Genotypic Distribution of Alpha-Like Proteins in Group B Streptococcus Strains Isolated in Korea: Implications for Vaccine Coverage

Abstract

Background

Group B Streptococcus (GBS) is a major cause of invasive bacterial diseases, including sepsis, meningitis, and pneumonia, particularly in newborns and infants. Pregnant adults, those with pre-existing conditions, and older adults are particularly susceptible. Ongoing research is focused on developing various vaccines utilizing different antigens, including capsular polysaccharides and alpha-like proteins (Alps). Epidemiological data on these antigens in GBS is essential for predicting the effectiveness of these vaccines. However, no epidemiological studies on Alps genotype have been conducted in Korea. This study aimed to fill this gap by investigating the distribution and characteristics of the alp genotype in domestic clinical strains.

Materials and Methods

We analyzed 386 GBS strains isolated from various clinical specimens between April 2000 and November 2018. The serotype of each strain was initially verified using a slide latex agglutination reaction, then confirmed by polymerase chain reaction to determine the presence of the genes bca, rib, alp1, alp2, alp3, and alp4 associated with Alps. Strains were then classified as invasive or non-invasive based on the type of clinical specimen. The distribution of serotypes and alp genotype was analyzed across these classifications.

Results

We analyzed 386 bacterial strains to assess their clinical characteristics, serotypes, and alp genotype distributions. Of these strains, 47.1% (182 strains) were invasive primarily isolated from blood samples (43.3%, 167 strains), whereas non-invasive strains were more frequently isolated from sites such as the vagina and urethra. Serotype III was the most prevalent across both invasive and non-invasive strains, comprising 28.2% (109 strains) of all isolates. Notably, 79.5% (307 strains) of all isolates were encompassed by the hexavalent vaccine (serotype Ia, Ib, II, III, and V) formulations. Furthermore, the rib genotype was the most common, detected in 39.4% (152 strains) of all isolates, with a higher prevalence in non-invasive samples (44.1%, 90 strains).

Conclusion

Although the distribution of alp genotypes differed between invasive and non-invasive strains, the proportion of bca and rib was substantial. Therefore, Alp protein vaccine containing Rib and Cα antigens is expected to provide protection against prevalent GBS strains in Korea. Additional epidemiological studies on GBS vaginal colonization in pregnant women and invasive neonatal strains are needed to support early neonatal sepsis prevention in these high-risk groups.

Graphical Abstract

Introduction

Streptococcus agalactiae (group B Streptococcus, GBS) is a Gram-positive bacterium responsible for invasive bacterial diseases, including sepsis, meningitis, and pneumonia, in newborns and infants under 3 months of age [1].

While GBS infection has been primarily recognized as a pediatric disease, it is also a significant pathogen that colonizes both pregnant and nonpregnant adults, particularly older adults and those with underlying medical conditions. Maternal colonization is a well-established risk factor for subsequent GBS sepsis in neonates [2]. Approximately 50% of carrier mothers transmit the infection to their babies, with 1% of neonatal carriers developing invasive diseases [3]. Common clinical symptoms of GBS infection in adults include skin and soft tissue infections, primary bacteremia, bone and joint infections, and pneumonia [4].

GBS expresses capsular polysaccharide (CPS), a well-known virulence factor, that evades the host immunity by protecting bacteria from opsonophagocytosis by immune cells [5]. Furthermore, CPS enhances the invasiveness of GBS by promoting biofilm formation, inhibiting the binding of antimicrobial peptides to neutrophil extracellular traps, and promoting bacterial adhesion to the epithelium and mucus [6]. Additionally, a correlation has been reported between the presence of CPS-specific antibodies in serum and increased risk of GBS early-onset disease (EOD) and late-onset disease (LOD) due to GBS [7]. Therefore, CPS is considered the optimal target for GBS vaccine development, and leading to actual vaccine development and clinical studies. To date, 10 CPS serotypes (Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX) have been identified [1].

The CPS vaccine was introduced to pregnant women in the 1980s. It has been clinically tested in healthy adults but has proven to be somewhat lacking in immunogenicity [8]. Consequently, CPS-conjugated protein-based GBS vaccines are currently under development. For CPS-conjugated vaccines, CPS from GBS is used as the primary target, and immunogenicity is enhanced through the covalent conjugation of tetanus toxin or a protein carrier such as CRM197. Phase I and II trials of the trivalent (Ia, Ib, and III) CPS-CRM197 GBS conjugate vaccine and preclinical studies of pentavalent (Ia, Ib, II, III, and V) CPS-CRM197 vaccines are currently underway. This vaccine is being developed to provide immunization during pregnancy and prevent invasive GBS in newborns and infants. Moreover, clinical trials have been conducted on trivalent vaccines in both nonpregnant and pregnant women, and most of the reported local and systemic reactions have been mild to moderate, with no serious side effects related to the vaccine. Notably, more than 75% of vaccine recipients, both nonpregnant and pregnant, demonstrated a >4-fold increase in serotype-specific IgG concentrations, and mother-to-infant IgG transfer rates ranged from 50% to 81% for all serotypes [9]. CPS-conjugated vaccines effectively induce protective antibodies against the serotypes included in the vaccine. However, CPS-conjugated vaccines have the limitation of inducing protective antibodies primarily against the serotypes included in the vaccine, which may result in insufficient protection against non-included serotypes.

Therefore, protein-based vaccines have been developed to overcome these disadvantages. Because protein vaccines use common GBS proteins as vaccine targets, broad protective immunity can be induced across serotypes [1]. A series of alpha-like proteins (Alps) encoded by the bca, rib, alp1, alp2, alp3, and alp4 genes, among GBS proteins, have been demonstrated to play an important role in the development of GBS and are currently leading vaccine candidates. Almost all GBS express proteins belonging to Alps, including Cα (bca), Alp1 (alp1), Alp2 (alp2), Alp3 (alp3), Alp4 (alp4), and Rib (rib), all of which induce protective immunity [10]. In general, Cα protein belongs to serotype Ia, Ib and II, and Rib protein was mostly found in serotype III strains. In addition, the Alp3 protein was found in serotypes V and VIII, and the Alp2 protein was found in a few strains, including serotypes Ia, III, and V [11]. The sequence structure of Alp family proteins is similar to that of many surface proteins of Gram-positive bacteria, with an N-terminal signal sequence, repeat region, cell wall-anchored region with an LPXTG motif, short hydrophobic region, and charged tail [12,13,14].

Alps possess 2 major antigenic domains, 1 located in the N-terminal region and the other in the C-terminal region. Most of the N-terminal sites showed protein specificity, whereas the C-terminal sites exhibited broader cross-reactivity. All non-protein-specific domains exhibit immunological cross-reactivity, with the corresponding domains in at least 1 other Alp [10]. Furthermore, immunological cross-reactivity has been reported between Cα and Alp2 and among Alp1, Alp2, and Alp3 [15].

Recently, a protein-based vaccine based on a fusion protein of the N-terminal domain of Alps, Rib and Alp C (N-terminals of Cα and Rib, GBS-NN), has been prepared and is undergoing clinical trials. Importantly, a phase 1a study was completed using the GBS-NN in nonpregnant female volunteers, and a phase 1b study was conducted to confirm its safety and dosage in nonpregnant women. To date, the results have indicated the promising safety and immunogenicity of GBS-NN in nonpregnant women [1].

With the development and widespread use of various bacterial vaccines, the number of infectious diseases caused by bacteria has rapidly decreased. However, GBS infection remains a large disease burden because no vaccine has yet been developed. Therefore, prevention and treatment of infections, analysis of pathological mechanisms, and effective efforts to develop new vaccines are important. As the currently developed CPS vaccines exhibit low immunogenicity, membrane protein vaccines are being developed for a wider range of protection compared to that of serotype-specific immunity. Among the membrane protein vaccines, Alps vaccines have been extensively studied. Epidemiological information on the antigens of the domestically prevalent GBS strain is required to predict the effectiveness of vaccines developed to prevent GBS infection in Korea. However, epidemiological studies on GBS related to Alps in Korea remain limited, highlighting the need for further research in this area. Vaccines targeting GBS must consider the epidemiological characteristics of strains specific to each region. This study provides foundational data on the distribution of Alps in GBS isolates from Korean clinical specimens, which could inform the development and optimization of vaccines tailored to vulnerable populations, such as neonates and pregnant women in Korea. We analyzed the epidemiology and characteristics of the Alps by determining the genotype of GBS strains isolated from domestic clinical samples.

Materials and Methods

1. Group B streptococcal collection

GBS samples were obtained from Ewha Womans University Mokdong Hospital, Chonbuk National University Hospital, Gachon University Gil Medical Center, and Seoul National University Bundang Hospital between April 2000 and November 2018. A total of 386 GBS samples were analyzed. Among these, cases in which bacteria were identified in the blood, cerebrospinal fluid, joint fluid, and normally sterile body fluids were defined as invasive infections, and the strains were classified as invasive strains. To identify the GBS Alp type, strains with known Alp types were obtained and used as references. Strains with previously identified Alp types and serotypes were obtained to use as positive controls for establishing Alp typing. For the Cα type, National Collection of Type Cultures (NCTC) 11078 (A909) (serotype Ia) was obtained, whereas for the Alp1 type, the American Type Culture Collection (ATCC) BAA-1177 (515) (serotype Ia) was used. Similarly, for the Alp2 type, ATCC 12403 (NEM316) (serotype III), and for the Rib type, ATCC BAA-1176 (COH1) (serotype III) were acquired from the ATCC (Manassas, VA, USA) [16]. Because of the unavailability of commercially available strains with Alp3 were not commercially available, a strain confirmed as Alp3-positive (GBS B13-16) through polymerase chain reaction (PCR), based on a previously published method, was used as a positive control for subsequent analyses. The GBS B13-16 strain (serotype V) was obtained from Seoul National University Bundang Hospital.

After GBS was subcultured on blood agar medium using a 10 µL inoculation loop, colonies exhibiting beta hemolysis, Gram-stain positive, and catalase-negative were selected. GBS was identified by confirming the enhancement of hemolysis using the Christie–Atkins–Munch–Peterson test.

The strain was inoculated onto a blood agar medium and incubated in a CO₂ incubator at 37°C for 20 h. Colonies were harvested into 812 µL of THYB medium, which is a mixture of Todd–Hewitt Broth (Becton-Dickinson, Sparks, MD, USA) and Yeast Extract (Becton-Dickinson). Subsequently, 188 µL of 80% glycerol was added to the mixture. Assay stock was stored at -80°C.

2. Ethics statement

In this study, no patient information was collected, and only bacterial isolates from clinical specimens were used. According to the Institutional Review Board’s policy, bacterial isolates obtained from clinical specimens are not classified as human-derived materials and, as such, are not subject to IRB review or exemption.

3. Serotyping

GBS serotypes were identified using slide latex agglutination. A latex agglutination test was performed using the ImmuLex Streptococcus Group Kit (SSI Diagnostica, Hillerød, Denmark). The latex reagent was added dropwise for each serotype (Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX) on the slide, and the bacteria were mixed with each latex reagent using a 10 µL loop. After approximately 30 s, each aggregation reaction was monitored to determine the serotype. For the coverage analysis of the CPS and Alps vaccine, the distribution of serotypes corresponding to the trivalent protein conjugate and Alps vaccines, both currently in development, was confirmed.

4. Genotyping of the alp gene

1) DNA extraction

A genomic DNA purification kit (Promega, Madison, WI, USA) was used to extract DNA from the GBS. First, bacteria were inoculated and cultured on a blood agar medium. The next day, all bacteria were scraped into 1 mL of THYB and centrifuged for 2 min (25°C, 16,000 RCF) to remove the supernatant. Subsequently, 480 µL of 50 mM EDTA and 120 µL of 10 mg/mL lysozyme were added, reacted at 37°C for 60 min, and centrifuged for 2 min (25°C, 16,000 RCF) to remove the supernatant. After adding 600 µL of cell nucleus lysis solution, the mixture was incubated at 80 °C for 5 min. Subsequently, 3 µL of RNase A was added, and the sample was incubated at 37°C for 60 min. After 200 µL of the protein precipitation solution was added to the sample, the sample was thoroughly mixed, left on ice for 5 min, and centrifuged for 3 min (25°C, 16,000 RCF) to obtain 600 µL of supernatant. The supernatant was added to 600 μL of isopropanol stored in a new tube, mixed carefully, and centrifuged for 2 min (25°C, 16,000 RCF) to remove the supernatant. The precipitated sample was washed with 600 µL of 70% ethanol, centrifuged for 3 min (25 °C, 16,000 RCF) to remove the supernatant, and dried at room temperature. Finally, 100 µL of the DNA rehydration solution was added to the sample and stored at 4 °C for 1 d.

2) Multiplex PCR

The PCR mixture was prepared according to the manufacturer’s instructions. The final volume of 50 µL was achieved with the following components: 5 µL of 50 ng/µL template DNA, 3 µL of 5× Colorless GoTaq Flexi buffer, 1 µL of 25 mM MgCl2, 1.25 µL of each dNTP mixture (2.5 mM each), 3 µL of primer mix (10 pmol/µL for each of the 6 primers) (Table 1), and 0.25 µL of 5 U/µL DNA polymerase (Promega). The remaining volume (32.75 µL) was adjusted using nuclease-free water. PCR cycling parameters included an initial denaturation at 96 °C for 3 min, followed by denaturation at 95°C for 60 sec, annealing of primers at 58°C for 45 sec, and elongation at 72°C for 45 sec. After the denaturation, bonding, and elongation processes were performed a total of 35 times, the final polymerization reaction was performed at 72°C for 10 min.

Table 1. Nucleotide primer sequences and amplicon size expected for each group B Streptococcus surface protein gene considered in this study.

Primer	Sequence (5′→3′)	Target gene	Amplicon size (bp)
Universal forwarda	TGATACTTCACAGACGAAACAACG
Alpha-C reversea	TACATGTGGTAGTCCATCTTCACC	bca	398
Rib reversea	CATACTGAGCTTTTAAATCAGGTGA	rib	295
Alp1 reversea	CCAGATACATTTTTTACTAAAGCGG	alp1	200
Alp2/3 reversea	CACTCGGATTACTATAATATTTAGCAC	alp2, alp3	334
Alp4 reversea	TTAATTTGCACCGGATTAACACCAC	alp4	110
bal23S1b	CAGACTGTTAAAGTGGATGAAGATATTACCTTTACGG	alp2, alp3	426
bal2A2b	GGTATCTGGTTTATGACCATTTTTCCAGTTATACG	alp2
bal23S2b	CTTAAAGCTAAGTATGAAAATGATATCATTGGAGCTCGTG	alp2, alp3	240
bal3Ab	GACCGTTTGGTCCTTACCTTTTGGTTCGTTGCTATCC	alp3

^aFrom reference [37].

^bFrom reference [38].

GBS reference strains (5 strains) and selected clinical isolates (386 strains) were analyzed via multiplex PCR. Among these, 34 strains were analyzed again using alp2 and alp3 PCR to distinguish between 2/3. In the multiplex PCR, alp2 and alp3 could not be distinguished, necessitating an additional PCR step, as the two proteins are identical over the first half of their sequence [17].

3) PCR amplification of Alps encoding genes

First, 50 µL of the alp2 PCR mixture contained 5 × Colorless GoTaq Flaxi Buffer, 25 mM MgCl₂, 2.5 mM for each dNTP mixture, 2 primers (bal23S1-bal2A2) at a concentration of 10 pmol/µL (Table 1), and 5 U/µL of DNA polymerase (Promega).

The PCR to confirm alp2 underwent an initial heat treatment at 96°C for 3 min. After the DNA was denatured at 96°C for 30 sec and the primers were bound at 55°C for 30 sec, the DNA was elongated at 74°C for 30 sec. After the denaturation, bonding, and elongation processes were performed a total of 35 times, the final polymerization reaction was performed at 72°C for 10 min.

Next, 50 µL of alp3 PCR mixture contained 5×Colorless GoTaq Flaxi Buffer, 25 mM MgCl₂, 2.5 mM of each dNTP mixture, 2 primers (bal23S2-bal3A) at a concentration of 10 pmol/µL (Table 1), and 5 U/µL of DNA polymerase (Promega). In the PCR to identify alp3, the DNA was denatured at a temperature of 96 °C for 30 sec, following an initial heat treatment at 96°C for a period of 3 min. After binding the primers at 66°C for 30 s, the DNA was elongated at 74°C for 30 s. After the denaturation, bonding, and elongation processes were performed a total of 35 times, and the final polymerization reaction was performed at 72°C for 10 min.

4) Electrophoresis

The PCR amplification products were analyzed using agarose gel electrophoresis to determine the alp. A 2% agarose gel was prepared by dissolving agarose powder in 1×Tris-acetate-EDTA (TAE) buffer and heating until fully dissolved. After cooling to approximately 50–60°C, ethidium bromide was added to the gel at a final concentration of 0.5 µg/mL to enable visualization under UV light. The gel was poured into a casting tray equipped with a comb and allowed to solidify at room temperature. Upon solidification, the gel was placed into an electrophoresis tank containing 1×TAE buffer. A 6×loading dye was mixed with the PCR products at a ratio of 1:5 (loading dye: PCR product), and the samples were loaded into individual wells alongside a DNA ladder (1 kb ladder) as a molecular size reference. Electrophoresis was performed at 100 V for 30–40 minutes, or until the dye front migrated an appropriate distance. Subsequently, the gel was then transferred to a UV transilluminator, and the amplified DNA bands were visualized and documented using a gel documentation system. Band sizes were compared against the DNA ladder to confirm the size of the PCR amplification products. Each size-corresponding band was interpreted to assign specific alp genotypes based on established size criteria for each variant.

5) Statistical analysis

Descriptive statistics were used to summarize the data. Categorical variables were presented as frequencies and percentages. Statistical analysis and data processing for generating charts were performed using Excel 2023 (Microsoft Corporation, Redmond, WA, USA) and GraphPad Prism version 10.1 (GraphPad Software, San Diego, CA, USA).

Results

1. Clinical characteristics of the strains

The 386 samples used in this test included 182 invasive strains (47.2%) and 204 non-invasive strains (52.8%), with non-invasive strains accounting for a higher proportion than invasive strains (Fig. 1). Of the 182 invasive strains, 168 (43.5%) were found in the blood, 10 (2.6%) in the cerebrospinal fluid, 3 (0.8%) in the joint fluid, and 1 (0.3%) in the pleural fluid. Among the non-invasive strains, 46 (11.9%), 125 (32.4%), 21 (5.4%), 1 (0.3%), 1 (0.3%), 1 (0.3%), and 2 (0.5%) were found in the vagina, urethra, pus, skin, ear, catheter, and nose, respectively (Table 2).

Figure 1. Serotypes distribution of group B Streptococcus isolated in invasive and non-invasive strains (A). Serotype coverage comparison of trivalent (blue dashed line) and hexavalent vaccines (red dashed line) (B).

Table 2. Number of group B Streptococcus isolates by type of specimen.

Origin	Number of isolates (%)
Blood	168 (43.5)
Urine	125 (32.4)
Vaginal discharge	46 (11.9)
Pus	21 (5.4)
CSF	10 (2.6)
Synovial fluid	3 (0.8)
Nasal swab	2 (0.5)
Skin swab	1 (0.3)
Ear	1 (0.3)
Catheter	1 (0.3)
Pleural fluid	1 (0.3)
Other	9 (2.3)
Total	386 (100)

CSF, cerebrospinal fluid.

2. Serotypes

From the slide latex agglutination test for 10 serotypes (Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX), type III was the most common, with 109 strains (28.2%), followed by type Ib with 65 strains (16.8%), type Ia with 60 strains (15.5%), type V with 60 strains (15.5%), type VIII with 45 strains (11.7%), type VI with 34 strains (8.8%), type II with 11 strains (2.8%), and type IV with 2 strains (0.5%; Table 3); meanwhile, serotypes VII and IX were not identified. Among the 386 strains tested, 234 strains (60.5%) were encompassed by the trivalent protein conjugate vaccine, which targets serotypes Ia, Ib, and III. Additionally, 305 strains (78.8%) were encompassed by the pentavalent vaccine, which includes serotypes Ia, Ib, II, III, and V. Analysis of the serotypes of invasive strains (182 strains) isolated from the blood, cerebrospinal fluid, joint fluid, and pleural fluid revealed that 56 strains (30.8%) were type III, 34 strains (18.7%) were type Ib, 32 strains (17.6%) were type V, 28 strains (15.4%) were type Ia, 17 strains (9.3%) were type VI, 7 strains (3.9%) were type VIII, 6 strains (3.3%) were type II, and 2 strains of type IV (1.1%) (Fig. 1). Serotype III was the most common invasive strain. Among the non-invasive strains (204 non-invasive strains), 52 (25.5%) were type III, 38 (18.6%) were type VIII, 32 (15.7%) were type Ia, 31 (15.2%) were type Ib, 28 (13.7%) were type V, 17 (8.3%) were type VI, 5 (2.4%) were type II, and 1 (0.5%) was type IV (Fig. 1). Among the non-invasive strains, serotype III was the most prevalent.

Table 3. Distribution of serotypes and alp genotypes among group B Streptococcus isolates.

Alp type	Serotype								Total (%)
	Ia	Ib	II	III	IV	V	VI	VIII
bca	11	61	10	4	2	3	34	2	127 (32.9)
rib	8	0	0	103	0	1	0	40	152 (39.4)
alp 1	28	2	0	0	0	8	0	0	38 (9.8)
alp 2	3	0	0	0	0	7	0	0	10 (2.6)
alp 3	10	0	1	1	0	41	0	2	55 (14.2)
non-alp	0	2	0	1	0	0	0	1	4 (1.0)
Total (%)	60 (15.5)	65 (16.8)	11 (2.8)	109 (28.2)	2 (0.5)	60 (15.5)	34 (8.8)	45 (11.7)	386 (100)

3. Alp genotype distribution

Of the 386 strains, 152 (39.4%) had rib, 127 (32.9%) had the bca, and alp3 was detected in 55 strains (14.2%) (Table 3). However, alp4 was not detected. Additionally, 279 strains (72.3%) contained Alps genes (bca, rib) included in the protein vaccine currently under development (Fig. 2).

Figure 2. alp genotype distribution of group B Streptococcus isolated in invasive and non-invasive strains (A). The bca and rib genotypes, which have been extensively studied in the context of vaccines and are clinically significant, appear to constitute 72.3% of the samples (red dashed line) (B).

Analysis of the alp genotype of the invasive strains isolated from the blood, cerebrospinal fluid, joint fluid, and pleural fluid revealed that 62 strains (34.1%) had rib genotype, 60 strains (33.0%) had bca genotype, 28 strains (15.4%) had alp3 genotype, 23 strains (12.6%) had alp1 genotype, and 8 strains (4.4%) had alp2 genotype. The rib genotype was the most common (Fig. 3). Analysis of the alp genotype of the non-invasive strains showed that 90 strains (44.1%) had the rib genotype. The bca genotype was found in 67 strains (32.8%), alp3 genotype in 27 strains (13.2%), alp1 genotype in 15 strains (7.4%), and alp2 genotype in 2 strains (1.5%). The rib genotype was the most common.

Figure 3. Serotypes and alp genotypes distribution of group B Streptococcus isolated in invasive strains. The serotype coverage of the trivalent vaccine (solid blue line) is 64.8%, while the serotype coverage of the hexavalent vaccine (dashed red line) is 86.26%. The bca and rib genotypes were identified in 67.6% of invasive strains.

Discussion

In this study, we analyzed 386 GBS samples, comprising 182 (47.2%) invasive and 204 (52.8%) non-invasive strains. Although demographic details such as age, sex, and underlying conditions of were unavailable, serotypes Ia, Ib, II, III, V, VI, and VIII were identified. Serotype III was the most frequently observed (28.2%), followed by serotype Ib (16.8%). These findings align with those of previous studies on the molecular epidemiology of strains isolated from mothers and newborns in Korea [18,19,20].

EOD accounts for 60–70% of neonatal GBS infections. Among the 10 serotypes, Ia, II, III, and V are predominant in EOD cases [21]. In the U.S., serotype III constituted one-third of EOD and 90% of LOD cases in the 1970s and 1980s. By the 1990s, serotypes Ia (35–40%), III (25–30%), and V (15%) were prominent [22]. In Korea, serotype III remains the leading cause of neonatal meningitis, representing 51.2% of invasive cases and 72.7% of meningitis cases [23]. Other studies in Korea identified serotypes III (44.6%), V (28.6%), Ia (14.3%), and Ib (10.7%) as common in neonatal infections [24]. Serotype III was more frequent in full-term infants, while serotype V predominated in preterm infants [25]. Although this study did not focus exclusively on isolates from neonatal infections or maternal colonization and has certain limitations, it suggests that serotypes III and V are similarly predominant.

Globally, the incidence of invasive GBS in pregnant women is estimated at 0.38 per 1000 pregnancies, with a mortality rate of 0.2% [26]. Serotypes Ia and III account for most maternal systemic cases, followed by V, Ib, and II [26]. In Japan, serotypes VIII (36.0%) and VI (25.0%) were predominant among pregnant women, while serotype VIII accounted for 6% of invasive cases in Denmark [27,28]. In our study, serotypes VI (8.8%) and VIII (11.7%) were identified, demonstrating a different distribution compared to international data. These findings elucidates the importance of ongoing epidemiological studies to assess the potential effectiveness of the trivalent CPS vaccine in improving maternal vaccine coverage in Korea.

In nonpregnant adults, serotypes V (27.2%) and Ia (24.3%) dominated in United States (US) studies (1992–1999) and later reports from Sweden and the US [29,30]. In our study, serotype II was detected at a notably lower proportion (2.8%) compared to international reports. Considering the increasing prevalence of GBS infections among nonpregnant adults in Korea, comprehensive epidemiological investigations are required to monitor serotype distribution and address those not covered by current vaccines.

Of the 386 strains tested in this study, serotype Ia constituted 15.5%, Ib for 16.8%, III for 28.2%, and V for 15.5%. These findings are consistent with previous reports from the US, where serotypes Ia, Ib, III, and V are among the most prevalent [29,31]. For nonpregnant adults, serotype V was more common than serotypes Ia, Ib, and III, indicating that the trivalent CPS vaccine (Ia, Ib, and III) may have limited efficacy in adults. However, pentavalent vaccines (Ia, Ib, II, III, and V) provide broader coverage. Recently, in view of the increase in diseases caused by serotype IV, this serotype was added to create a hexavalent vaccine (serotypes Ia, Ib, II, III, IV, and V) with the aim of covering at least 98% of GBS isolates that cause neonatal invasive disease. Therefore, monitoring serotype distribution in Korean clinical specimens is essential.

Several GBS surface proteins, including Alps, have been identified as potential vaccine candidates. In the Alps, Cα (bca), Alp1 (alp1), Alp2 (alp2), Alp3 (alp3), Alp4 (alp4), and Rib (rib) are present [21], and these surface antigens allow antibodies to interrupt bacterial pathogenicity. These surface proteins appear to be effective vaccine candidates because of their potential to interfere with the Fc receptors in phagocytes and promote opsonophagocytosis. Vaccines utilizing Cα and Rib proteins have been developed, and animal studies have demonstrated that maternal immunization can prevent neonatal infections [32]. In addition, unlike CPS, protein antigens do not need to be conjugated with other molecules; therefore, protein antigens can elicit protective T cell-dependent antibody responses and have the potential to induce long-lasting immunity [33]. Moreover, these bacterial proteins have been shown to induce cross-protective immunity [33]. Furthermore, all strains of clinically significant serotype III express the protein rib, which elicits protective immunity. Of the 4 typical serotypes, 90% of GBS strains express either Cα or Rib, suggesting that a combination of these 2 proteins could be utilized to develop a protein vaccine against GBS.

In this study, alp genotypes were confirmed in the following order: rib, bca, alp1, alp2, and alp3. Among them, rib were the most common (39.4%). Moreover, bca and alp3 genes were found in most serotypes (Fig. 2).

In the distribution of the alp genotypes of the 75 isolates that caused GBS infection reported in Italy, 55 strains (73.3%) had rib genotype, 8 strains (10.7%) had bca genotype, 8 strains (10.7%) had alp1 genotype, 3 strains (4.0%) had alp3 genotype, and 1 strain (1.3%) had alp2 genotype. Genotype rib was mainly found in serotype III strains and in only 1 serotype II strain. Furthermore, the alp1 genotype was mostly identified in serotype Ia strains and partially in serotype IV and V strains. The bca genotype was mainly identified in serotype Ib strains and was present in some serotype Ia and II strains. The alp3 genotype was identified only in serotype V strains, and alp2 genotype was detected only in serotype II strains [34]. Compared to the results of this study, rib and bca genotypes were the most common among all alp genotypes, and serotype III and Rib, serotype Ib and Cα, and serotype V and Alp3 were correlated with each other. Therefore, most GBS contain Rib and Cα, which are antigens included in the Alp protein vaccine.

Of the strains used in this study, 279 (72.3%) harbored rib and bca genes, which are antigens contained in the Alps vaccine. The Alps vaccine coverage was greater than that of the 234 strains (60.6%), including polysaccharide-conjugated vaccine antigens (trivalent conjugate vaccine). Even if this was limited to invasive strains, there were 122 strains (67.0%) containing the Alps vaccine antigen, which was more than the 118 strains (64.8%) containing polysaccharide conjugate vaccine antigens (trivalent conjugate vaccine). Therefore, the coverage of the Alps vaccine was greater than that of the polysaccharide conjugate vaccine. In addition, it has been reported that Cα and Rib cross-react with Alp1, Alp3, and Alp4 [10], suggesting that the coverage can be even greater.

Recent developments in GBS vaccine development and clinical trials have shown promising results for GBS6 (PF-06760805), a hexavalent investigational maternal vaccine candidate currently in Phase 2 studies. This vaccine aims to protect against 6 major serotypes of GBS (Ia, Ib, II, III, IV, and V). The Phase 2 trials are currently evaluating the safety and immunogenicity of GBS6 in pregnant women and infants. These studies are being conducted in various countries, including South Africa, the US, and the United Kingdom [35]. Notably, MinervaX is developing a protein-based GBS vaccine and has completed participant recruitment for phase 2 studies in South Africa, Uganda, Denmark, and the United Kingdom. This vaccine has shown strong immune responses and a promising safety profile in both pregnant and nonpregnant women. The MinervaX approach focuses on the fusion of highly immunogenic and protective protein domains from the GBS surface proteins [36].

This study has some limitations. First, no demographic information were included, it cannot represent the epidemiology of GBS strains in mothers and newborns, which are the most important groups for GBS infection and the target group for vaccine introduction. Second, clinical symptoms were not collected, the isolates classified as invasive strains might not necessarily represent true infections or strains causing invasive disease. Therefore, it is necessary to collect and analyze invasive clinical strains from multiple institutions. Furthermore, studies that support the actual protein expression in strains by genotyping analysis and bacterial killing by vaccine-induced antibodies are needed. Additional analyses of cross-reactions between vaccine-induced antibodies and other Alps are necessary.

In this study, serotype III and the rib genotype of Alps were the most commonly identified. Upon separate analysis of the invasive strains, serotype III was the most frequent, and the rib genotype was the most commonly observed. To effectively prevent GBS infections, it is necessary to continuously monitor the epidemiology of vaccine-target antigens of circulating strains in Korea to develop appropriate vaccines and determine vaccine policies. Future studies should address the limitations identified in this study, including the absence of demographic data, to better inform vaccination strategies and improve health outcomes for both mothers and infants.