Epidemiology and molecular characterisation of multidrug-resistant Escherichia coli isolated from chicken meat

Hamida Khanom; Chandan Nath; Philip P Mshelbwala; Md Ridoan Pasha; Ricardo Soares Magalhaes; John I Alawneh; Mohammad Mahmudul Hassan

doi:10.1371/journal.pone.0323909

. 2025 May 14;20(5):e0323909. doi: 10.1371/journal.pone.0323909

Epidemiology and molecular characterisation of multidrug-resistant Escherichia coli isolated from chicken meat

Hamida Khanom ^1,², Chandan Nath ¹, Philip P Mshelbwala ³, Md Ridoan Pasha ¹, Ricardo Soares Magalhaes ^4,⁵, John I Alawneh ⁶, Mohammad Mahmudul Hassan ^1,^4,^*

Editor: Mabel Kamweli Aworh⁷

PMCID: PMC12077676 PMID: 40367070

Abstract

Ensuring the safety of poultry products is critical for public health, particularly due to the rising concern of antimicrobial resistance (AMR) in foodborne pathogens. This study aimed to investigate the prevalence and antimicrobial resistance (AMR) patterns of Escherichia coli (E. coli) isolated from broiler chicken meat samples collected from live bird markets (LBMs) and supermarkets (SMs) in the Chattogram Metropolitan Area (CMA), Bangladesh. A total of 430 samples, comprising 215 liver and 215 muscle samples, were collected between October 2020 and February 2021 from nine LBMs and five SMs. Samples were processed and cultured, and E. coli was isolated and identified through phenotypic and molecular techniques, including PCR targeting the uidA and uspA genes. Antimicrobial susceptibility testing (AST) was conducted using the Kirby-Bauer disk diffusion techniques with seven antibiotics from six distinct antimicrobial classes. The study found an overall prevalence of 56.28% (95% CI: 51.56–60.89) for E. coli. The prevalence in LBMs (58.33%) was higher than in SMs (54.80%), with liver samples showing a slightly higher rate of contamination (63.33% in LBMs, 55.20% in SMs) compared to muscle samples. AMR profiling revealed high resistance rates to sulfamethoxazole-trimethoprim (88.84%), tetracycline (86.78%), and ampicillin (82.23%). Conversely, cephalexin (63.64%) and gentamicin (57.02%) had the highest susceptibility rates. A significant proportion (84.71%) of isolates were multidrug-resistant (MDR), with some isolates resistant to up to six classes of antimicrobial. The multiple antibiotic resistance (MAR) index ranged from 0.14 to 1.00, indicating substantial antimicrobial exposure. PCR analysis confirmed the presence of the blaTEM gene in all ampicillin-resistant isolates, while 75.35% of sulfamethoxazole-resistant isolates carried the sul2 gene. Correlation analysis revealed a strong association between phenotypic resistance to ampicillin and the presence of the blaTEM gene (r = 1), along with a moderate correlation between sul2 and resistance to sulfamethoxazole (r = 0.5). These findings highlight the widespread presence of multidrug-resistant (MDR) E. coli in broiler meat, posing a significant public health concern.

Introduction

Escherichia coli (E. coli) is a bacterium essential for supporting intestinal health in both humans and animals [1]. Although the majority of E. coli strains are non-pathogenic, approximately 10–15% of intestinal coliforms comprise opportunistic and pathogenic serotypes capable of causing infections in immunocompromised hosts, including poultry [2]. Contamination of meat with E. coli is frequently associated with poor slaughter hygiene [3], and the strains isolated from such contaminated meat have shown resistance to commonly used antibiotics [4]. This antimicrobial resistance presents serious threats to the health of both humans and animals [5]. While the majority of E. coli strains coexist harmlessly in the large intestine, they can become pathogenic under specific conditions, causing both intestinal and systemic infections [6]. Antimicrobials are extensively used in both human and veterinary medicine to manage infections and health risks, but their overuse contributes to the rise of AMR, posing a serious challenge to effective treatment and public health [7]. Antimicrobials are often administered as growth promoters (AMGP) in poultry farming, especially for broilers. However, to minimise the risk of resistance development, they should be used cautiously and primarily for therapeutic and preventive purposes [8]. Overuse of antibiotics accelerates the development of antibiotic-resistant bacteria, a complex process driven by bacterial genetic and metabolic mechanisms [9,10].

In intensive broiler chicken production, the strong antibiotic selection pressure has led to a substantial presence of resistant bacteria in poultry fecal flora, which can then spread to humans, pets, and the environment [11–13]. The misuse of antimicrobials in livestock production contributes to developing multidrug resistant E. coli, which can be spread to humans via the food chain, particularly through broiler chicken meat, posing serious health risks as well as making treatment option more challenging [14,15].

LBMs and SMs play an important role for influencing microbial contamination and AMR patterns due to their diverse poultry supply chain, meat processing methods and consumer exposure risks [15]. Poor handling, inadequate cleaning, and improper meat-selling practices are known to contribute to poultry meat contamination with E. coli [15]. Poultry meat, particularly breast muscle and liver of broiler chicken, has been recognised as a likely source of infection due to the high risk of contamination during meat processing [16]. While the global prevalence of avian E. coli in broiler meat has been well documented, there is still limited information on the situation in Bangladesh. Despite the presence of veterinary and research laboratories across Bangladesh, systematic surveillance of AMR remains inadequate. Over 60% of farmers in Bangladesh reportedly use antibiotics without prescriptions [17]. Chicken meat from LBMs has AMR, as vendors often use antibiotics to reduce mortality rates among their stock [18]. Moreover, a range of antimicrobials, including ciprofloxacin, amoxicillin, sulfamethoxazole-trimethoprim, and gentamicin, are frequently used at various stages of poultry production, contributing to the development of antibiotic-resistant E. coli strains in Bangladesh. The rate of antimicrobial resistance have increased at a faster rate in E. coli as well as commensal E. coli which is an important reservoir of antimicrobial resistance genes [19].These antimicrobial resistance genes may disseminate to pathogenic strain through horizontal gene transfer mechanism because E. coli has ability to get mobile genetic elements including plasmids, transposons, and integrons, which often carry AMR genes [20]. Polymerase chain reaction (PCR), DNA microarrays, and whole-genome sequencing (WGS) are all performed for molecular characterization, which is crucial for precisely identifying the genetic determinants of drug resistance bacteria. These technologies improve our understanding of the genetic basis of resistance and pathogenicity, allowing for more efficient surveillance and control efforts. Several studies on AMR E. coli on chicken meat in Bangladesh have been published previously [15,18,21], but this study focuses on new insights such as comparative analysis Between LBMs and SMs, correlation of resistance genes with phenotypic resistance, and molecular characterization. This study examines the current levels of E. coli contamination and AMR profiles, including blaTEM, sul1, and sul2 genes, in broiler chicken meat from SMs and LBMs in the Chattogram Metropolitan Area (CMA) of Bangladesh.

Methodology

Ethical approval

This study was conducted by following the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of the Chattogram Veterinary and Animal Sciences University, Bangladesh (permit reference number: CVASU/Dir (R and E) EC/2019/126 (02), Date: 29 December 2019).

Study location and design

This cross-sectional study was carried out between October 2020 and February 2021 in the Chattogram Metropolitan Area (CMA) of Bangladesh’s second-largest city. There are numerous LBMs and SMs in the study region. The LBM stalls are within proximity, which increases the risk of cross contamination [15]. This research is a part of a larger project, with some components already published [18,21]. A total of 40 LBMs and eight SMs, with nine LBMs and five SMs conveniently chosen for sample collection within the CMA. Ten stalls were randomly selected from each LBM. We collected breast muscle and liver tissues, as these are primary sites for bacterial contamination during slaughter and are commonly consumed, directly impacting public health. The geographical locations of the sampling areas are shown in Fig 1.

Sample collection, transportation, and processing

We determined the appropriate sample size using the Open Epi version 3.1 online tool, and based on the following equation

S a m p l e s i z e (n) = [D E F F \times N p (1 - p)] / [(d 2 / Z 21 - α / 2 \times (N - 1) + p \times (1 - p)]

Based on a prior study [18], in which the design effect was fixed at 1, we estimated the expected frequency of the outcome factor in the population (p) to be 76.1% + /- 5% error [18].

From each LBM, 10 liver samples and 10 breast muscle samples were collected; from each SM, 25 liver samples and 25 muscle samples were collected. In total, 430 samples were obtained, consisting of 215 liver and 215 muscle samples. In the SMs, the sources of chickens were from different farms and LBMs. Usually, SMs collected poultry from different suppliers throughout the years. The broiler carcasses were kept at 4⁰C overnight and sometimes until sold out. An overview of the sample collection is presented in S1 Table. The samples were collected in separate zipper bags while maintaining proper hygiene procedures. In brief, one dressed broiler carcass was collected from each stall. After collection, they were transported to the Department of Microbiology and Veterinary Public Health (DMVPH) at Chattogram Veterinary and Animal Sciences University (CVASU) for further investigation, ensuring the cold chain was maintained throughout transport. The samples were then processed into small pieces using sterile scissors, and 1 g of each sample was transferred into a separate sterile Falcon tube containing 9 mL of buffered peptone water (BPW) (HIMEDIA, pH: 7.0 ± 0.2, Mumbai, India). The samples were incubated at 37°C overnight for primary enrichment.

Isolation and presumptive detection of E. coli

To isolate E. coli, the enriched culture was streaked onto MacConkey agar medium (HIMEDIA, pH: 7.1 ± 0.2, Mumbai, India) and incubated at 37°C for 24 hours. Bright pink-coloured, large colonies on the MacConkey agar plate were suspected of E. coli. These colonies were then streaked onto Eosin Methylene Blue (EMB) agar plates (HIMEDIA, pH: 7.0 ± 0.2, Mumbai, India) and incubated at 37°C for 24 hours. A “green metallic sheen” on the EMB agar confirmed the growth of E. coli. Following confirmation, the isolates were inoculated onto blood agar (HIMEDIA, pH: 7.0 ± 0.2, Mumbai, India) and incubated at 37°C for 24 hours. All confirmed E. coli isolates were cultured in brain heart infusion (BHI) broth (HIMEDIA, pH: 7.0 ± 0.2, Mumbai, India) and incubated overnight at 37°C. For each isolate, 700 µ L of the BHI broth culture was mixed with 300 µ L of 15% glycerol in an Eppendorf tube. The tubes were properly labelled and stored at -80°C for further investigation.

Molecular detection of E. coli

Phenotypic E. coli isolates were subjected to molecular identification by PCR. Genomic DNA was extracted using the crude boiling method described by Malorny et al. [22]. Molecular identification of E. coli was carried out through species-specific multiplex PCR in a thermal cycler (DLAB, USA) using primers targeting the uidA gene and the flanking region of the uspA gene [23]. The oligonucleotide primer sequences are listed in Table 1. The PCR reaction mixture consisted of 12.5 µ L of OneTaq Quick-load 2X Master Mix with Standard Buffer (New England Biolabs Inc.), 0.5 µ L each of the forward and reverse primers (10 pmol), 1 µ L of template DNA, and the required volume of nuclease-free water. The thermal cycling conditions were as follows: initial denaturation at 94°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 10 seconds, annealing at 55.2°C for 10 seconds, extension at 72°C for 1 minute, and a final extension at 72°C for 10 minutes. After amplification, 5 µ L of the PCR products were loaded onto a 1.5% (w/v) agarose gel, prepared using agarose powder (MP Biomedicals, USA) and 1X TAE buffer (Thermo Fisher Scientific, USA). The gel was visualised in a gel documentation system (UVP UVsolo touch, Analytik Jena AG, Thermo Fisher Scientific, USA) after staining with ethidium bromide (Sigma-Aldrich, USA).

Table 1. The oligonucleotide primer sequences used in this study.

Target gene	Primer Name	Primer sequence (5′-3′)	Annealing temperature	Amplicon size (bp)	References
uspA	uspA -F	CCGATACGCTGCCAATCAGT	55.2 °C	884	[23]
uspA	uspA -R	ACGCAGACCGTAGGCCAGAT		884
uidA	uidA-F	TATGGAATTTCGCCGATTTT		164
uidA	uidA -R	TGTTTGCCTCCCTGCTGCGG		164
bla _TEM	bla_TEM - F	GCGGAACCCCTATTTG	50 °C	964	[29]
bla _TEM	bla_TEM - R	TCTAAAGTATATATGAGTAAACTTGGTCTGAC	50 °C	964	[29]
sul 1	sul 1- F	GTGACGGTGTTCGGCATTCT	68 °C	779	[28]
sul 1	sul 1- R	TCCGAGAAGGTGATTGCGCT	68 °C	779
sul 2	sul 2- F	CGGCATCGTCAACATAACCT	66 °C	721
sul 2	sul 2- R	TGTGCGGATGAAGTCAGCTC	66 °C	721

Open in a new tab

AST of E. coli

The E. coli positive isolates in PCR were screened for antimicrobial susceptibility against a panel of antimicrobials using the Kirby-Bauer disc diffusion method [24]. Seven antimicrobials of six different groups such as penicillins: ampicillin, tetracyclines: tetracycline and doxycycline, aminoglycosides: gentamicin, fluoroquinolones: ciprofloxacin, sulfonamides: sulfamethoxazole-trimethoprim, and cephalosporins: cephalexin) of drugs that had public health significance were selected for antimicrobial susceptibility testing. All the types, i.e., Access, Watch or reserve groups of antibiotics, were available in the study area, but the farmers did not follow the policy for antibiotic use among poultry farms. The following antimicrobials with respective disc potencies were used: TE: tetracycline (30µg), CN: gentamicin (10µg), DO: doxycycline (30µg), AMP: ampicillin (10µg), CL: cephalexin (30µg), SXT: sulfamethoxazole-trimethoprim (23.75µg + 1.25 µg), CIP: ciprofloxacin (5µg). After dispensing all the discs, the Mueller Hinton agar (HIMEDIA, pH: 7.0 ± 0.2, Mumbai, India) plates were incubated at 37°C for 18 hours. After incubation, the size of the zone of inhibition (in mm) around a disc, including the diameter of the disc, was measured using slide calipers, and the result was interpreted according to Clinical Laboratory Standards Institute guidelines [25]. The pan-susceptible E. coli ATCC 25922 was used as a quality control strain during AST. The E. coli isolates resistant to at least three antimicrobial classes were described as multidrug-resistant (MDR) [26]. The multiple antibiotic resistance (MAR) index was estimated by following the formula a/b, a = the number of antibiotics that showed resistance by isolates, b = the number of antibiotics that were exposed by isolates, as described earlier by Krumperman et al., [27].

Detection of antimicrobial resistance genes

Using PCR, the phenotypic sulphonamide- and ampicillin-resistant isolates were tested for the presence of resistance genes. The sul 1 and sul 2 genes were screened for sulphonamide resistance, and the blaTEM gene for ampicillin resistance, as previously described by Lanz et al. [28] and Hasman et al. [29]. The oligonucleotide primer sequences, amplicon sizes, and annealing temperatures are provided in Table 1.

Statistical analysis

All sampling and laboratory test data were meticulously entered, organised, and cleaned using Microsoft Excel 2019. Descriptive statistics, including percentages and 95% confidence intervals, were performed using the modified Wald method available in the GraphPad QuickCalcs online tool (https://www.graphpad.com/quickcalcs/). Pearson’s Chi-squared test was performed on LBMs and SMs to determine the level of significance of the source. The p value ≤0.05 was considered as statistically significant. Data visualisations, such as heat maps and bar charts, were generated using GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA, USA) to illustrate trends and distributions effectively. Correlation analyses between antimicrobials and corresponding resistance gene abundances were conducted using R software (version 4.4.1; https://www.r-project.org/). These correlations were visualised with high-quality graphical outputs produced in R, ensuring precise and informative data presentation. The map of the locations of the LBMs and SMs was created using QGIS software (version 3.12.0).

Results

Prevalence of E. coli in LBMs and SMs

Among the 450 samples tested in this study, 242 (56.28%, 95% CI: 51.56–60.89) were confirmed as E. coli. In LBMs, the prevalence of E. coli was 58.33%, with 63.33% in liver and 52.22% in muscle samples (S2 Table). Similarly, the prevalence in SMs was 54.80%, with 55.20% in liver samples and 54.40% in muscle samples. The prevalence of E. coli across different sources is presented in Table 2.

Table 2. The overview of the sample collected and frequency of E. coli from different sources.

Sources	Samples	N, E. coli	Percentage (%), (95% CI)	Chi-Square, p value
LBMs	Liver (n = 90)	57	63.33 (53.01-72.57)	0.53098
LBMs	Muscle (n = 90)	48	52.22 (42.02-62.24)
subtotal (n = 180)		105	58.33 (51.03-65.29)
SMs	Liver (n = 125)	69	55.20 (46.46-63.63)	0.76^ns^*
SMs	Muscle (n = 125)	68	54.40 (45.67- 62.87)
subtotal (n = 250)		137	54.80 (48.60-60.85)
Total (N = 430)		242	56.28 (51.56-60.89)

Open in a new tab

*Not significant

AMR patterns of E. coli isolates of LBMs and SMs

The AST showed that the highest proportion of isolates were resistant to sulfamethoxazole-trimethoprim (88.84%), followed by tetracycline (86.78%) and ampicillin (82.23%). In contrast, the highest susceptibility was confirmed for cephalexin (63.64%), followed by gentamicin (57.02%) and ciprofloxacin (23.14%). Additionally, 28.51% of the isolates were intermediate to doxycycline. The AMR profiles are illustrated in Fig 2/a.

Fig 2 — a) AMR patterns, b) MDR patterns and c) correlation coefficient of specific antimicrobials and resistance genes. Here, TE = tetracycline, DO = doxycycline CN = gentamicin, CIP = ciprofloxacin, SXT = sulfamethoxazole-trimethoprim, CL = cephalexin and AMP = ampicillin.

MDR profiles of E. coli

This study revealed that 205 isolates (84.71%) exhibited multidrug resistance (MDR), while 37 isolates (15.29%) were not MDR. Among the non-MDR isolates, 3 (1.24%) showed no resistance to any antimicrobials tested. Of the MDR isolates, 78 (32.23%) were resistant to four antimicrobial classes (Fig 2/b). The phenotypic antimicrobial resistance patterns revealed that 32 isolates (13.22%) were resistant to four antimicrobial classes, displaying the CIP + SXT + AMP + DO + TE resistance patterns. Additionally, 25 isolates (10.33%) exhibited resistance to five antimicrobial classes, displaying the CIP + CN + SXT + AMP + DO + TE resistance pattern. Furthermore, 15 isolates (6.22%) demonstrated resistance to six antimicrobial classes following the CL + CIP + CN + SXT + AMP + DO + TE resistance pattern (Table 3). The multiple antibiotic resistance (MAR) index for all isolates ranged from 0.14 to 1 (Table 3).

Table 3. The phenotypic AMR patterns of E. coli isolates, along with the MAR index.

No of isolates	%	Resistance type	Phenotypic resistance patterns	MAR Index
32	13.22	MDR	Four classes CIP, SXT, AMP, DO, TE	0.57
25	10.33	MDR	Five classes CIP, CN, SXT, AMP, DO, TE	0.86
18	7.44	MDR	Five classes CL, CIP, SXT, AMP, DO, TE	0.86
18	7.44	MDR	Three classes SXT, AMP, TE	0.43
15	6.20	MDR	Six classes CL, CIP, CN, SXT, AMP, DO, TE	1
12	4.96	MDR	Four classes CIP, SXT, AMP, TE	0.57
8	3.31	MDR	Three classes SXT, AMP, DO, TE	0.57
7	2.89	MDR	Four classes CL, SXT, AMP, TE	0.57
7	2.89	MDR	Five classes CIP, CN, SXT, AMP, TE	0.71
6	2.48	MDR	Five classes CL, CIP, SXT, AMP, TE	0.71
6	2.48	MDR	Six classes CL, CIP, CN, SXT, AMP, DO	0.86
5	2.07	MDR	Four classes CL, SXT, AMP, DO, TE	0.57
4	1.65	MDR	Four classes CN, SXT, AMP, TE	0.57
3	1.24	MDR	Four classes SXT, AMP, CIP, TE	0.57
3	1.24	MDR	Three classes CL, AMP, TE	0.43
3	1.24	MDR	Three classes CL, SXT, TE	0.43
2	0.83	MDR	Five classes CL, CN, SXT, AMP, DO, TE	0.86
2	0.83	MDR	Five classes CL, CN, SXT, AMP, TE	0.71
2	0.83	MDR	Four classes CL, CIP, AMP, TE	0.57
2	0.83	MDR	Four classes CL, CN, SXT, TE	0.57
2	0.83	MDR	Four classes CIP, CN, SXT, AMP	0.57
2	0.83	MDR	Three classes CIP, SXT, TE	0.43
2	0.83	MDR	Three classes CIP, SXT, DO, TE	0.57
1	0.41	MDR	Three classes CL, AMP, TE	0.43
1	0.41	MDR	Three classes CL, SXT, AMP	0.43
1	0.41	MDR	Three classes CL, CIP, AMP	0.43
1	0.41	MDR	Three classes CL, SXT, DO, TE	0.57
1	0.41	MDR	Three classes CIP, CN, SXT	0.43
1	0.41	MDR	Three classes SXT, AMP, DO	0.43
1	0.41	MDR	Three classes CL, SXT, DO	0.43
1	0.41	MDR	Three classes CL, CIP, TE	0.43
1	0.41	MDR	Three classes CN, SXT, AMP	0.43
1	0.41	MDR	Three classes CIP, CN, SXT, TE	0.57
1	0.41	MDR	Four classes CL, CN, SXT, AMP	0.57
1	0.41	MDR	Four classes CIP, SXT, AMP, DO	0.57
1	0.41	MDR	Four classes CL, CIP, SXT, TE	0.57
1	0.41	MDR	Four classes CL, CN, SXT, DO	0.57
1	0.41	MDR	Four classes CL, CIP, SXT, DO, TE	0.71
1	0.41	MDR	Four classes CN, SXT, AMP, DO, TE	0.71
1	0.41	MDR	Four classes CL, CN, SXT, DO, TE	0.71

Open in a new tab

Correlation of antimicrobials, resistance genes with E. coli isolates from LBMs and SMs

The Pearson’s Correlation coefficient analysis revealed a strong positive correlation between AMP resistance and the blaTEM gene (r = 1), a moderate correlation between SXT resistance and the sul2 gene (r = 0.5), and a weak correlation between SXT resistance and the sul1 gene (r = 0.2). The weak correlation (r = 0.2) between blaTEM and SXT, TE, or sul2 indicates an indirect or minimal relationship (Fig 2/c). The heat map compares the AMR profiles of liver and meat samples collected from LBMs and SMs alongside the sul1, sul2, and blaTEM genes associated with sulfonamide and ampicillin resistance (Fig 3).

Discussion

AMR is an escalating global issue as the effectiveness of antimicrobials continues to decline. The results of this study demonstrated a high prevalence of E. coli in broiler breast muscle and liver samples from both SMs and LBMs, with these isolates showing resistance to multiple antimicrobials.

In this study, the prevalence of E. coli in broilers from LBMs is consistent with the findings of Hossain et al. [30], who reported a prevalence of 63.6%; Jakaria et al. [31], who found 82%, and Bashar et al. [32], who reported 100% in poultry. The ampicillin resistance observed in this study is consistent with the findings of Islam et al. [33], who reported a 100% resistance rate to penicillin in E. coli isolates from poultry. Schroeder et al. [34] documented lower % resistance rates of 49% for ampicillin and 84% for sulfamethoxazole-trimethoprim. In contrast, Parvin et al. [19] reported significantly higher resistance rates, including 89.5% for ampicillin, 88.4% for sulfamethoxazole-trimethoprim, and 84.9% for tetracycline, which closely aligns with the findings of the present study. The correlation analysis revealed a strong association between phenotypic resistance to ampicillin and the presence of the blaTEM gene, indicating that blaTEM is a key genetic determinant of ampicillin resistance. This result is consistent with findings in similar studies, where blaTEM has been identified as a major contributor to β-lactam antibiotic resistance through the production of TEM-type β-lactamases, which hydrolyse ampicillin effectively [35]. The weak correlation (r = 0.2) between blaTEM and sul1 or sul2 suggests a limited direct association. However, these genes may be present on mobile genetic elements like plasmids or integrons, which promote co-selection under antibiotic pressure. This could account for the observed weak statistical correlation. The low correlations between blaTEM and non-AMP antibiotics indicate that blaTEM primarily confers AMP resistance. Nevertheless, indirect associations might occur due to co-selection or co-localization with other resistance genes on shared genetic elements. The moderate correlation of sul2 with resistance to sulfamethoxazole, a component of SXT, underscores its role in sulfonamide resistance. However, as SXT resistance involves both sulfonamide (e.g., sul2) and trimethoprim resistance genes (e.g., dfrA), this partial correlation reflects the multifactorial nature of resistance SXT. The AST showed the highest resistance to the combination of sulfamethoxazole-trimethoprim, followed by tetracycline and ampicillin. Li et al. [36] found that 70.9% of isolates were MDR, while only 6.5% exhibited no resistance to the tested antimicrobials. The detection of MDR E. coli in this study is concerning and aligns with the findings of Hassan et al. [37], who reported that 100% of poultry samples tested positive for MDR E. coli. The rise of MDR pathogens presents a major threat, as these bacteria have the potential to evolve into ‘superbugs,’ resulting in treatment failures in poultry and significant public health risks. The widespread occurrence of MDR in poultry is likely due to the overuse of various antibiotic classes, creating intense selection pressure.

Several studies have highlighted poultry farms and their environments, such as litter and wastewater, as major sources of antibiotic residues [30,37]. Moreover, vegetables and animal products from wet markets and shops have been identified as reservoirs of these residues, further contributing to AMR [38,39]. Regular exposure to antibiotic residues accelerates the spread of AMR, particularly in developing countries like Bangladesh. Horizontal transmission of resistant bacteria and genes has also been observed on farms due to antimicrobial residues [40,41]. The improper use of antimicrobials in both human and veterinary medicine plays a significant role in the development of AMR [42]. Lack of knowledge about proper antimicrobial use and the indiscriminate administration of antibiotics are common issues in Bangladesh [43]. Drug sellers and medical representatives often encourage the random use of antimicrobials without prescriptions [44,45]. Inappropriate dosing exposes bacteria to subtherapeutic levels of antimicrobials, enabling them to develop resistance [46]. High doses, conversely, can lead to tissue residues, further promoting resistance [47]. In poultry farming, antimicrobials are frequently administered to entire flocks for infection control and growth promotion [48]. While this reduces mortality and increases profitability, it has serious public health consequences. When humans consume poultry meat containing antibiotic residues, they can inadvertently acquire these residues, contributing to the spread of resistant genes, which are transferred horizontally and vertically among bacterial populations [49]. Although pathogenic bacteria are generally absent in the muscle tissues of healthy birds [50], contamination during slaughter and meat processing can introduce bacteria from the gastrointestinal tract, some of which may already be resistant to antimicrobials due to continuous low-dose exposure.

AMR represents a major threat to both veterinary and public health. In response, the World Health Organization (WHO) has classified antimicrobials into three categories—Access, Watch, and Reserve—based on their significance and the risk of resistance [51]. The Access group is recommended for general use, while the Watch group is reserved for cases where Access group options are ineffective. The Reserve group is intended for use when other options are no longer effective [52]. Addressing AMR requires scientific knowledge and evidence-based practices. Rational use of antimicrobials can improve agriculture while simultaneously reducing the problem of AMR, enhancing both profitability and public health [52,53]. This study is part of a larger project and focused on broiler meat samples collected from LBMs and SMs in the CMA, which may not fully reflect other regions or retail systems in Bangladesh, potentially limiting the generalisability of the findings. The present study does not focus on environmental samples, but the future aim is to investigate the AMR status of SMs and LBMs environmental samples. The AST was conducted using the Kirby-Bauer disc diffusion techniques, which, while widely used, provides qualitative rather than quantitative resistance data, potentially limiting the depth of resistance profiling. The study only investigated resistance to seven antibiotics, leaving the resistance profiles against other clinically relevant antimicrobials unexplored. Molecular characterisation in this study was restricted to detecting the blaTEM and sul2 genes, while other resistance mechanisms, such as efflux pumps or additional resistance genes, were not examined. The frequency of multidrug-resistant E. coli in the human food chain was investigated in this study, which provides important information about potential risks to consumers. This information can guide particular interventions, such as enhanced biosecurity protocols and prudent use of antibiotics in poultry production, processing and distributions.

Conclusion

This study emphasises the high prevalence of E. coli contamination and AMR in broiler meat samples from LBMs and SMs in the CMA, Bangladesh. The findings revealed significant resistance to commonly used antibiotics, including sulfamethoxazole-trimethoprim, tetracycline, and ampicillin, with a substantial proportion of isolates exhibiting MDR. The identification of resistance-associated genes, such as blaTEM and sul2, further highlights the genetic foundation of AMR in these isolates. These results indicate a pressing need for stricter monitoring of antibiotic use in poultry production and robust food safety measures to mitigate public health risks. Addressing AMR must include integrated strategies involving policymakers, the poultry industry, and public health stakeholders. This study recommends a large-scale study on AMR patterns of food-producing animals as well as genetic characterization of MDR bacteria covering different geographical areas to mitigate the future risk.

Supporting Information

S1 Table. List of sample collected from LBMs and SMs.

(DOCX)

pone.0323909.s001.docx^{(16.7KB, docx)}

S2 Table. Main Dataset.

(XLSX)

pone.0323909.s002.xlsx^{(22.4KB, xlsx)}

Acknowledgments

The author sincerely thanks the office staff and lab assistants from the Department of Physiology, Biochemistry, and Pharmacology, as well as the Department of Microbiology and Public Health at Chattogram Veterinary and Animal Sciences University, Chattogram, Bangladesh. The author also appreciates the support of LBM and SM owners for providing the important information and meat samples.

Data Availability

All relevant data are within the article and its Supporting Information files.

Funding Statement

Bangladesh Bureau of Education Information and Statistics (BANBEIS), Ministry of Education, People’s Republic of Bangladesh, funded this research with project number #SD-2019967.

References

1.Levine MM. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis. 1987;155(3):377–89. doi: 10.1093/infdis/155.3.377 [DOI] [PubMed] [Google Scholar]
2.Akond MA, Alam S, Hassan SMR, Shirin M. Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of bangladesh. Internet J Food Saf. 2009;11:19–23. [Google Scholar]
3.Laury A, Echeverry A, Brashears M. Fate of Escherichia coli O157:H7 in meat. In: Safety of Meat and Processed Meat. 2009. p. 31–53. [Google Scholar]
4.Mølbak K. Spread of resistant bacteria and resistance genes from animals to humans—the public health consequences. J Vet Med B. 2004;51(8-9):364–69. [DOI] [PubMed] [Google Scholar]
5.Salehi TZ, Bonab SF. Antibiotics susceptibility pattern of Escherichia coli strains isolated from chickens with colisepticemia in tabriz province, iran. Int J Poult Sci. 2006;5:677–84. [Google Scholar]
6.Kittana H, Gomes-Neto JC, Heck K, Geis AL, Segura Muñoz RR, Cody LA, et al. Commensal Escherichia coli strains can promote intestinal inflammation via differential interleukin-6 production. Front Immunol. 2018;9:2318. doi: 10.3389/fimmu.2018.02318 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Moulin G, Cavalié P, Pellanne I, Chevance A, Laval A, Millemann Y, et al. A comparison of antimicrobial usage in human and veterinary medicine in France from 1999 to 2005. J Antimicrob Chemother. 2008;62:617–25. [DOI] [PubMed] [Google Scholar]
8.Hassan MM, Kalam MA, Alim MA, Shano S, Nayem MRK, Badsha MR, et al. Knowledge, attitude, and practices on antimicrobial use and antimicrobial resistance among commercial poultry farmers in Bangladesh. Antibiotics. 2021;10:784. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Munita JM, Arias CA. Mechanisms of antibiotic resistance. In: Virulence Mechanisms of Bacterial Pathogens. ASM Press. 2016. p. 481–511. doi: 10.1128/9781555819286.ch17 [DOI] [Google Scholar]
10.Zhang L, Levy K, Trueba G, Cevallos W, Trostle J, Foxman B, et al. Effects of selection pressure and genetic association on the relationship between antibiotic resistance and virulence in Escherichia coli. Antimicrob Agents Chemother. 2015;59:6733–740. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Hassan MM, Amin KB, Ahaduzzaman M, Alam M, Faruk MS, Uddin I. Antimicrobial resistance pattern against Escherichia coli and salmonella in layer poultry. Res J Vet Pract. 2014;2:30–5. [Google Scholar]
12.van den Bogaard AE, London N, Driessen C, Stobberingh EE. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J Antimicrob Chemother. 2001;47(6):763–71. doi: 10.1093/jac/47.6.763 [DOI] [PubMed] [Google Scholar]
13.McEwen S, Collignon P. Antimicrobial resistance: a one health perspective. In: Antimicrob Resist Bact Livest Companion Anim. 2018. p. 521–47. [Google Scholar]
14.Osman KM, Kappell AD, Elhadidy M, ElMougy F, El-Ghany WAA, Orabi A, et al. Poultry hatcheries as potential reservoirs for antimicrobial-resistant Escherichia coli: a risk to public health and food safety. Sci Rep. 2018;8:5859. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Nath C, Das T, Islam MS, Hasib FMY, Singha S, Dutta A, et al. Colistin resistance in multidrug-resistant Escherichia coli isolated from retail broiler meat in Bangladesh. Microb Drug Resist. 2023;29(11):523–32. doi: 10.1089/mdr.2023.0026 [DOI] [PubMed] [Google Scholar]
16.Bélanger L, Garenaux A, Harel J, Boulianne M, Nadeau E, Dozois CM. Escherichia coli from animal reservoirs as a potential source of human extraintestinal pathogenic E. coli. FEMS Immunol Med Microbiol. 2011;62:1–10. [DOI] [PubMed] [Google Scholar]
17.Islam A, Saifuddin AKM, Faruq AA, Islam S, Shano S, Alam M, et al. Antimicrobial residues in tissues and eggs of laying hens at Chittagong, Bangladesh. Int J One Health. 2016;2:75–80. doi: 10.14202/ijoh.2016.75-80 [DOI] [Google Scholar]
18.Alam GS, Hassan MM, Ahaduzzaman M, Nath C, Dutta P, Khanom H, et al. Molecular detection of tetracycline-resistant genes in multidrug-resistant Escherichia coli isolated from broiler meat in Bangladesh. Antibiotics. 2023;12:418. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Parvin MS, Talukder S, Ali MY, Chowdhury EH, Rahman MT, Islam MT. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens. 2020;9(6):420. doi: 10.3390/pathogens9060420 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Tokuda M, Shintani M. Microbial evolution through horizontal gene transfer by mobile genetic elements. Microb Biotechnol. 2024;17(1):e14408. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Tanzin AZ, Nath C, Nayem MR, Sayeed MA, Khan SA, Magalhaes RS, et al. Detection and characterisation of colistin-resistant Escherichia coli in broiler meats. Microorganisms. 2024;12(12):2535. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Malorny B, Hoorfar J, Hugas M, Heuvelink A, Fach P, Ellerbroek L, et al. Interlaboratory diagnostic accuracy of a Salmonella-specific PCR-based method. Int J Food Microbiol. 2003;89:241–49. [DOI] [PubMed] [Google Scholar]
23.Godambe LP, Bandekar J, Shashidhar R. Species specific PCR based detection of Escherichia coli from Indian foods. 3 Biotech. 2017;7(2):130. doi: 10.1007/s13205-017-0784-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45(4):493–6. doi: 10.1093/ajcp/45.4_ts.493 [DOI] [PubMed] [Google Scholar]
25.CLSI. M100: Performance standards for antimicrobial susceptibility testing. 2020. Available from: https://www.nih.org.pk/wp-content/uploads/2020/02/CLSI-2020.pdf [Accessed 20 September 2024]. [Google Scholar]
26.Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–81. doi: 10.1111/j.1469-0691.2011.03570.x [DOI] [PubMed] [Google Scholar]
27.Krumperman PH. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl Environ Microbiol. 1983;46(1):165–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Lanz R, Kuhnert P, Boerlin P. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet Microbiol. 2003;91(1):73–84. doi: 10.1016/s0378-1135(02)00263-8 [DOI] [PubMed] [Google Scholar]
29.Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM. beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J Antimicrob Chemother. 2005;56(1):115–21. doi: 10.1093/jac/dki190 [DOI] [PubMed] [Google Scholar]
30.Hossain M, Siddique M, Hossain F, Zinnah M, Hossain M, Alam M. Isolation, identification, toxin profile, and antibiogram of Escherichia coli isolated from broilers and layers in the Mymensingh district of Bangladesh. Bangl J Vet Med. 2008;6(1):1–5. [Google Scholar]
31.Jakaria A, Islam MA, Khatun MM. Prevalence, characteristics and antibiogram profiles of Escherichia coli isolated from apparently healthy chickens in Mymensingh, Bangladesh. Microbes & Health. 2013;1(1):27–9. doi: 10.3329/mh.v1i1.13710 [DOI] [Google Scholar]
32.Bashar T, Rahman M, Rabbi FA, Noor R, Rahman MM. Enterotoxin profiling and antibiogram of Escherichia coli Isolated from Poultry Feces in Dhaka District of Bangladesh. SJ Microbiol. 1970;1(1):51–7. doi: 10.3329/sjm.v1i1.9134 [DOI] [Google Scholar]
33.Islam MJ, Sultana S, Das KK, Sharmin N, Hasan MN. Isolation of plasmid-mediated multidrug-resistant Escherichia coli from poultry. Int J Sustain Crop Prod. 2008;3(1):46–50. [Google Scholar]
34.Schroeder CM, Meng J, Zhao S, DebRoy C, Torcolini J, Zhao C, et al. Antimicrobial resistance of Escherichia coli O26, O103, O111, O128, and O145 from animals and humans. Emerg Infect Dis. 2002;8(12):1409–14. doi: 10.3201/eid0812.0200770 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Jacoby G. β-Lactamase classification and amino acid sequences for TEM, SHV and OXA extended-spectrum and inhibitor-resistant enzymes. 2012. Available from: http://www.lahey.org/Studies/ [Google Scholar]
36.Li X, Watanabe N, Xiao C, Harter T, McCowan B, Liu Y, et al. Antibiotic-resistant E. coli in surface water and groundwater in dairy operations in Northern California. Environ Monit Assess. 2014;186(2):1253–60. doi: 10.1007/s10661-013-3454-2 [DOI] [PubMed] [Google Scholar]
37.Hasan B, Faruque R, Drobni M, Waldenström J, Sadique A, Ahmed KU, et al. High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011;55(4):689–92. doi: 10.1637/9686-021411-Reg.1 [DOI] [PubMed] [Google Scholar]
38.Islam A, Saifuddin AKM, Faruq AA, Islam S, Shano S, Alam M, et al. Antimicrobial residues in tissues and eggs of laying hens at Chittagong, Bangladesh. Int J One Health. 2016;2:75–80. doi: 10.14202/ijoh.2016.75-80 [DOI] [Google Scholar]
39.Sobur MA, Sabuj AAM, Sarker R, Rahman AMMT, Kabir SML, Rahman MT. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet World. 2019;12(7):984–93. doi: 10.14202/vetworld.2019.984-993 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Ferdous J, Bradshaw A, Islam SKMA, Zamil S, Islam A, Ahad A, et al. Antimicrobial residues in chicken and fish, chittagong, Bangladesh. Ecohealth. 2019;16(3):429–40. doi: 10.1007/s10393-019-01430-6 [DOI] [PubMed] [Google Scholar]
41.Sattar S, Hassan MM, Islam SKM, Alam M, Al Faruk MS, Chowdhury S, et al. Antibiotic residues in broiler and layer meat in Chittagong district of Bangladesh. Vet World. 2014;7(10):738–42. [Google Scholar]
42.Couper MR. Strategies for the rational use of antimicrobials. Clin Infect Dis. 1997;24(Suppl 1):S154-6. doi: 10.1093/clinids/24.supplement_1.s154 [DOI] [PubMed] [Google Scholar]
43.Kalam MA, Alim MA, Shano S, Nayem MRK, Badsha MR, Mamun MAA, et al. Knowledge, attitude, and practices on antimicrobial use and antimicrobial resistance among poultry drug and feed sellers in Bangladesh. Vet Sci. 2021;8(6):111. doi: 10.3390/vetsci8060111 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Okeke IN, Lamikanra A, Edelman R. Socioeconomic and behavioral factors leading to acquired bacterial resistance to antibiotics in developing countries. Emerg Infect Dis. 1999;5(1):18–27. doi: 10.3201/eid0501.990103 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Barbosa TM, Levy SB. The impact of antibiotic use on resistance development and persistence. Drug Resist Updat. 2000;3(5):303–11. doi: 10.1054/drup.2000.0167 [DOI] [PubMed] [Google Scholar]
46.Levy SB. The challenge of antibiotic resistance. Sci Am. 1998;278(3):46–53. doi: 10.1038/scientificamerican0398-46 [DOI] [PubMed] [Google Scholar]
47.Hofacre C, Fricke J, Inglis T. Antimicrobial drug use in poultry. Antimicrob Ther Vet Med. 2013;2013:569–87. [Google Scholar]
48.Summers AO. Genetic linkage and horizontal gene transfer, the roots of the antibiotic multi-resistance problem. Anim Biotechnol. 2006;17(2):125–35. doi: 10.1080/10495390600957217 [DOI] [PubMed] [Google Scholar]
49.Gill CO. Microbiological conditions of meats from large game animals and birds. Meat Sci. 2007;77(2):149–60. doi: 10.1016/j.meatsci.2007.03.007 [DOI] [PubMed] [Google Scholar]
50.Gandra S, Kotwani A. Need to improve availability of “access” group antibiotics and reduce the use of “watch” group antibiotics in India for optimum use of antibiotics to contain antimicrobial resistance. J Pharm Policy Pract. 2019;12:20. doi: 10.1186/s40545-019-0182-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Hsia Y, Lee BR, Versporten A, Yang Y, Bielicki J, Jackson C, et al. Use of the WHO Access, Watch, and Reserve classification to define patterns of hospital antibiotic use (AWaRe): an analysis of paediatric survey data from 56 countries. Lancet Glob Health. 2019;7(7):e861–71. doi: 10.1016/S2214-109X(19)30071-3 [DOI] [PubMed] [Google Scholar]
52.Barnett ML. The rationale for the daily use of an antimicrobial mouthrinse. J Am Dent Assoc. 2006;137(Suppl 1):16S–21S. doi: 10.14219/jada.archive.2006.0408 [DOI] [PubMed] [Google Scholar]
53.Moellering RC Jr. Rationale for use of antimicrobial combinations. Am J Med. 1983;75(1A):4–8. doi: 10.1016/0002-9343(83)90088-8 [DOI] [PubMed] [Google Scholar]

PLoS One. 2025 May 14;20(5):e0323909. doi: 10.1371/journal.pone.0323909.r001

Author response to Decision Letter 0

10 Feb 2025

PLoS One. doi: 10.1371/journal.pone.0323909.r002

Decision Letter 0

Mabel Kamweli Aworh

4 Mar 2025

PONE-D-25-06137Epidemiology and Molecular Characterisation of Multidrug-Resistant Escherichia coli Isolated from Chicken MeatPLOS ONE

Dear Dr. Hassan,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 18 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Mabel Kamweli Aworh, DVM, MPH, PhD. FCVSN

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

4. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical.

5. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

7. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments : In addition to addressing the reviewers comments please fix the following issues.

Please remove the section numbering from the manuscript.
The section should be omitted. Instead, include limitations as the final paragraph in the section.
Include line numbers throughout the manuscript to facilitate the review process.
In the section, based on your findings, provide a paragraph that includes recommendations or potential future research directions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have conducted a very important and timely study on the epidemiology and molecular characterization of multidrug-resistant Escherichia coli in chicken meat from live bird markets and supermarkets in Chattogram, Bangladesh. This study is highly relevant given the increasing global concerns about AMR and its implications for food safety and public health.

After reviewing this manuscript, i would say it is well-structured with a clearly defined research question. The methodological approach, including antimicrobial susceptibility testing and molecular characterization, was rigorous and appropriate for addressing the study objectives. The authors have also presented their findings in a comprehensive manner, with relevant data supporting their conclusions.

This study provides valuable insights into the burden of MDR E. coli in poultry products in Chattogram, which could help inform surveillance programs and antimicrobial stewardship efforts. The inclusion of both live bird markets and supermarkets strengthens the study by allowing for a comparative analysis, which adds to the novelty of the work.

That said, there are some areas where the manuscript could be improved to enhance clarity, scientific rigor, and overall impact. Below, I provide specific comments and suggestions for improvement.

INTRODUCTION

1. This is a great introduction! However, there is need to include information concerning why you are going to LBM and SMs. Is there any prior evidence differentiating contamination levels or AMR profiles in E. coli from live bird markets vs. supermarkets?

2. Also, your introduction needs to clarify why molecular characterization is necessary (e.g., detection of AMR genes, virulence factors, plasmid-mediated resistance)?

3. The introduction also needs to specify whether similar studies have been conducted in Bangladesh in the past and how this study adds new insights.

4. Since this is the first time this acronym -CMA is used in the main manuscript, please write in full for the first use

METHODS

1. Can you include the particular epidemiological study design that was used in this study (e.g, cross-sectional, observational, experimental)? It is important to include this information so the readers can understand the context of the study

2. Can you indicate a brief justification for selecting this study location? Is it that there have been numerous cases or outbreaks of E.coli around the area or what was the reason for this?

3. It is important to include more information about the study area to give a better context and to allow a more objective interpretation of your findings. I understand that part of this study has been published elsewhere but here you need to provide important details also as not every reader will have the chance to get the already published articles. Please include information concerning

a. The total number of LBM and SM in CMA since this is a prevalence study

b. How the sample size was calculated. How can you justify this sample size of 430 samples?

c. The type (Access, Watch or reserve) and availability of antibiotics in the study area including the policy for antibiotic use among farm animals.

d. A brief description of the sampling technique.

FIGURE 1 - These maps are good as they give the reader more insight to the area. For the map please include

1. The source of the map

2. The cardinal points/North arrow

3. The scale

4. The legend

these are crucial information required for any map in a scientific document

5. Statistical Analysis; if you collected data from LBMs and SM, what tests did you use to make comparisons between LBMs and SMs?

6. Please specify the particular correlation that was done - Spearman, Pearson's, point bi serial e.t.c

RESULTS

1. it would be better to conduct statistical comparisons between LBMs and supermarkets otherwise there maybe little significance in seperating the data from the two.

2. Specify the type of correlation analysis that was performed. As well as the level of significance. were these values statistically significant?

DISCUSSION

1. It is important in the discussion to highlight the public health significance of each major finding as it relates to your objectives. What is the public health significance of a high prevalence of E.coli in broilers?

2. This would be better in the introduction rather than the discussion.

3. it is important you highlight the strengths of your study. Can you provide a brief description of one or two strengths of your study? This is important so we dont only focus on limitations

e. what were the selection criteria for the LBM and SM? These need to be clearly stated

Reviewer #2: It is required that your submitted manuscript should have each line numbered.

It is mandated that page numbers and line numbers be in the manuscript file. Use continuous line numbers (do not restart the numbering on each page).

References: In the text, cite the reference number in square brackets (e.g., “We used the techniques developed by our colleagues [19] to analyze the data”)

Time of study: This study was conducted in 2021 and four years later, it is unclear how the results from this research would still be relevant in the present day.

Introduction

The introduction section does not state what roles the genes associated with or contribute to antibiotic resistance (molecular characterization) play in bacteria carrying them. Also, the authors did not state the rationale for examining breast muscles and the liver in this study.

Methods

2.7 In your methods section you wrote “Correlation analyses between antimicrobial coefficients and corresponding resistance gene abundances”. It is unclear what antimicrobial coefficients mean in this instance.

Did you compare the antimicrobial resistance patterns broadly between the LBMs and SMs to examine if geographical distribution matters?

Results

Kindly note that figures should be at the end of your paper not the result section. PLOS One policy “Do not include figures in the main manuscript file. Each figure must be prepared and submitted as an individual file”

3.2 AMR patterns of E. coli isolates of LBMs and SMs: Is there a reason why the authors did not look for the resistant genes for Tetracycline when a high proportion of 86.78% of isolates showed resistance to Tetracycline (higher than ampicillin)? For ciprofloxacin, the susceptibility in isolates cannot be interpreted as high at 23.14% when compared to the other “highest susceptibility”.

Figure 2c: The correlation coefficient of specific antimicrobials and resistance genes. Did you compute a p-value to determine the significance of the correlation in your samples? The p-value will help in the interpretation of the strength of the relationship between antimicrobial resistance and genes and thus should be included.

References

It is recommended that the authors should update the references to include recent references to reflect current knowledge in this field.

Supplementary Data

The supporting information in this study is sparse thereby making your work hard to reproducible. As explained in PLOS’s Data Policy, be sure to make individual data points and all data and related metadata underlying the findings reported should be provided available as part of the submitted article.

Reviewer #3: The authors are commended for their work on AMR. Once the minor clarifications are made, the paper should be ready for publication

In the methods (there are no line nos to guide), the authors need to state EXACTLY how the liver and breast samples were taken? Was the procedure aseptic. Were the tools reused or single use? Exact size of liver and breast tissue taken? Time interval between slaughter and sample retrieval? Time of the day, etc. It will be good to state what they observed of the environment in which the birds were slaughtered and the chicken were presented prior to sample retrieval across the LBMs.

For the SM samples, we are not told how and from where they were sourced? Same or different suppliers? Same or different packaging? Storage conditions in the SMs? How long have the chicken been placed in the SMs? Etc. Is it not possible that these and other parameters might influence culture yields and trends?

The following statement "The results of this study demonstrated a high prevalence of E. coli in broiler breast muscle and liver samples from both SMs and LBMs, with these isolates" can be better clarified and thus better understood by readers if the above requested but presently missing data is given. Does this statement mean that the birds were prevalence of E. coli is solely from the breast muscle and liver. Or due to post slaughter environmental contamination? Or both? The authors are commended for the limitation section already in place. They may wish to add the lack of environmental samples to the section.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: Yes: Abdulhakeem Abayomi Olorukooba

Reviewer #2: Yes: Damilola Odumade

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: PONE-D-25-06137 rev AAO.pdf

pone.0323909.s003.pdf^{(1MB, pdf)}

PLoS One. 2025 May 14;20(5):e0323909. doi: 10.1371/journal.pone.0323909.r003

Author response to Decision Letter 1

22 Mar 2025

Dear Editor-in-Chief,

Thank you very much for giving us the opportunity to revise our manuscript (Manuscript ID PONE-D-25-06137) entitled “Epidemiology and Molecular Characterisation of Multidrug-Resistant Escherichia coli Isolated from Chicken Meat” for consideration in “PLOS ONE”. This revision has been made following the valuable comments from the three reviewers. Through you, we would like to sincerely thank the distinguished reviewers for their kind contributions to rendering an improved version of the manuscript from the original submission.

Below are our responses to the reviewers’ and additional editor comments:

Additional Editor Comments: In addition to addressing the reviewers comments please fix the following issues.

• Please remove the section numbering from the manuscript.

Author’s response: Thank you for your comment. We removed the section numbering as per suggestion.

• The Limitations section should be omitted. Instead, include limitations as the final paragraph in the Discussion section.

Author’s response: Thank you for your suggestion. The limitation section have been added with final paragraph in the Discussion section.

• Include line numbers throughout the manuscript to facilitate the review process.

Author’s response: Thank you for your suggestions. We added the line number in the revised manuscript as per suggestion.

• In the Conclusion section, based on your findings, provide a paragraph that includes recommendations or potential future research directions.

Author’s response: Thank you for your suggestion. We have added recommendations for future research.

Responses to reviewers’ comments

Reviewer 1

Comments and Suggestions for Authors

Reviewer #1:

Reviewer comment: The authors have conducted a very important and timely study on the epidemiology and molecular characterization of multidrug-resistant Escherichia coli in chicken meat from live bird markets and supermarkets in Chattogram, Bangladesh. This study is highly relevant given the increasing global concerns about AMR and its implications for food safety and public health.

That said, there are some areas where the manuscript could be improved to enhance clarity, scientific rigor, and overall impact. Below, I provide specific comments and suggestions for improvement.

Author’s Response: Thank you for your comments and appreciation of our manuscript.

INTRODUCTION

Reviewer comment: 1. This is a great introduction! However, there is need to include information concerning why you are going to LBM and SMs. Is there any prior evidence differentiating contamination levels or AMR profiles in E. coli from live bird markets vs. supermarkets?

Author’s response: Thank you for your comments. Yes, we published articles based on AMR profiles in LBMs and SMs. We have added a published article link for your check. Besides, we have added a line in the introduction addressing LBMs and SMs roles.

https://www.mdpi.com/2079-6382/12/2/418

https://www.mdpi.com/2076-2607/12/12/2535

Reviewer comment: 2. Also, your introduction needs to clarify why molecular characterization is necessary (e.g., detection of AMR genes, virulence factors, plasmid-mediated resistance)?

Author’s response: Thank you for your comments. We have added the necessity of molecular characterization in the introduction part of revised manuscript.

Reviewer comment: 3. The introduction also needs to specify whether similar studies have been conducted in Bangladesh in the past and how this study adds new insights.

Author’s response: We appreciate your feedback and have incorporated these points into the revised manuscript to strengthen the context and significance of our study.

Reviewer comment: 4. Since this is the first time this acronym -CMA is used in the main manuscript, please write in full for the first use

Author’s response: Thank you. Corrected as suggested.

METHODS

Reviewer comment: 1. Can you include the particular epidemiological study design that was used in this study (e.g, cross-sectional, observational, experimental)? It is important to include this information so the readers can understand the context of the study

Author’s response: Thank you. Corrected as suggested.

Reviewer comment: 2. Can you indicate a brief justification for selecting this study location? Is it that there have been numerous cases or outbreaks of E.coli around the area or what was the reason for this?

Author’s response: Thank you so much for your insightful suggestion. We have added a brief justification of study locations.

Reviewer comment: 3. It is important to include more information about the study area to give a better context and to allow a more objective interpretation of your findings. I understand that part of this study has been published elsewhere but here you need to provide important details also as not every reader will have the chance to get the already published articles. Please include information concerning

a. The total number of LBM and SM in CMA since this is a prevalence study

Author’s response: Thank you for your comment. This information have been added as suggested

Reviewer comment: b. How the sample size was calculated. How can you justify this sample size of 430 samples?

Author’s response: Thank you. The sample size calculation formula have been added.

Reviewer comment: c. The type (Access, Watch or reserve) and availability of antibiotics in the study area including the policy for antibiotic use among farm animals.

Author’s response: Thanks for your comments. Corrected as suggested.

Reviewer comment: d. A brief description of the sampling technique.

Author’s response: Thank you. Sampling techniques have been added in the revised manuscript.

Reviewer comment: FIGURE 1 - These maps are good as they give the reader more insight to the area. For the map please include

1. The source of the map

2. The cardinal points/North arrow

3. The scale

4. The legend

these are crucial information required for any map in a scientific document

Author’s response: Thank you for your comment. Figure 1 have been revised accordingly.

Reviewer comment: 5. Statistical Analysis; if you collected data from LBMs and SM, what tests did you use to make comparisons between LBMs and SMs?

Author’s response: Thank you for this comment. We did not perform any significant test, but we did descriptive analysis.

Reviewer comment: 6. Please specify the particular correlation that was done - Spearman, Pearson's, point bi serial e.t.c

Author’s response: Thank you for your comment. We performed Pearson’s correlation.

RESULTS

Reviewer comment: 1. it would be better to conduct statistical comparisons between LBMs and supermarkets otherwise there may be little significance in seperating the data from the two.

Author’s response: Thank you for your nice comment. We conducted Pearson's Chi-squared test for statistical comparisons between LBMs and SMs and the value add in the Table 2 of revised manuscript though it was not significant.

Reviewer comment: 2. Specify the type of correlation analysis that was performed. As well as the level of significance. Were these values statistically significant?

Author’s response: Thank you. We did Pearson’s correlation.

DISCUSSION

Reviewer comment: 1. It is important in the discussion to highlight the public health significance of each major finding as it relates to your objectives. What is the public health significance of a high prevalence of E.coli in broilers? 2. This would be better in the introduction rather than the discussion.

Author’s response: Thank you for your insightful comments. The public health significance have been added in introduction part of revised manuscript.

Reviewer comment: 3. it is important you highlight the strengths of your study. Can you provide a brief description of one or two strengths of your study? This is important so we dont only focus on limitations

Author’s response: Thank you for your insightful comments. We have added a brief description of strengths of our study in the discussion section of revised manuscript.

Reviewer comment: e. what were the selection criteria for the LBM and SM? These need to be clearly stated

Author’s response: Thank you for your comment. LBMs and SMs were conveniently selected

Reviewer #2:

Reviewer comment: It is required that your submitted manuscript should have each line numbered. It is mandated that page numbers and line numbers be in the manuscript file. Use continuous line numbers (do not restart the numbering on each page).

Author’s response: Thank you for your comment. We have added the line number as suggested.

Reviewer comment: References: In the text, cite the reference number in square brackets (e.g., “We used the techniques developed by our colleagues [19] to analyze the data”)

Author’s response: Thank you. Corrected as suggested.

Reviewer comment: Time of study: This study was conducted in 2021 and four years later, it is unclear how the results from this research would still be relevant in the present day.

Author’s response: Thank you for your comment. Following the completion of our project in 2022, we have published several articles based on our findings. However, we believe that this study remains highly relevant, as there is still a lack of published data on this topic within the specific geographical context of Bangladesh. Our research provides valuable insights into antimicrobial resistance trends, which continue to be a critical public health concern.

Introduction

Reviewer comment: The introduction section does not state what roles the genes associated with or contribute to antibiotic resistance (molecular characterization) play in bacteria carrying them. Also, the authors did not state the rationale for examining breast muscles and the liver in this study.

Author’s response: Thank you for your insightful comments. We will revise the introduction to clearly state the roles of the genes associated with antibiotic resistance and how they contribute to resistance mechanisms in E. coli. Additionally, we will include the rationale for selecting breast muscle and liver for examination, emphasizing their relevance in food safety, human consumption, and the potential for bacterial accumulation in different tissues.

Methods

Reviewer comment: 2.7 In your methods section you wrote “Correlation analyses between antimicrobial coefficients and corresponding resistance gene abundances”. It is unclear what antimicrobial coefficients mean in this instance.

Author’s response: Thank you. We deleted the term coefficients for more understanding

Reviewer comment: Did you compare the antimicrobial resistance patterns broadly between the LBMs and SMs to examine if geographical distribution matters?

Author’s response: Thank you. The source of the broiler chickens were almost same for the LBM and SM that’s why we did not consider the geographical distribution.

Results

Reviewer comment: Kindly note that figures should be at the end of your paper not the result section. PLOS One policy “Do not include figures in the main manuscript file. Each figure must be prepared and submitted as an individual file”

Author’s response: Thank you for your comment. Corrected as suggested.

Reviewer comment: 3.2 AMR patterns of E. coli isolates of LBMs and SMs: Is there a reason why the authors did not look for the resistant genes for Tetracycline when a high proportion of 86.78% of isolates showed resistance to Tetracycline (higher than ampicillin)? For ciprofloxacin, the susceptibility in isolates cannot be interpreted as high at 23.14% when compared to the other “highest susceptibility”.

Author’s response: Thank you. We did a separate study where we gave high priority to tetracycline, which was published in the Antibiotic Journal of MDPI.

Reviewer comment: Figure 2c: The correlation coefficient of specific antimicrobials and resistance genes. Did you compute a p-value to determine the significance of the correlation in your samples? The p-value will help in the interpretation of the strength of the relationship between antimicrobial resistance and genes and thus should be included.

Author’s response: Thank you very much. Added as suggested in the revised version.

References

Reviewer comment: It is recommended that the authors should update the references to include recent references to reflect current knowledge in this field.

Author’s response: Thank you. We have updated the reference list.

Supplementary Data

Reviewer comment: The supporting information in this study is sparse thereby making your work hard to reproducible. As explained in PLOS’s Data Policy, be sure to make individual data points and all data and related metadata underlying the findings reported should be provided available as part of the submitted article.

Author’s response: Thank you. Corrected as suggested.

Reviewer #3:

Reviewer comment: The authors are commended for their work on AMR. Once the minor clarifications are made, the paper should be ready for publication

Author’s response: Thank you for your comment.

Reviewer comment: In the methods (there are no line nos to guide), the authors need to state EXACTLY how the liver and breast samples were taken? Was the procedure aseptic? Were the tools reused or single use? Exact size of liver and breast tissue taken? Time interval between slaughter and sample retrieval? Time of the day, etc. It will be good to state what they observed of the environment in which the birds were slaughtered and the chicken were presented prior to sample retrieval across the LBMs.

Author’s response: Thank you. The liver and breast muscle samples were collected using aseptic techniques to prevent contamination. Sterile scalpels and forceps were used to excise the samples, which were immediately placed in sterile containers. Fresh gloves were worn for each sample, and all instruments were sterilized before and after each collection. Samples were collected within 5 minutes of post-slaughter to minimize bacterial changes due to external factors. Sampling was conducted in morning to account for potential variations in handling and storage conditions. Additionally, we will describe the environmental observations at the live bird markets (LBMs), including hygiene practices, slaughter conditions, and how chickens were handled before sample collection. This information will provide a clearer context for potential sources of bacterial contamination.

Reviewer comment: For the SM samples, we are not told how and from where they were sourced? Same or different suppliers? Same or different packaging? Storage conditions in the SMs? How long have the chicken been placed in the SMs? Etc. Is it not possible that these and other parameters might influence culture yields and trends?

Author’s response: Thank you very much. Please see the revised version.

Reviewer comment: The following statement "The results of this study demonstrated a high prevalence of E. coli in broiler breast muscle and liver samples from both SMs and LBMs, with these isolates" can be better clarified and thus better understood by readers if the above requested but presently missing data is given. Does this statement mean that the birds were prevalence of E. coli is solely from the breast muscle and liver? Or due to post slaughter environmental contamination? Or both? The authors are commended for the limitation section already in place. They may wish to add the lack of environmental samples to the section.

Aut

Attachment

Submitted filename: Revision_Letter_Plos One.docx

pone.0323909.s005.docx^{(28.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0323909.r004

Decision Letter 1

Mabel Kamweli Aworh

16 Apr 2025

Epidemiology and Molecular Characterisation of Multidrug-Resistant Escherichia coli Isolated from Chicken Meat

PONE-D-25-06137R1

Dear Dr. Hassan,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mabel Kamweli Aworh, DVM, MPH, PhD. FCVSN

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: (No Response)

**********

6. Review Comments to the Author

Reviewer #1: Authors have addressed all my concerns and comments. I don't have any further questions or comments.

Reviewer #2: Thank you for including the review comment and submitting a great study. Note reference 31 should be corrected (year of publication is missing)

Reviewer #3: The authors seemed to have addressed almost all of the points raised during the first round of the review process.

They added " In the SMs, the sources of chickens were from different farms and LBMs. Usually, SMs collected poultry from different suppliers throughout the years. The broiler carcasses were kept at 40C overnight and sometimes until sold out." However, this statement does not clearly indicate the time interval between slaughter and sample retrieval, time of the day, etc. as was earlier requested. Ditto for slaughter environment observation requested.

"In total, 430 samples were obtained, consisting of 215 liver and 215 muscle samples." from Line 134 should be reported in the results section not under methods.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: Yes: ABDULHAKEEM OLORUKOOBA

Reviewer #2: Yes: Damilola Odumade

Reviewer #3: No

**********

PLoS One. doi: 10.1371/journal.pone.0323909.r005

Acceptance letter

Mabel Kamweli Aworh

PONE-D-25-06137R1

PLOS ONE

Dear Dr. Hassan,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Mabel Kamweli Aworh

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. List of sample collected from LBMs and SMs.

(DOCX)

pone.0323909.s001.docx^{(16.7KB, docx)}

S2 Table. Main Dataset.

(XLSX)

pone.0323909.s002.xlsx^{(22.4KB, xlsx)}

Attachment

Submitted filename: PONE-D-25-06137 rev AAO.pdf

pone.0323909.s003.pdf^{(1MB, pdf)}

Attachment

Submitted filename: Revision_Letter_Plos One.docx

pone.0323909.s005.docx^{(28.5KB, docx)}

Data Availability Statement

All relevant data are within the article and its Supporting Information files.

[pone.0323909.ref001] 1.Levine MM. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis. 1987;155(3):377–89. doi: 10.1093/infdis/155.3.377 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref002] 2.Akond MA, Alam S, Hassan SMR, Shirin M. Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of bangladesh. Internet J Food Saf. 2009;11:19–23. [Google Scholar]

[pone.0323909.ref003] 3.Laury A, Echeverry A, Brashears M. Fate of Escherichia coli O157:H7 in meat. In: Safety of Meat and Processed Meat. 2009. p. 31–53. [Google Scholar]

[pone.0323909.ref004] 4.Mølbak K. Spread of resistant bacteria and resistance genes from animals to humans—the public health consequences. J Vet Med B. 2004;51(8-9):364–69. [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref005] 5.Salehi TZ, Bonab SF. Antibiotics susceptibility pattern of Escherichia coli strains isolated from chickens with colisepticemia in tabriz province, iran. Int J Poult Sci. 2006;5:677–84. [Google Scholar]

[pone.0323909.ref006] 6.Kittana H, Gomes-Neto JC, Heck K, Geis AL, Segura Muñoz RR, Cody LA, et al. Commensal Escherichia coli strains can promote intestinal inflammation via differential interleukin-6 production. Front Immunol. 2018;9:2318. doi: 10.3389/fimmu.2018.02318 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref007] 7.Moulin G, Cavalié P, Pellanne I, Chevance A, Laval A, Millemann Y, et al. A comparison of antimicrobial usage in human and veterinary medicine in France from 1999 to 2005. J Antimicrob Chemother. 2008;62:617–25. [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref008] 8.Hassan MM, Kalam MA, Alim MA, Shano S, Nayem MRK, Badsha MR, et al. Knowledge, attitude, and practices on antimicrobial use and antimicrobial resistance among commercial poultry farmers in Bangladesh. Antibiotics. 2021;10:784. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref009] 9.Munita JM, Arias CA. Mechanisms of antibiotic resistance. In: Virulence Mechanisms of Bacterial Pathogens. ASM Press. 2016. p. 481–511. doi: 10.1128/9781555819286.ch17 [DOI] [Google Scholar]

[pone.0323909.ref010] 10.Zhang L, Levy K, Trueba G, Cevallos W, Trostle J, Foxman B, et al. Effects of selection pressure and genetic association on the relationship between antibiotic resistance and virulence in Escherichia coli. Antimicrob Agents Chemother. 2015;59:6733–740. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref011] 11.Hassan MM, Amin KB, Ahaduzzaman M, Alam M, Faruk MS, Uddin I. Antimicrobial resistance pattern against Escherichia coli and salmonella in layer poultry. Res J Vet Pract. 2014;2:30–5. [Google Scholar]

[pone.0323909.ref012] 12.van den Bogaard AE, London N, Driessen C, Stobberingh EE. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J Antimicrob Chemother. 2001;47(6):763–71. doi: 10.1093/jac/47.6.763 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref013] 13.McEwen S, Collignon P. Antimicrobial resistance: a one health perspective. In: Antimicrob Resist Bact Livest Companion Anim. 2018. p. 521–47. [Google Scholar]

[pone.0323909.ref014] 14.Osman KM, Kappell AD, Elhadidy M, ElMougy F, El-Ghany WAA, Orabi A, et al. Poultry hatcheries as potential reservoirs for antimicrobial-resistant Escherichia coli: a risk to public health and food safety. Sci Rep. 2018;8:5859. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref015] 15.Nath C, Das T, Islam MS, Hasib FMY, Singha S, Dutta A, et al. Colistin resistance in multidrug-resistant Escherichia coli isolated from retail broiler meat in Bangladesh. Microb Drug Resist. 2023;29(11):523–32. doi: 10.1089/mdr.2023.0026 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref016] 16.Bélanger L, Garenaux A, Harel J, Boulianne M, Nadeau E, Dozois CM. Escherichia coli from animal reservoirs as a potential source of human extraintestinal pathogenic E. coli. FEMS Immunol Med Microbiol. 2011;62:1–10. [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref017] 17.Islam A, Saifuddin AKM, Faruq AA, Islam S, Shano S, Alam M, et al. Antimicrobial residues in tissues and eggs of laying hens at Chittagong, Bangladesh. Int J One Health. 2016;2:75–80. doi: 10.14202/ijoh.2016.75-80 [DOI] [Google Scholar]

[pone.0323909.ref018] 18.Alam GS, Hassan MM, Ahaduzzaman M, Nath C, Dutta P, Khanom H, et al. Molecular detection of tetracycline-resistant genes in multidrug-resistant Escherichia coli isolated from broiler meat in Bangladesh. Antibiotics. 2023;12:418. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref019] 19.Parvin MS, Talukder S, Ali MY, Chowdhury EH, Rahman MT, Islam MT. Antimicrobial resistance pattern of Escherichia coli isolated from frozen chicken meat in Bangladesh. Pathogens. 2020;9(6):420. doi: 10.3390/pathogens9060420 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref020] 20.Tokuda M, Shintani M. Microbial evolution through horizontal gene transfer by mobile genetic elements. Microb Biotechnol. 2024;17(1):e14408. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref021] 21.Tanzin AZ, Nath C, Nayem MR, Sayeed MA, Khan SA, Magalhaes RS, et al. Detection and characterisation of colistin-resistant Escherichia coli in broiler meats. Microorganisms. 2024;12(12):2535. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref022] 22.Malorny B, Hoorfar J, Hugas M, Heuvelink A, Fach P, Ellerbroek L, et al. Interlaboratory diagnostic accuracy of a Salmonella-specific PCR-based method. Int J Food Microbiol. 2003;89:241–49. [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref023] 23.Godambe LP, Bandekar J, Shashidhar R. Species specific PCR based detection of Escherichia coli from Indian foods. 3 Biotech. 2017;7(2):130. doi: 10.1007/s13205-017-0784-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref024] 24.Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45(4):493–6. doi: 10.1093/ajcp/45.4_ts.493 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref025] 25.CLSI. M100: Performance standards for antimicrobial susceptibility testing. 2020. Available from: https://www.nih.org.pk/wp-content/uploads/2020/02/CLSI-2020.pdf [Accessed 20 September 2024]. [Google Scholar]

[pone.0323909.ref026] 26.Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–81. doi: 10.1111/j.1469-0691.2011.03570.x [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref027] 27.Krumperman PH. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl Environ Microbiol. 1983;46(1):165–70. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref028] 28.Lanz R, Kuhnert P, Boerlin P. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet Microbiol. 2003;91(1):73–84. doi: 10.1016/s0378-1135(02)00263-8 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref029] 29.Hasman H, Mevius D, Veldman K, Olesen I, Aarestrup FM. beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J Antimicrob Chemother. 2005;56(1):115–21. doi: 10.1093/jac/dki190 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref030] 30.Hossain M, Siddique M, Hossain F, Zinnah M, Hossain M, Alam M. Isolation, identification, toxin profile, and antibiogram of Escherichia coli isolated from broilers and layers in the Mymensingh district of Bangladesh. Bangl J Vet Med. 2008;6(1):1–5. [Google Scholar]

[pone.0323909.ref031] 31.Jakaria A, Islam MA, Khatun MM. Prevalence, characteristics and antibiogram profiles of Escherichia coli isolated from apparently healthy chickens in Mymensingh, Bangladesh. Microbes & Health. 2013;1(1):27–9. doi: 10.3329/mh.v1i1.13710 [DOI] [Google Scholar]

[pone.0323909.ref032] 32.Bashar T, Rahman M, Rabbi FA, Noor R, Rahman MM. Enterotoxin profiling and antibiogram of Escherichia coli Isolated from Poultry Feces in Dhaka District of Bangladesh. SJ Microbiol. 1970;1(1):51–7. doi: 10.3329/sjm.v1i1.9134 [DOI] [Google Scholar]

[pone.0323909.ref033] 33.Islam MJ, Sultana S, Das KK, Sharmin N, Hasan MN. Isolation of plasmid-mediated multidrug-resistant Escherichia coli from poultry. Int J Sustain Crop Prod. 2008;3(1):46–50. [Google Scholar]

[pone.0323909.ref034] 34.Schroeder CM, Meng J, Zhao S, DebRoy C, Torcolini J, Zhao C, et al. Antimicrobial resistance of Escherichia coli O26, O103, O111, O128, and O145 from animals and humans. Emerg Infect Dis. 2002;8(12):1409–14. doi: 10.3201/eid0812.0200770 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref035] 35.Jacoby G. β-Lactamase classification and amino acid sequences for TEM, SHV and OXA extended-spectrum and inhibitor-resistant enzymes. 2012. Available from: http://www.lahey.org/Studies/ [Google Scholar]

[pone.0323909.ref036] 36.Li X, Watanabe N, Xiao C, Harter T, McCowan B, Liu Y, et al. Antibiotic-resistant E. coli in surface water and groundwater in dairy operations in Northern California. Environ Monit Assess. 2014;186(2):1253–60. doi: 10.1007/s10661-013-3454-2 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref037] 37.Hasan B, Faruque R, Drobni M, Waldenström J, Sadique A, Ahmed KU, et al. High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011;55(4):689–92. doi: 10.1637/9686-021411-Reg.1 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref038] 38.Islam A, Saifuddin AKM, Faruq AA, Islam S, Shano S, Alam M, et al. Antimicrobial residues in tissues and eggs of laying hens at Chittagong, Bangladesh. Int J One Health. 2016;2:75–80. doi: 10.14202/ijoh.2016.75-80 [DOI] [Google Scholar]

[pone.0323909.ref039] 39.Sobur MA, Sabuj AAM, Sarker R, Rahman AMMT, Kabir SML, Rahman MT. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet World. 2019;12(7):984–93. doi: 10.14202/vetworld.2019.984-993 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref040] 40.Ferdous J, Bradshaw A, Islam SKMA, Zamil S, Islam A, Ahad A, et al. Antimicrobial residues in chicken and fish, chittagong, Bangladesh. Ecohealth. 2019;16(3):429–40. doi: 10.1007/s10393-019-01430-6 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref041] 41.Sattar S, Hassan MM, Islam SKM, Alam M, Al Faruk MS, Chowdhury S, et al. Antibiotic residues in broiler and layer meat in Chittagong district of Bangladesh. Vet World. 2014;7(10):738–42. [Google Scholar]

[pone.0323909.ref042] 42.Couper MR. Strategies for the rational use of antimicrobials. Clin Infect Dis. 1997;24(Suppl 1):S154-6. doi: 10.1093/clinids/24.supplement_1.s154 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref043] 43.Kalam MA, Alim MA, Shano S, Nayem MRK, Badsha MR, Mamun MAA, et al. Knowledge, attitude, and practices on antimicrobial use and antimicrobial resistance among poultry drug and feed sellers in Bangladesh. Vet Sci. 2021;8(6):111. doi: 10.3390/vetsci8060111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref044] 44.Okeke IN, Lamikanra A, Edelman R. Socioeconomic and behavioral factors leading to acquired bacterial resistance to antibiotics in developing countries. Emerg Infect Dis. 1999;5(1):18–27. doi: 10.3201/eid0501.990103 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref045] 45.Barbosa TM, Levy SB. The impact of antibiotic use on resistance development and persistence. Drug Resist Updat. 2000;3(5):303–11. doi: 10.1054/drup.2000.0167 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref046] 46.Levy SB. The challenge of antibiotic resistance. Sci Am. 1998;278(3):46–53. doi: 10.1038/scientificamerican0398-46 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref047] 47.Hofacre C, Fricke J, Inglis T. Antimicrobial drug use in poultry. Antimicrob Ther Vet Med. 2013;2013:569–87. [Google Scholar]

[pone.0323909.ref048] 48.Summers AO. Genetic linkage and horizontal gene transfer, the roots of the antibiotic multi-resistance problem. Anim Biotechnol. 2006;17(2):125–35. doi: 10.1080/10495390600957217 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref049] 49.Gill CO. Microbiological conditions of meats from large game animals and birds. Meat Sci. 2007;77(2):149–60. doi: 10.1016/j.meatsci.2007.03.007 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref050] 50.Gandra S, Kotwani A. Need to improve availability of “access” group antibiotics and reduce the use of “watch” group antibiotics in India for optimum use of antibiotics to contain antimicrobial resistance. J Pharm Policy Pract. 2019;12:20. doi: 10.1186/s40545-019-0182-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0323909.ref051] 51.Hsia Y, Lee BR, Versporten A, Yang Y, Bielicki J, Jackson C, et al. Use of the WHO Access, Watch, and Reserve classification to define patterns of hospital antibiotic use (AWaRe): an analysis of paediatric survey data from 56 countries. Lancet Glob Health. 2019;7(7):e861–71. doi: 10.1016/S2214-109X(19)30071-3 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref052] 52.Barnett ML. The rationale for the daily use of an antimicrobial mouthrinse. J Am Dent Assoc. 2006;137(Suppl 1):16S–21S. doi: 10.14219/jada.archive.2006.0408 [DOI] [PubMed] [Google Scholar]

[pone.0323909.ref053] 53.Moellering RC Jr. Rationale for use of antimicrobial combinations. Am J Med. 1983;75(1A):4–8. doi: 10.1016/0002-9343(83)90088-8 [DOI] [PubMed] [Google Scholar]

PERMALINK

Epidemiology and molecular characterisation of multidrug-resistant Escherichia coli isolated from chicken meat

Hamida Khanom

Chandan Nath

Philip P Mshelbwala

Md Ridoan Pasha

Ricardo Soares Magalhaes

John I Alawneh

Mohammad Mahmudul Hassan

Roles

Abstract

Introduction

Methodology

Ethical approval

Study location and design

Fig 1. Map depicts locations of selected LBMs and SMs of Chattogram Metropolitan Area.

Sample collection, transportation, and processing

Isolation and presumptive detection of E. coli

Molecular detection of E. coli

Table 1. The oligonucleotide primer sequences used in this study.

AST of E. coli

Detection of antimicrobial resistance genes

Statistical analysis

Results

Prevalence of E. coli in LBMs and SMs

Table 2. The overview of the sample collected and frequency of E. coli from different sources.

AMR patterns of E. coli isolates of LBMs and SMs

Fig 2. AMR patterns of E. coli isolated from broiler chicken muscle and liver samples.

MDR profiles of E. coli

Table 3. The phenotypic AMR patterns of E. coli isolates, along with the MAR index.

Correlation of antimicrobials, resistance genes with E. coli isolates from LBMs and SMs

Fig 3. The heatmap illustrates the AMR profiles of liver and muscle samples, along with resistance genes,

Discussion

Conclusion

Supporting Information

Acknowledgments

Data Availability

Funding Statement

References

Author response to Decision Letter 0

Decision Letter 0

Mabel Kamweli Aworh

Roles

Author response to Decision Letter 1

Decision Letter 1

Mabel Kamweli Aworh

Roles

Acceptance letter

Mabel Kamweli Aworh

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases