci. 2022;8:803657. doi: 10.3389/fvets.2021.803657 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref064] 64.Sieniawska E. Activities of tannins-from in vitro studies to clinical trials. Natural Products Communications. 2015;10(11). [PubMed] [Google Scholar]

[pone.0319524.ref065] 65.Munteanu IG, Apetrei C. Assessment of the Antioxidant Activity of Catechin in Nutraceuticals: Comparison between a Newly Developed Electrochemical Method and Spectrophotometric Methods. Int J Mol Sci. 2022;23(15):8110. doi: 10.3390/ijms23158110 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref066] 66.Nain CW, Mignolet E, Herent M-F, Quetin-Leclercq J, Debier C, Page MM, et al. The Catechins Profile of Green Tea Extracts Affects the Antioxidant Activity and Degradation of Catechins in DHA-Rich Oil. Antioxidants (Basel). 2022;11(9):1844. doi: 10.3390/antiox11091844 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref067] 67.Sutherland BA, Rahman RMA, Appleton I. Mechanisms of action of green tea catechins, with a focus on ischemia-induced neurodegeneration. J Nutr Biochem. 2006;17(5):291–306. doi: 10.1016/j.jnutbio.2005.10.005 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref068] 68.Saher S, Rehman MH-U-, Imran M, Nadeem M, Abbas F, Atta Khan F, et al. Fatty acids profile, antioxidant activity, lipid oxidation, induction period, and sensory properties of burgers produced from blends of fish and mango kernel oils. International Journal of Food Properties. 2023;26(2):2811–25. doi: 10.1080/10942912.2023.2252206 [DOI] [Google Scholar]

[pone.0319524.ref069] 69.Taghvaei M, Jafari SM. Application and stability of natural antioxidants in edible oils in order to substitute synthetic additives. J Food Sci Technol. 2015;52(3):1272–82. doi: 10.1007/s13197-013-1080-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref070] 70.Jordamovc N, Pehlivanovic B, Niksic H, Gusic I, Koric E, Dedic M, et al. Anti-proliferative and anti-inflammatory activity of triterpene extracts from plant species belonging to Lamiaceae family. BLACPMA. 2023;22(6):864–78. doi: 10.37360/blacpma.23.22.6.58 [DOI] [Google Scholar]

[pone.0319524.ref071] 71.Nguyen T-D, Nguyen T-H-A, Do T-H, Tran VT-H, Nguyen H-A, Pham D-V. Anti-inflammatory effect of a triterpenoid from Balanophora laxiflora: results of bioactivity-guided isolation. Heliyon. 2022;8(3):e09070. doi: 10.1016/j.heliyon.2022.e09070 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref072] 72.Kokilananthan S, Bulugahapitiya VP, Manawadu H, Gangabadage CS. Sesquiterpenes and monoterpenes from different varieties of guava leaf essential oils and their antioxidant potential. Heliyon. 2022;8(12):e12104. doi: 10.1016/j.heliyon.2022.e12104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref073] 73.Hassan EM, El Gendy AE-NG, Abd-ElGawad AM, Elshamy AI, Farag MA, Alamery SF, et al. Comparative Chemical Profiles of the Essential Oils from Different Varieties of Psidium guajava L. Molecules. 2020;26(1):119. doi: 10.3390/molecules26010119 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref074] 74.Hajam TA, H S. Phytochemistry, biological activities, industrial and traditional uses of fig (Ficus carica): A review. Chem Biol Interact. 2022;368:110237. doi: 10.1016/j.cbi.2022.110237 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref075] 75.Singh R, Kotecha M. A review on the Standardization of herbal medicines. Article in International Journal of Pharma Sciences and Research. 2016. Available from: https://www.researchgate.net/publication/298426911 [Google Scholar]

[pone.0319524.ref076] 76.Rai MK, Phulwaria M, Shekhawat NS. Transferability of simple sequence repeat (SSR) markers developed in guava (Psidium guajava L.) to four Myrtaceae species. Mol Biol Rep. 2013;40(8):5067–71. doi: 10.1007/s11033-013-2608-1 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref077] 77.Urquía D, Gutierrez B, Pozo G, Pozo MJ, Espín A, Torres M de L. Psidium guajava in the Galapagos Islands: Population genetics and history of an invasive species. PLoS One. 2019;14(3):e0203737. doi: 10.1371/journal.pone.0203737 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref078] 78.Kumar C, Kumar R, Singh SK, Goswami AK, Nagaraja A, Paliwal R, et al. Development of novel g-SSR markers in guava (Psidium guajava L.) cv. Allahabad Safeda and their application in genetic diversity, population structure and cross species transferability studies. PLoS One. 2020;15(8):e0237538. doi: 10.1371/journal.pone.0237538 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref079] 79.Thakur S, Yadav IS, Jindal M, Sharma PK, Dhillon GS, Boora RS, et al. Development of Genome-Wide Functional Markers Using Draft Genome Assembly of Guava (Psidium guajava L.) cv. Allahabad Safeda to Expedite Molecular Breeding. Front Plant Sci. 2021;12:708332. doi: 10.3389/fpls.2021.708332 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref080] 80.Mittal A, Yadav IS, Arora NK, Boora RS, Mittal M, Kaur P, et al. RNA-sequencing based gene expression landscape of guava cv. Allahabad Safeda and comparative analysis to colored cultivars. BMC Genomics. 2020;21(1):484. doi: 10.1186/s12864-020-06883-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref081] 81.Techen N, Parveen I, Pan Z, Khan IA. DNA barcoding of medicinal plant material for identification. Curr Opin Biotechnol. 2014;25103–10. doi: 10.1016/j.copbio.2013.09.010 [DOI] [PubMed] [Google Scholar]

[pone.0319524.ref082] 82.Zhang D, Jiang B, Duan L, Zhou N. Internal transcribed spacer (ITS), an ideal DNA barcode for species discrimination in crawfurdia wall. (GENTIANACEAE). Afr J Tradit Complement Altern Med. 2016;101–106. doi: 10.21010/ajtcam [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref083] 83.Bustamante K, Santos-Ordóñez E, Miranda M, Pacheco R, Gutiérrez Y, Scull R. Morphological and molecular barcode analysis of the medicinal tree Mimusops coriacea (A.DC.) Miq. collected in Ecuador. PeerJ. 2019;7:e7789. doi: 10.7717/peerj.7789 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref084] 84.Sarmiento-Tomalá G, Santos-Ordóñez E, Miranda-Martínez M, Pacheco-Coello R, Scull-Lizama R, Gutiérrez-Gaitén Y, et al. Short Communication: Molecular barcode and morphology analysis of Malva pseudolavatera Webb & Berthel and Malva sylvestris L. from Ecuador. Biodiversitas. 2020;21(8). doi: 10.13057/biodiv/d210818 [DOI] [Google Scholar]

[pone.0319524.ref085] 85.Soledispa P, Santos-Ordóñez E, Miranda M, Pacheco R, Gutiérrez Gaiten YI, Scull R. Molecular barcode and morphological analysis of Smilax purhampuy Ruiz, Ecuador. PeerJ. 2021;9:e11028. doi: 10.7717/peerj.11028 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0319524.ref086] 86.María R, Shirley M, Xavier C, Jaime S, David V, Rosa S, et al. Preliminary phytochemical screening, total phenolic content and antibacterial activity of thirteen native species from Guayas province Ecuador. Journal of King Saud University - Science. 2018;30(4):500–5. doi: 10.1016/j.jksus.2017.03.009 [DOI] [Google Scholar]

[pone.0319524.ref087] 87.Senanayake CM, Hapugaswatta H, Jayathilaka N, Seneviratne KN. Phenolic extracts of the leaves ofPsidium guineenseSw. improve the shelf life of sunflower oil and baked cake and antioxidant status of Wistar rats. J Food Biochem. 2018;42(6). doi: 10.1111/jfbc.12632 [DOI] [Google Scholar]

[pone.0319524.ref088] 88.Wołosiak R, Drużyńska B, Derewiaka D, Piecyk M, Majewska E, Ciecierska M, et al. Verification of the Conditions for Determination of Antioxidant Activity by ABTS and DPPH Assays-A Practical Approach. Molecules. 2021;27(1):50. doi: 10.3390/molecules27010050 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

DNA Barcode, chemical analysis, and antioxidant activity of Psidium guineense from Ecuador

Joel Eduardo Vielma-Puente

Efrén Santos-Ordóñez

Xavier Cornejo

Iván Chóez-Guaranda

Ricardo Pacheco-Coello

Liliana Villao-Uzho

Christian Moreno-Alvarado

Natalia Mendoza-Samaniego

Yuraima Fonseca

Roles

Abstract

Introduction

Methods

Reagents

Plant material

Morphological analysis

Solvent extraction by Soxhlet apparatus

Qualitative phytochemical screening

GC-MS analysis

DNA extraction and PCR

Table 1. Primers used for PCR amplification of the DNA barcodes psbA-trnH spacer, psbK-psbI spacer, rpoB, rpoC1, atpF-atpH spacer, rbcL, matK, and ITS2.

Bioinformatics analysis of sequences

Total phenolic content

Total flavonoid content

Antioxidant activity

ABTS radical cation inhibition assay.

DPPH radical scavenging assay.

Ferric reducing antioxidant power (FRAP) assay.

Results and discussion

Morphological evaluation

Qualitative phytochemical screening

Table 2. Qualitative phytochemical screening of P. guineense in ethereal, alcoholic, and aqueous extracts.

GC-MS analysis

Table 3. Compounds detected by GC-MS.

DNA barcode analysis

Fig 1. Phylogenetic tree of the psbA-trnH barcode with accessions from the genus Psidium spp. and different genera selected from the blastn results.

Fig 2. Phylogenetic tree of the rpoB barcode with accessions from the genus Psidium spp. and different genera selected from the blastn results.

Fig 3. Phylogenetic tree of the rbcL barcode with accessions from the genus Psidium spp. and different genera selected from the blastn results.

Fig 4. Phylogenetic tree of the matK barcode with accessions from the genus Psidium spp. and different genera selected from the blastn results.

Fig 5. Phylogenetic tree of the ITS1 barcode with accessions from the genus Psidium spp. and different genera selected from the blastn results.

Total phenolics and flavonoids content and antioxidant activity

Table 4. Antioxidant activity of Psidium species aqueous extracts.

Conclusion

Supporting information

Data Availability

Funding Statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases