Abstract

Germin and Germin-like proteins (GLPs) are a class of plant proteins that are part of the Cupins superfamily, found in several plant organs including roots, seeds, leaves, and nectar glands. They play a crucial role in plant defense against pathogens and environmental stresses. Herein, this study focused on the promoter analysis of OsGLP12-3 in rice cultivar Swat-1 to elucidate its regulation and functions. The region (1863bp) of the OsGLP12-3 promoter from Swat-1 genomic DNA was amplified, purified, quantified, and cloned using Topo cloning technology, followed by sequencing. Further in silico comparative analysis was conducted between the OsGLP12-3 promoters from Nipponbare and Swat-1 using the Plant CARE database, identifying 24 cis-acting regulatory elements with diverse functions. These elements exhibited distinct distribution patterns in the 2 rice varieties. The OsGLP12-3 promoter revealed an abundance of regulatory elements associated with biotic and abiotic stress responses. Computational tools were employed to analyze the regulatory features of this region. In silico expression analysis of OsGLP12-3, considering various developmental stages, stress conditions, hormones, and expression timing, was performed using the TENOR tool. Pairwise alignment indicated 86% sequence similarity between Nipponbare and Swat-1. Phylogenetic analysis was conducted to explore the evolutionary relationship between the OsGLP12-3 and other plant GLPs. Additionally, 2 unique regulatory elements were modeled and docked, GARE and MBS to understand their hydrogen bonding interactions in gene regulation. The study highlights the importance of OsGLP12-3 in plant defense against biotic and abiotic stresses, supported by its expression patterns in response to various stressors and the presence of specific regulatory elements within its promoter region.
1. Introduction
Oryza sativa L., commonly known as rice, holds pivotal status as a primary cereal crop. Global rice production for the year 2015–2016, as reported by the United States Agriculture Department (USAD), reached 469.32 million metric tons. Acknowledging its significance as a model crop plant, Devos and Gale emphasize its utility in elucidating fundamental traits like productivity, yield, hybrid vigor, disease resistance, and stress tolerance due to its fully sequenced genome.1 Despite O. sativa maintaining a diploid genome structure (2n = 24), certain Oryza species exhibit tetraploid genomes (4n = 48). Noteworthy is rice’s distinction among food crops for possessing a relatively compact genome, with repetitive sequences constituting approximately half of its genetic content.2 The rice genome comprises 12 chromosomes, displaying genetic diversity across both cultivated and wild species.3,4 In-depth genomic analysis,5 reveals extensive genetic diversity, with the identification of over 50,000 genes within the O. sativa genome.
Germins and germin-like proteins (GLPs) belong to the cupin superfamily of plant proteins6 and play an important role in the plant’s defensive mechanism against osmotic and homeostasis stresses.7 Additionally, they are involved in enhancing the plant’s resistance to oxidative stress caused by both abiotic and biotic stimuli,8−10 have provided a comprehensive description of the germins and GLPs, highlighting their occurrence in plants and their association with several developmental processes.10,11 Additionally, it has been reported that the genome of O. sativa has a considerable collection of GLPs. As a result, O. sativa serves as a model plant for investigating the structural and functional characteristics of germins and GLPs. Several studies have documented the presence and manifestation of GLPs in different plant tissues,10,12,13 as well as their response to various unfavorable environmental conditions.14−16 GLPs have a wide range of expression patterns. Certain developmental stages, including fruit ripening, blooming initiation, and embryogenesis.17,18 Several biotic and abiotic stress situations, including attacks by pathogens,13,19 herbivores,20 and osmotic stress,13 induce different GLPs. It was found that pathogens activate the barley GER4c gene promoter.21 In a continuation study,22 used expression profile data to select an expressed-sequence tag (EST) encoding a putative GLP that is expressed in leaves to functionally analyze the EgGLP gene promoter from Eucalyptus grandis. They also confirmed the promoter activity through reverse transcription polymerase chain reaction (PCR) analysis. Additionally, two GLP gene-promoters from two conifers were studied (LmGER1 from hybrid larch and PcGER1 from Pinus caribaea).17 The PcGER1 promoter was shown to be active throughout cell growth,23,24 whereas the LmGER1 promoter was found to be responsible for reporter gene expression in developing embryonic root caps and cotyledons.17
The main goals of this study are the amplification of the OsGLP12-3 promoter region from rice genomic DNA, cloning it into a cloning vector, its sequencing, and the use of computational tools to characterize the regulatory elements and potential transcription-factor binding sites. Furthermore, an analysis was carried out on the interplay between the transcription factors and associated regulatory elements. Two transcription factors, the MYB binding site (MBS) and gibberellin responsive elements (GARE), which have a major impact on plant growth and the response to drought stress, respectively, were selected from the several transcription factors found in the OsGLP12-3 gene promoter to assess protein–DNA interactions. The presence of regulatory elements in matching promoters and the expression profile of the OsGLP12-3 gene in response to different abiotic and biotic stresses indicate that this protein is vital for plant defense against pathogens and abiotic stress conditions.
2. Materials and Methods
2.1. Plant Material and Their Cultivation
The seeds of Rice O. sativa L. cultivar Swat-1 were obtained from the National Agriculture Research Centre (NARC) Pakistan. After the surface sterilization, these were cultivated on MS basal media hydro-phonically under aseptic conditions.
2.2. Primer Designing and PCR Amplification
For the amplification of the OsGLP12-3 gene-promoter region from the selected rice variety, a specific set of primers was designed from available sequences in GenBank of NCBI (National Center for Biotechnology Information) with the assistance of primer 3 (version 0.4.0), and the sequence of primers is given below;
Forward Primer: 5′-CACCACCTTGACTTGTTGTCAG-3′
Reverse Primer: 5′-CATGTTAAGTTGATGGAACTTTTG-3′
Genomic DNA was extracted from the leaf tissues by the Cetyltrimethyl Ammonium Bromide (CTAB) method described by.29 Extracted DNA was used for the amplification of the OsGLP12-3 gene promoter (1863bp). For the amplification of the OsGLP12-3 gene promoter region, a 200 μL PCR reaction mixture was prepared using Dream Taq Green Master Mix 2X (Thermo Scientific) 100 μL, with 72 μL of PCR grade Water provided with Master Mix, 20 μL of template DNA and 4 μL of each 25 Pmol forward and reverse primers, and the reaction was set to run: the conditions were pre-denaturation at 94 °C for 3 min followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 51 °C for 30 s, and extension at 72 °C for 1 min. The final extension cycle was set at 72 °C for 7 min.
2.3. Cloning, Sequencing, and Computational Analysis of the Sequence
2.3.1. Cloning
Amplified PCR products were purified using Monarch DNA Gel Extraction Kit (New England Biolabs) as per the manufacturer’s instructions. The amplified promoter sequence was cloned to a cloning vector using the Invitrogen pCR 2.1 Topo cloning kit as per the manufacturers’ instructions.
2.3.2. Sequencing
The gel-purified PCR products were sequenced by acquiring services from Macrogen Seoul, South Korea.
2.3.3. Computational Analysis of the Promoter Sequence
Various bioinformatics tools, sequence searches, and databases were used for the analysis of the sequencing data. The basic local alignment search tool (BLAST) was used to detect the similarity between sequences. Nucleotide Blast (BLASTn) was applied to find the sequence’s resemblance with previously submitted sequences in the sequence databases (http://blast.ncbi.nlm.nih.gov).25−28 The sequences which show a high level of similarity were selected for the phylogenetic analysis which includes the sequences from the Sorghum bicolor, Setaria italica, Zea mays, O. sativa Japonica group and Panicum hallii, Dichanthelium oligosanthes, Triticum uratru, Hordeum vulgare subspp. Vulgare, Aegilops tauschi subspp. Tauschii, Triticum aestivum, and Japonica Rice PAC (PI Artificial Chromosome) clone which also belongs to the monocot group of plants. The software tool CLUSTAL-X downloaded from (https://www.clustal.org), and is available offline, was utilized to align the promoter’s sequence with other GLP promoters to perform phylogenetic analysis and multiple sequence alignment. The homology and differences between OsGLP12-3 and other GLP promoters were determined by using the MEGA 7 software program, which can be downloaded from (https://www.megasoftware.net/active_download), phylogenetic tree was constructed to determine the degree of similarity between OsGLP12-3 and other GLPs promoters as well as to trace back the evolutionary history of genes.16,25 The promoter region was searched for several cis-acting regulatory elements using the bioinformatics tool Plant CARE, which can be accessed at http://bioinformatics.psb.ugent.30 A separate DOG 2.0 program was utilized to map various cis-acting regulatory elements downloaded from (www.mybiosoftware.com/protein-sequence-analysis). Additionally, an online information tool called WEB 3DNA, which can be accessed at http://w3dna.rutgers.edu/, was utilized to model the cis-acting regulatory elements located in the promoter region. PDB was used to derive the structural information about the regulatory components of the potential interacting pairs. Missing residues, atomic resolution, and mutation were the selection criteria used to determine which template should be used for further DNA–protein docking study.31 The HADDOCK web server, which is accessible online at http://haddock.chem.com, was used to perform protein–DNA docking. PyMol, the Molecular Graphic System, which is accessible online at (http://www.pymol.com), was used to visualize the graphic analysis of every model.25 Additionally, the TENOR “The Encyclopedia of Rice” database, available online at (http://tenor.dna.affrc.go.jp/),32 was used to predict and understand gene’s regulatory characteristics, in terms of gene expression, which is governed by cis-acting elements that are the Transcription-factor binding sites located on the promoter. The information available, with context to the expression of the gene, governed by its promoter, during development and in response to abiotic and biotic stresses, were retrieved from the TENOR database.33 For data retrieval from the TENOR database different parameters; including different abiotic stress conditions, and development, along with the time period taken, for the expression of the OsGLP12-3 gene, were used.16,25
3. Results and Discussion
3.1. Amplification by PCR
The promoter region was amplified by PCR and resolved as indicated in Figure 1 on a TBE-agarose gel.
Figure 1.
Amplified OsGLP12-3 is represented by Lane 1 and the 1KB + DNA Ladder is represented by Lane L.
3.2. Confirmation of Cloning
To determine whether the inset was present in the retrieved putative-recombinant plasmids, PCR was performed using the plasmids as a template. This was done using insert-specific primers and resolved on a TBE-agarose gel, as shown in Figure 2.
Figure 2.
Using gene-specific primers, the clone was confirmed.
3.3. Sequencing
The PCR-amplified product of the OsGLP12-3 gene promoter was used for the sequencing. The obtained sequence data for the OsGLP12-3 gene-promoter region from Rice variety Swat-1 exhibited 86% similarity, with the OsGLP12-3 promoter sequence from O. sativa variety Nipphonbare, which is taken as a standard. The sequence was finally submitted to the Genbank database, and accession number MK946667.1 was obtained.
3.4. Comparative Phylogenetic Analysis and Multiple Sequence Alignment
For building a phylogenetic tree, multiple sequence alignments and phylogenetic analyses were applied to determine the evolutionary relationship between OsGLP12-3 and other GLPs from various plants. Using phylogenetic analysis and MSA, two major clades are formed. While the sequences in Clade-2 came from the Japonica Rice PAC (PI Artificial Chromosome) clone, which is also a member of the monocot group of plants, the sequences in Clade-1 came from monocot plants, such as S. italica, S. bicolor, Z. mays, O. sativa Japonica and P. hallii, T. uratru, D. oligosanthes, H. vulgare subspecie Vulgare, and Tauschii Aegilops tasuschi subspecie Titicum aestium. Two sub-groups, which were subsequently sub-divided into two sub-groups, were formed from the further division of Clade-1. Two sub-groups were created out of group two. However, it was discovered that sub-group 1, and sub-group 2 had a cluster of GLP12-2 branches that belonged to D. oligosanthes and a cluster of additional sub-groups that contained sequences of GLPs from different plants. But as Figure 3 illustrates, OsGLP12-3 was grouped in Sub-group 1B, which also included the hypothetical protein PAHAL F01217 from P. hallii and another GLP protein, PHAL F01217 from Japonica rice. The OsGLP12-3 Promoter from Indica rice cultivar Swat-1 is closely connected to the Japonica group of rice according to the phylogenetic study.
Figure 3.
Phylogenetic tree showing the evolutionary relationship of OsGLP12-3 with GLPs from different other plants.
3.5. Identification and Mapping of the cis-Acting Regulatory Elements
In the two rice cultivars, Swat-1 and Nipponbare (taken as a standard for comparison), the OsGLP12-3 gene promoter region revealed to include many cis-acting regulatory elements.25 It was discovered in this investigation that these two varieties contain 24 significantly distinct cis-acting elements. Twenty of these regulatory elements, which are listed in Table 1, were found to be unique in one variety with distinct copy numbers from the remaining elements being discovered to be common in both. Thirteen distinct elements were found in Swat-1, whereas seven were found in Nipponbare. In Swat-1, two unique regulatory components were reported. Every regulatory element’s location was plotted on the OsGLP12-3 promoter. Figure 4 provides a map of the cis-acting elements present on the promoter. A detailed comparison of the several cis-acting regulatory elements present in the two rice varieties’ OsGLP12-3 Promoter regions; Nipphonbare and Swat-1 are denoted by V1 and V2, respectively is given in Table 1.
Table 1. Comparison of the Several cis-acting Regulatory Elements Present in the Two Rice Varieties OsGLP12-3 Promoter Regions; Nipphonbare and Swat-1, Denoted by V1 and V2, Respectively.
| copy
number |
position |
||||||
|---|---|---|---|---|---|---|---|
| Sr.,# | name of the regulatory element | sequence of the element | V1 | V2 | V1 | V2 | function of regulatory element |
| 1 | G-Box | CACGTTCACACATGGAACACATGG | 2 | 0 | 56–58 | 0 | involved in light responsiveness34 |
| 2 | CAAT-Box | CAATCCAATCAAATCAATTCCAATCCAATCAATTGGCAAT | 7 | 15 | 128–483 | 105–686 | common cis-acting element in promoters, enhancer region35 |
| 3 | Box-4 | ATTAATATTAATATTAAT | 3 | 3 | 352–400 | 273–390 | part of a conserved DNA module involved in light responsiveness36 |
| 4 | TATA-Box | ATATATTATATATAATAATTATATATAAATTTTATATATAATATATACCTATAAATTTAATATCTATATATT | 26 | 32 | 42–642 | 30–729 | core promoter element around −30 of transcription initiation region37 |
| 5 | I-Box | GTATAAGGCCGTATAAGGCCGATAGGG | 1 | 0 | 291 | 0 | part of light-responsive element38 |
| 6 | W-Box | TTGACCTTGACC | 2 | 2 | 125–560 | 113–548 | linked to gibberellin signaling repression and pathogen-related gene induction39 |
| 7 | 5UTR Py-rich stretch | TTTCTTCTCT | 2 | 2 | 79–114 | 555–591 | element conferring high transcription levels40 |
| 8 | O2-Site | GATGACATGG | 1 | 1 | 117 | 552 | element involved in Zein metabolism regulation41 |
| 9 | Box-W1 | TTGACC | 2 | 2 | 125–560 | 113–548 | fungal elicitor responsive element42 |
| 10 | TATCCATC-Motif | TATCCAT | 1 | 1 | 108 | 564 | gibberellin induction element43 |
| 11 | CE3 | GACGCGTGTC | 0 | 1 | 0 | 551 | element involved in ABA and VP1 responsiveness44 |
| 12 | TCCC-Motif | TCTCCCT | 1 | 0 | 288 | 0 | part of a light-responsive element45 |
| 13 | MBS | CGGTCACAACTG | 0 | 2 | 0 | 112–755 | MYB binding site involved in drought inducibility46 |
| 14 | AE-Box | AGAAACAT | 1 | 1 | 309 | 362 | part of a module for light responsiveness47 |
| 15 | C-Repeat/DRE | TGGCCGAC | 1 | 1 | 408 | 263 | regulatory element involved in cold and dehydration responsiveness48 |
| 16 | AAGAA-Motif | GAAAGAAGGTAAAGAAA | 2 | 0 | 486–469 | 0 | regulatory element involved in plant development49 |
| 17 | GARE-Motif | AAACAGA | 0 | 1 | 0 | 119 | gibberellin responsive element50 |
| 18 | GAG-Motif | GGAGATG | 2 | 0 | 286–521 | 0 | part of a light-responsive element51 |
| 19 | GATA-Motif | GATAGGG | 1 | 0 | 291 | 0 | part of a light-responsive element52 |
| 20 | RY-Element | CATGCATG | 1 | 0 | 386 | 0 | element involved in seed-specific regulation53 |
| 21 | LAMP-Element | CTTTATCA | 1 | 0 | 297 | 0 | part of a light-responsive element54 |
| 22 | Skn-1-Motif | GTCAT | 1 | 0 | 373 | 0 | element required for endosperm expression55 |
| 23 | ATCT-Motif | AATCTAATCC | 1 | 1 | 354 | 342 | part of a conserved DNA Module involved in light responsiveness56 |
| 24 | P-Box | CCTTTTG | 1 | 2 | 550 | 662 | part of a light-responsive element57 |
Figure 4.
Localizations and Arrangements of various cis-acting regulatory elements in the OsGLP12-3 Promoter.
3.6. Transcription Factor Interactions with Regulatory Elements
Studying the interactions between DNA and proteins is crucial to the understanding of gene expression regulation.16 In the current study, two TFs (MBS and GARE) were chosen to dock for the detection of DNA protein interactions as indicated in Figure 5 and Figure 6 based on the buried surface area, HADDOCK score, and cluster size as provided in Table 2. Before being chosen for docking, the aforementioned transcription factors were modeled to identify DNA–protein interactions. Structural information regarding protein–DNA docking complexes was analyzed in terms of Hydrogen bonding residues. The transcription factor GARE was docked with the cis-acting element 5′ AACCTAA 3′ forming hydrogen bonds between them as illustrated by the dotted lines in Figure 7. Its Hydrogen bonding interactions between the protein–DNA residues along with the bond distances among them are shown in Table 3. Furthermore, the second TF, MBS was also docked to the regulatory element 5′ CGGTCA 3′ the Hydrogen bonds formed are shown by the dotted lines in Figure 8. Its Hydrogen bonding interactions between the protein–DNA residues along with the bond distances among them are shown in Table 4. Previous studies have demonstrated that hydrogen bonds between the sequences of proteins and DNA are the causes of TFs DNA interactions.16,58
Figure 5.

Unveiling TF GARE interactions with AACCTAA cis-acting element: Showing the hydrogen bonding through green-dotted lines.
Figure 6.

Exploring TF MBS interactions with the CGGTCA cis-acting element: highlighting hydrogen bonding via green-dotted lines.
Table 2. Results of HADDOCK Web Server Regarding the Interaction between TFs and cis-acting Elements.
| proteins/DNA | HADDOCK score | cluster size | RMSD (Å) | van der Walls energy (kcal/mol) | electrostatic energy (kcal/mol) | desolation energy (kcal/mol) | restrains violation energy (kcal/mol) | buried surface area |
|---|---|---|---|---|---|---|---|---|
| GARE-CGGTCA | –142.0 | 18 | 13.1 | –85.4 | –661.6 | 28.9 | 168.1 | 1883.3 |
| GARE-CGGTCACAACGA | –159.5 | 23 | 57.7 | –85.8 | –615.1 | 26.8 | 226.0 | I 57.7 |
| GARE- AGAAACAT | –165.6 | 26 | 64.6 | –84.8 | –616.8 | 28.2 | 203.6 | 1852.I |
| MBS- AACCTAA | –185.7 | 24 | 68.0 | –62.1 | –411.7 | 25.6 | 660.7 | 168-1 |
| MBS-ACCTAAAG | –129.8 | 16 | 50.5 | –63.2 | –557.6 | 18.5 | 206.4 | 1777.0 |
| MBS-CGGTTAA | –114.6 | 21 | 45.0 | –65.0 | –126.6 | 7.5 | 432.3 | 1722.2 |
Figure 7.
Modeling the interaction of TF GARE with the AACCTAA cis-acting element.
Table 3. Hydrogen Bonds between DNA Sequence AAACAGA and the TF GARE.
| protein residue | protein atoms | amino acid position | DNA residue | DNA atoms | nucleotide position | distance in Å |
|---|---|---|---|---|---|---|
| LYS | HZ2 | 3 | T | O5 | 11 | 2.3 |
| LYS | HZ3 | 3 | T | O1P | 12 | 2.0 |
| LYS | HZ1 | 43 | A | O1P | 9 | 2.0 |
| LYS | HZ1 | 43 | A | O5′ | 10 | 2.3 |
| LYS | HZ2 | 63 | A | O1P | 1 | 2.0 |
| LYS | HZ1 | 63 | A | H5″ | 2 | 2.8 |
| ARG | HN | 52 | A | O1P | 2 | 1.9 |
| HIS | HE2 | 53 | G | O6 | 3 | 2.3 |
| SER | HN | 7 | G | O1P | 17 | 2.4 |
| SER | HN | 7 | T | O2P | 18 | 1.9 |
| TYR | HH | 40 | T | O1P | 18 | 2.1 |
| ASN | HD2 | 49 | T | O2P | 19 | 2.1 |
| TRP | O | 47 | T | O2P | 18 | 3.6 |
| TYR | HH | 8 | T | O2P | 18 | 2.0 |
| SER | HE2 | 50 | T | O6 | 19 | 2.3 |
| SER | HG | 50 | T | O2P | 18 | 2.1 |
Figure 8.
Modeling the interaction of TF MBS with the CGGTCA cis-acting element.
Table 4. Hydrogen Bonds between DNA Sequence CGGTCACAACTG and the TF MBS.
| protein residue | proteins atoms | amino acid position | DNA residue | DNA atoms | nucleotide position | distance in Å |
|---|---|---|---|---|---|---|
| LYS | HZ3 | 7 | T | O1P | 26 | 2.2 |
| LYS | HZ3 | 7 | T | 02P | 27 | 2.1 |
| ARG | HN11 | 8 | A | 02P | 25 | 2.9 |
| ARG | HN11 | 8 | C | O1P | 24 | 2.1 |
| ARG | HE | 8 | T | 02P | 26 | 2.1 |
| ARG | HH21 | 10 | T | 02 | 8 | 2.4 |
| ARG | HE | 10 | T | 02 | 26 | 2.1 |
| ASN | HD22 | 18 | A | O1P | 14 | 2.3 |
| LYS | HN | 19 | T | O1P | 23 | 2.1 |
| LYS | HZ3 | 19 | C | O1P | 24 | 2.1 |
| LYS | HZ2 | 17 | G | O1P | 13 | 2.1 |
| GLY | HN | 20 | T | O1P | 22 | 2.1 |
| GLY | HN | 20 | T | O1P | 23 | 2.2 |
| ARG | HH21 | 12 | G | 04 | 13 | 2.5 |
| ARG | HN | 12 | T | O1P | 23 | 2.1 |
| SER | HG | 16 | C | 03 | 24 | 2.6 |
| GLY | HN | 15 | A | O1P | 12 | 2.1 |
| GLY | HN | 11 | A | 04 | 25 | 2.4 |
| GLY | HN | 11 | A | 04 | 24 | 2.4 |
3.7. DNA–Protein Docking Analysis
Further computational analysis was performed for the two important transcription factors, MBS and GARE, to better understand how the transcriptional regulation of OsGLP12 3 gene expression works.59 Structural information regarding protein–DNA docking complexes was analyzed in terms of Hydrogen bonding residues. As shown by the dotted lines in Figure 7, a typical model generated by HADDOCK, the transcription factor GARE was docked with the cis-acting element 5′ AACCTAA 3′ creating hydrogen bonds between them. N7 exhibited the greatest quantity of hydrogen bonds in the protein DNA docking data along with THR20, SER70, ILE69, GLY68, and ASN66. Additionally, as Table 3 below shows, Hydrogen bonds bound O1P and LYS18, C2 and ALA21, N and LYS63, O2P and GLY68, and C2N3 and GLY13. As observed in Figure 8, a second TF MBS was also affixed to regulatory element 5′ CGGTCA 3′ by the use of dotted lines to illustrate hydrogen bonding. Stronger connections between the protein and DNA were indicated by this TF’s smaller gap and fewer dots between residues. In particular, O2P created the most hydrogen bonds with ARG 126, AGR223, AGR180, AND LEU181. Furthermore, hydrogen bonds were observed between O1P and ARG126, O3 and ARG126, O4 and ALA120 and LUC119, N6 and PR O121 and ALA120 and C5 AND GLY AND PRO123 as shown in the Table. 4 below.
3.8. In Silico Expression Analysis of OsGLP12-3 Gene
In silico analysis for the expression data of the OsGLP12-3 gene was retrieved from the TENOR database. Parameters for data retrieval included development and abiotic stress conditions including hormones, along with the time taken for the expression of the OsGLP12-3 gene.33
3.8.1. Expression of OsGLP12-3 Gene during Development
The OsGLP12-3 gene can be observed to be involved in plant development, mainly in roots. Maximum expression level was observed in the first 3 h after germination and was found to be continuously expressed after the first expression. These results are in agreement with former findings by,60 in which they observed the involvement of the OsGLP-1 gene in root elongation when it was transgenically overexpressed in Tobacco.
3.8.2. Expression of OsGLP12-3 Gene in Response to Hormonal Stimuli and Abiotic Stresses
The data gathered about the response of the OsGLP12-3 gene to abiotic stress conditions included: high and low concentrations of phosphorus and cadmium; drought (dry), high salinity, flood; cold treatment; osmotic stresses; and hormones, which indicate that all abiotic factors, including hormones, can induce the OsGLP-12-3 gene. Examples of these factors include abscisic acid30,60,39,32 and jasmonic acid.61−64,39,65 For examination, two different tissue types, the roots and shoots, were chosen.
Five days subsequent to the initial exposure of the plant to cadmium stress in its roots, high level of gene expression in response to heightened cadmium stress was observed. Intriguingly, the commencement of expression ensued within 1 h postexposure to elevated cadmium concentrations, sustaining at moderated levels across the plant’s development. Noteworthy is the observation in Figure 9, illustrating the expression of the OsGLP12-3 gene in shoots subjected to elevated cadmium stress. The graphical representation in Figure 9 delineates the profile of gene expression, with initiation observed no earlier than 12 hours postexposure to elevated cadmium stress and an exponential surge maintained for a discrete period of 5 days. Under various abiotic stress conditions, including osmotic stress (flood-induced), dry conditions, flooding, and varying cadmium concentrations, the expression levels of OsGLP-12-3 exhibit distinct patterns. Modest expression is observed in response to osmotic and dry stresses, while lower moderate expression is noted under flood and low cadmium stresses. It is noteworthy that under high cadmium concentrations, the gene predominantly responds in roots with minimal expression in shoots, a behavior observed consistently even at low cadmium concentrations. Under flood stress, the OsGLP-12-3 gene demonstrates a lower moderate expression, as depicted in Figure 9. Across all instances, the gene consistently responds to various abiotic stresses, albeit with variable intensity, predominantly in roots. Notably, during strong salinity stress, the gene exhibits activity in both roots and shoots, with roots displaying a 2-fold higher expression level than shoots. The expression pattern in response to hormones, such as jasmonic acid and abscisic acid, is positive in both roots and shoots, but sustained expression is limited to roots. Analyzing in silico results, it becomes evident that the OsGLP-12-3 gene consistently and primarily expresses itself in roots under abiotic stress conditions, encompassing high and low phosphorus, high salinity, high cadmium, drought, flood, cold, and osmotic stress. Additionally, in response to hormones like ABA and MeJa (methyljasmonate), the OsGLP-12-3 gene expression is consistently induced in roots. Hormone-induced increases in OsGLP-12-3 gene expression exhibit erratic patterns, reinforcing the predominant expression in roots and comparatively lower expression in shoots, as depicted in Figure 9. Lu et al., reported in their study that indole acetic acid (IAA) stimulates the expression of the soybean GmGER genes. This phenomenon reflects that the expression of germin-like proteins genes is affected by hormones.66
Figure 9.
Mapping the expression pattern of the OsGLP12-3 gene: hormonal induction, developmental variation, and diverse stress responses.
Germins and germin-like proteins (GLPs) are ubiquitous plant proteins characterized by their diverse sequences and evolutionary lineage. They perform pivotal functions in response to both biotic and abiotic stressors with their expression detected across diverse plant organs and developmental stages. Furthermore, they actively participate in critical processes and pathways associated with plant development and defense systems.67 Comparative analysis discloses 86% similarity in the sequence of the OsGLP12-3 promoter between Swat-1 and Nipponbare, underscoring a close relationship within the Indica and Japonica rice groups. Phylogenetic analysis further demonstrates the variable homology in GLPs across distinct plant species. The OsGLP12-3 gene promoter from Japonica rice exhibits a link with the Hypothetical protein PAHAL F01217 from Panicurn hallii, suggesting independent gene duplication events during evolution.66In silico analysis of the expression of OsGLP12-3’s during development corroborates earlier findings in soybean. Regulatory control over the treatment of OsGLP12-3 involves hormones such as ABA and jasmonate. The OsGLP12-3 promoter harbors cis-acting elements TGACG (for MeJA recognition) and GACGCGTGTC (for the ABA response). The gene exhibits varied responses to abiotic stresses, aligning consistently with prior reports in soybean and rice.14,66 Various OsGLP promoter region analyses revealed the presence of abiotic and biotic stress-related transcription factor binding sites. Phylogenetic analysis also confirms the evolutionary significance and expression of OsGLP genes govern by their respective promoters.16 Analysis of the OsGLP12-3 promoter region reveals unique gibberellic-acid-responsive elements (GARE) and W-box cis-acting elements. The W-box is linked to gibberellin signaling repression and pathogen-related gene induction.68 The OsGLP12-3 promoter features light-responsive I-box elements and two GATA boxes pivotal to light-induced gene expression. In Swat-1, two copies of the cis-acting element CGGTCA are identified, binding MYB transcription factors linked to drought inducibility. These findings correlate with the responsiveness of the OsGLP12-3’s to drought and flood stress conditions. Overall, the promoter encompasses elements associated with diverse stresses, light responses, and developmental processes.25 The distinctive elements within the promoter render it valuable for applications, such as genetically engineered stress-resistant crops. Comprehending gene regulation necessitates the exploration of DNA–protein interactions and hydrogen bonding, which influences stability and specificity. Transcription factors (TFs) linked to cis-acting elements with strong hydrogen bonds play a crucial role in gene regulation.69 Docking findings reveal that hydrogen bonds stabilize interactions between TFs and regulatory elements, contributing to the regulation of the expression of the OsGLP12-3 gene expression.
4. Conclusions and Outlook
Germin and Germin-like proteins in different plant species may have originated through distinct gene duplication events. Nucleotide sequences reveal no significant differences between the Indica Rice and Japonica Rice groups in the vicinity of the OsGLP12-3 promoter. The promoter region of OsGLP12-3 holds economic importance, harboring numerous cis-acting regulatory elements that are responsive to both biotic and abiotic stimuli. This characteristic renders it as a valuable tool for developing stress-resistant crops. Stabilization of the connections between regulatory DNA regions and their associated transcription factors involves several potential hydrogen bonds. The expression of the OsGLP12-3 gene is regulated by a stable connection between transcription factors (TFs) and their associated regulatory elements. In silico findings necessitate further validation through an in vitro expression analysis. Furthermore, The OsGLP12-3 Promoter may be engineered upstream of the GUS gene and subsequently transfermed in potatoes to assess its activity against biotic and abiotic stresses. If OsGLP12-3 imparts resistance to these stress conditions, then it holds promise for integration into agriculturally important crops to enhance resistance against both biotic and abiotic stresses.
Acknowledgments
The authors acknowledge the financial support through Researchers Supporting Project number (RSPD2024R691), King Saud University, Riyadh, Saudi Arabia.
Data Availability Statement
The authors confirm that the data supporting the findings of this study are available within the article [and/or] its Supporting Information.
Supporting Information Available
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.3c09670.
Pairwise alignments, the expression of OsGLP12-3 gene during development; expression in response to various abiotic stimuli in detail; specific cis-acting regulatory elements with their proposed functions in detail, CTAB (cetyltrimethylammonium bromide) buffer, TE (Tris–EDTA) buffer, MS (Murashig and Scouge) solution, 10× TBE (tris borate ethyl dimethyl tetra acetic acid) buffer, SOC (super optimal broth with catabolite repression) media composition for 1 L, composition of LB (Luria Broth) media for 1L composition of stock as well as working important solutions which were used during the experimental work, sequence of OsGLP12-3 promoter from Indica rice cv Swat-1. Topo cloning principle, preparation for heat shock competent cells, transformation of heat shock Escherichia coli DH5α competent cells (PDF)
Author Contributions
A.R.: Conceptualization and writing—original draft preparation, I.U.: Writing, U.Z.: Formal analysis, A.S.: Editing, R.A.: Project funding, K.S.S. and D.I.S.: Supervision. All authors have read and agreed to the published version of the manuscript.
The authors declare no competing financial interest.
Supplementary Material
References
- Devos K. M.; Gale M. D.. Comparative genetics in the grasses. In Oryza: From Molecule to Plant; Springer, 1997; pp 3–15. [PubMed] [Google Scholar]
- Chang T.-T.Origin, Domestication, and Diversification. In Rice: Origin, History, Technology, and Production; John Wiley & Sons, Inc., 2003; pp 3–26. [Google Scholar]
- Nakagahra M.; Okuno K.; Vaughan D.. Rice Genetic Resources: History, Conservation, Investigative Characterization and Use in Japan. In Oryza: From Molecule to Plant; Springer, 1997; pp 69–77. [PubMed] [Google Scholar]
- Vaughan D. A.; Morishima H.; Kadowaki K. Diversity in the Oryza genus. Curr. Opin. Plant Biol. 2003, 6 (2), 139–146. 10.1016/S1369-5266(03)00009-8. [DOI] [PubMed] [Google Scholar]
- Goff S. A.; Ricke D.; Lan T.-H.; Presting G.; Wang R.; Dunn M.; Glazebrook J.; Sessions A.; Oeller P.; Varma H.; et al. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 2002, 296 (5565), 92–100. 10.1126/science.1068275. [DOI] [PubMed] [Google Scholar]
- Hu F.; Ye Z.; Dong K.; Zhang W.; Fang D.; Cao J. Divergent structures and functions of the Cupin proteins in plants. Int. J. Biol. Macromol. 2023, 242, 124791 10.1016/j.ijbiomac.2023.124791. [DOI] [PubMed] [Google Scholar]
- Braun H.; Czihal A.; Shutov A.; Bäumlein H. A vicilin-like seed protein of cycads: similarity to sucrose-binding proteins. Plant Mol. Biol. 1996, 31, 35–44. 10.1007/BF00020604. [DOI] [PubMed] [Google Scholar]
- Dunwell J. M.; Gibbings J. G.; Mahmood T.; Saqlan Naqvi S. Germin and germin-like proteins: evolution, structure, and function. Crit. Rev. Plant Sci. 2008, 27 (5), 342–375. 10.1080/07352680802333938. [DOI] [Google Scholar]
- Ilyas M.; Ali I.; Nasser Binjawhar D.; Ullah S.; Eldin S. M.; Ali B.; Iqbal R.; Bokhari S. H. A.; Mahmood T. Molecular characterization of Germin-like Protein Genes in Zea mays (ZmGLPs) using various in silico approaches. ACS Omega 2023, 8 (18), 16327–16344. 10.1021/acsomega.3c01104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Anum J.; O’Shea C.; Skriver K.; Saeed M.; Hyder M. Z.; Farrakh S.; Yasmin T. The promoters of OsGLP genes exhibited differentially methylated sites under drought and salt stress in rice cultivars. Euphytica 2023, 219 (4), 42 10.1007/s10681-023-03173-6. [DOI] [Google Scholar]
- Yasmin T.; Mahmood T.; Hyder M. Z.; Akbar S.; Naqvi S. S. Cloning, sequencing and in silico analysis of germin-like protein gene 1 promoter from Oryza sativa L. ssp. indica. Pak. J. Bot. 2008, 40 (4), 1627–1634. [Google Scholar]
- Godfrey D.; Able A. J.; Dry I. B. Induction of a grapevine germin-like protein (VvGLP3) gene is closely linked to the site of Erysiphe necator infection: a possible role in defense?. Mol. Plant-Microbe Interact. 2007, 20 (9), 1112–1125. 10.1094/MPMI-20-9-1112. [DOI] [PubMed] [Google Scholar]
- Wang T.; Chen X.; Zhu F.; Li H.; Li L.; Yang Q.; Chi X.; Yu S.; Liang X. Characterization of peanut germin-like proteins, AhGLPs in plant development and defense. PLoS One 2013, 8 (4), e61722 10.1371/journal.pone.0061722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Banerjee J.; Maiti M. K. Functional role of rice germin-like protein1 in regulation of plant height and disease resistance. Biochem. Biophys. Res. Commun. 2010, 394 (1), 178–183. 10.1016/j.bbrc.2010.02.142. [DOI] [PubMed] [Google Scholar]
- Yang L.; Li T.; Zhang S.; Gao G.; Yang C. Characterization of the GLP13 gene promoter in Arabidopsis thaliana. Biol. Plant. 2013, 57 (2), 231–237. 10.1007/s10535-012-0273-1. [DOI] [Google Scholar]
- Das A.; Pramanik K.; Sharma R.; Gantait S.; Banerjee J. In-silico study of biotic and abiotic stress-related transcription factor binding sites in the promoter regions of rice germin-like protein genes. PLoS One 2019, 14 (2), e0211887 10.1371/journal.pone.0211887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mathieu M.; Lelu-Walter M.-A.; Blervacq A.-S.; David H.; Hawkins S.; Neutelings G. Germin-like genes are expressed during somatic embryogenesis and early development of conifers. Plant Mol. Biol. 2006, 61, 615–627. 10.1007/s11103-006-0036-5. [DOI] [PubMed] [Google Scholar]
- El-Sharkawy I.; Mila I.; Bouzayen M.; Jayasankar S. Regulation of two germin-like protein genes during plum fruit development. J. Exp. Bot. 2010, 61 (6), 1761–1770. 10.1093/jxb/erq043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guevara-Olvera L.; Ruíz-Nito M.; Rangel-Cano R.; Torres-Pacheco I.; Rivera-Bustamante R.; Muñoz-Sánchez C.; González-Chavira M.; Cruz-Hernandez A.; Guevara-González R. Expression of a germin-like protein gene (CchGLP) from a geminivirus-resistant pepper (Capsicum chinense Jacq.) enhances tolerance to geminivirus infection in transgenic tobacco. Physiol. Mol. Plant Pathol. 2012, 78, 45–50. 10.1016/j.pmpp.2012.01.005. [DOI] [Google Scholar]
- Lou Y.; Baldwin I. T. Silencing of a germin-like gene in Nicotiana attenuata improves performance of native herbivores. Plant Physiol. 2006, 140 (3), 1126–1136. 10.1104/pp.105.073700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Himmelbach A.; Liu L.; Zierold U.; Altschmied L.; Maucher H.; Beier F.; Müller D.; Hensel G.; Heise A.; Schützendübel A.; et al. Promoters of the barley germin-like GER4 gene cluster enable strong transgene expression in response to pathogen attack. Plant Cell 2010, 22 (3), 937–952. 10.1105/tpc.109.067934. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sassaki F. T.; Bravo J. P.; González E. R.; Maia I. G. Expression pattern and promoter analysis of a Eucalyptus grandis germin-like gene. Plant Mol. Biol. Rep. 2015, 33, 12–21. 10.1007/s11105-014-0734-0. [DOI] [Google Scholar]
- Sun B.; Li W.; Ma Y.; Yu T.; Huang W.; Ding J.; Yu H.; Jiang L.; Zhang J.; Lv S.; et al. OsGLP3–7 positively regulates rice immune response by activating hydrogen peroxide, jasmonic acid, and phytoalexin metabolic pathways. Mol. Plant Pathol. 2023, 24 (3), 248–261. 10.1111/mpp.13294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mathieu M.; Neutelings G.; Hawkins S.; Grenier E.; David H. Cloning of a pine germin-like protein (GLP) gene promoter and analysis of its activity in transgenic tobacco Bright Yellow 2 cells. Physiol. Plant. 2003, 117 (3), 425–434. 10.1034/j.1399-3054.2003.00050.x. [DOI] [PubMed] [Google Scholar]
- Mahmood T.; Tahir T.; Munir F.; Shinwari Z. K. Characterization of regulatory elements in OsRGLP2 gene promoter from different rice accessions through sequencing and in silico evaluation. Comput. Biol. Chem. 2018, 73, 206–212. 10.1016/j.compbiolchem.2018.02.015. [DOI] [PubMed] [Google Scholar]
- Mahmood T.; Yasmin T.; Haque M.; Naqvi S. Characterization of a rice germin-like protein gene promoter. GMR, Genet. Mol. Res. 2013, 12 (1), 360–369. 10.4238/2013.February.7.6. [DOI] [Google Scholar]
- Munir F.; Hayashi S.; Batley J.; Naqvi S. M. S.; Mahmood T. Germin-like protein 2 gene promoter from rice is responsive to fungal pathogens in transgenic potato plants. Funct. Integr. Genomics 2016, 16, 19–27. 10.1007/s10142-015-0463-y. [DOI] [PubMed] [Google Scholar]
- Shahwar D.; Deeba F.; Hussain I.; Naqvi S. S.; Alatawi F. S.; Omran A. M.; Moosa A.; Zulfiqar F. Characterization of the active site of a germin like protein 1 as an oxidative stress defense enzyme in plants. Plant Gene 2023, 36, 100432 10.1016/j.plgene.2023.100432. [DOI] [Google Scholar]
- Richards E.; Reichardt M.; Rogers S.. Preparation of Plant DNA Using CTAB. In Short Protocols in Molecular Biology; Wiley, 1997; Vol. 3, pp 2.10–12.11. [Google Scholar]
- Lescot M.; Déhais P.; Thijs G.; Marchal K.; Moreau Y.; Van de Peer Y.; Rouzé P.; Rombauts S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30 (1), 325–327. 10.1093/nar/30.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Berman H. M.; Westbrook J.; Feng Z.; Gilliland G.; Bhat T. N.; Weissig H.; Shindyalov I. N.; Bourne P. E. The protein data bank. Nucleic Acids Res. 2000, 28 (1), 235–242. 10.1093/nar/28.1.235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kawahara Y.; Oono Y.; Wakimoto H.; Ogata J.; Kanamori H.; Sasaki H.; Mori S.; Matsumoto T.; Itoh T. TENOR: database for comprehensive mRNA-Seq experiments in rice. Plant Cell Physiol. 2016, 57 (1), e7 10.1093/pcp/pcv179. [DOI] [PubMed] [Google Scholar]
- Vuong Q. T.; Nguyen H. D.; Dao T. N.; Phan M. V.; Do Thi P. In Silico Analysis of Osa-miR164 Gene Family in Rice (Oryza Sativa). VNU J. Sci.: Nat. Sci. Technol. 2021, 37 (3), 108–118. 10.25073/2588-1140/vnunst.5304. [DOI] [Google Scholar]
- Gangappa S. N.; Maurya J. P.; Yadav V.; Chattopadhyay S. The regulation of the Z-and G-box containing promoters by light signaling components, SPA1 and MYC2, in Arabidopsis. PLoS One 2013, 8 (4), e62194 10.1371/journal.pone.0062194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koul A.; Sharma D.; Kaul S.; Dhar M. K. Identification and in silico characterization of cis-acting elements of genes involved in carotenoid biosynthesis in tomato. 3 Biotech 2019, 9, 287 10.1007/s13205-019-1798-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mongkolsiriwatana C.; Pongtongkam P.; Peyachoknagul S. In silico promoter analysis of photoperiod-responsive genes identified by DNA microarray in rice (Oryza sativa L.). Agric. Nat. Resour. 2009, 43 (1), 164–177. [Google Scholar]
- Juven-Gershon T.; Hsu J.-Y.; Kadonaga J.. Perspectives on the RNA Polymerase II Core Promoter; Portland Press Ltd., 2006. [DOI] [PubMed] [Google Scholar]
- Borello U.; Ceccarelli E.; Giuliano G. Constitutive, light-responsive and circadian clock-responsive factors compete for the different I box elements in plant light-regulated promoters. Plant J. 1993, 4 (4), 611–619. 10.1046/j.1365-313X.1993.04040611.x. [DOI] [PubMed] [Google Scholar]
- Weirauch M. T.; Yang A.; Albu M.; Cote A. G.; Montenegro-Montero A.; Drewe P.; Najafabadi H. S.; Lambert S. A.; Mann I.; Cook K.; et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell 2014, 158 (6), 1431–1443. 10.1016/j.cell.2014.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang C.; Feng L.; Tian X. s. Alterations in the 5′ untranslated region of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica. Pest Manage. Sci. 2018, 74 (11), 2561–2568. 10.1002/ps.5042. [DOI] [PubMed] [Google Scholar]
- Castelli S.; Mascheretti I.; Cosentino C.; Lazzari B.; Pirona R.; Ceriotti A.; Viotti A.; Lauria M. Uniparental and transgressive expression of α-zeins in maize endosperm of o2 hybrid lines. PLoS One 2018, 13 (11), e0206993 10.1371/journal.pone.0206993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rushton P. J.; Torres J. T.; Parniske M.; Wernert P.; Hahlbrock K.; Somssich I. Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J. 1996, 15 (20), 5690–5700. 10.1002/j.1460-2075.1996.tb00953.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu X.; Bush D. Expression and transcriptional regulation of amino acid transporters in plants. Amino Acids 2006, 30, 113–120. 10.1007/s00726-005-0248-z. [DOI] [PubMed] [Google Scholar]
- Hobo T.; Asada M.; Kowyama Y.; Hattori T. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent. Plant J. 1999, 19 (6), 679–689. 10.1046/j.1365-313x.1999.00565.x. [DOI] [PubMed] [Google Scholar]
- Zhao Z.-q.; Xue M.-d.; Huang K.; Zhang J.-w.; Long Y.; Pei X.-w.; Yuan Q.-h. Cloning and Functional Analysis of Green Tissue-specific Expression Promoter of Common Wild Rice (Oryza rufipogon Griff.). Biotechnol. Bull. 2017, 33 (8), 51. [Google Scholar]
- Zhang L.; Song Z.; Li F.; Li X.; Ji H.; Yang S. RETRACTED ARTICLE: The specific MYB binding sites bound by Ta MYB in the GAPCp2/3 promoters are involved in the drought stress response in wheat. BMC Plant Biol. 2019, 19, 366 10.1186/s12870-019-1948-y. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Chen S.; Qiu G. Cloning and activity analysis of the promoter of nucleotide exchange factor gene ZjFes1 from the seagrasses Zostera japonica. Sci. Rep. 2020, 10 (1), 17291 10.1038/s41598-020-74381-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stockinger E. J.; Gilmour S. J.; Thomashow M. F. Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. U.S.A. 1997, 94 (3), 1035–1040. 10.1073/pnas.94.3.1035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ain-Ali Q.-U.; Mushtaq N.; Amir R.; Gul A.; Tahir M.; Munir F. Genome-wide promoter analysis, homology modeling and protein interaction network of Dehydration Responsive Element Binding (DREB) gene family in Solanum tuberosum. PLoS One 2021, 16 (12), e0261215 10.1371/journal.pone.0261215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Teshome S.; Kebede M. Analysis of regulatory elements in GA2ox, GA3ox and GA20ox gene families in Arabidopsis thaliana: An important trait. Biotechnol. Biotechnol. Equip. 2021, 35 (1), 1603–1612. 10.1080/13102818.2021.1995494. [DOI] [Google Scholar]
- Zhang H.-B.; Bokowiec M. T.; Rushton P. J.; Han S.-C.; Timko M. P. Tobacco transcription factors NtMYC2a and NtMYC2b form nuclear complexes with the NtJAZ1 repressor and regulate multiple jasmonate-inducible steps in nicotine biosynthesis. Mol. Plant 2012, 5 (1), 73–84. 10.1093/mp/ssr056. [DOI] [PubMed] [Google Scholar]
- Reyes J. C.; Muro-Pastor M. I.; Florencio F. J. The GATA family of transcription factors in Arabidopsis and rice. Plant Physiol. 2004, 134 (4), 1718–1732. 10.1104/pp.103.037788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakata Y.; Nakamura I.; Taji T.; Tanaka S.; Quatrano R. S. Regulation of the ABA-responsive Em promoter by ABI3 in the moss Physcomitrella patens: role of the ABA response element and the RY element. Plant Signaling Behav. 2010, 5 (9), 1061–1066. 10.4161/psb.5.9.11774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shariatipour N.; Heidari B. Investigation of Drought and Salinity Tolerance Related Genes and their Regulatory Mechanisms in Arabidopsis (). Open Bioinf. J. 2018, 11 (1), 12–28. 10.2174/1875036201811010012. [DOI] [Google Scholar]
- Guerrero-Rubio M. A.; Hernández-García S.; Escribano J.; Jiménez-Atiénzar M.; Cabanes J.; García-Carmona F.; Gandía-Herrero F. Betalain health-promoting effects after ingestion in Caenorhabditis elegans are mediated by DAF-16/FOXO and SKN-1/Nrf2 transcription factors. Food Chem. 2020, 330, 127228 10.1016/j.foodchem.2020.127228. [DOI] [PubMed] [Google Scholar]
- Wang L.; Li L.; Xu L.; Zhou J.; Zhuang H.; Gong X.; Wang M.; Sun S. S.; Zhuge Q. Isolation and functional analysis of the poplar RbcS gene promoter. Plant Mol. Biol. Rep. 2013, 31, 120–127. 10.1007/s11105-012-0482-y. [DOI] [Google Scholar]
- Mena M.; Vicente-Carbajosa J.; Schmidt R. J.; Carbonero P. An endosperm-specific DOF protein from barley, highly conserved in wheat, binds to and activates transcription from the prolamin-box of a native B-hordein promoter in barley endosperm. Plant J. 1998, 16 (1), 53–62. 10.1046/j.1365-313x.1998.00275.x. [DOI] [PubMed] [Google Scholar]
- Angarica V. E.; Pérez A. G.; Vasconcelos A. T.; Collado-Vides J.; Contreras-Moreira B. Prediction of TF target sites based on atomistic models of protein-DNA complexes. BMC Bioinf. 2008, 9 (1), 436 10.1186/1471-2105-9-436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ali I.; Mahmood T. Identification and analysis of regulatory elements in the germin and germin-like proteins family promoters in rice. Turk. J. Bot. 2015, 39 (3), 389–400. 10.3906/bot-1405-48. [DOI] [Google Scholar]
- Yasmin T.Cloning and Over-expression of a Germin-like Protein Gene for Its Functional Analysis. Ph.D. Thesis, University Rawalpindi, 2009. [Google Scholar]
- Lane B.; Dunwell J. M.; Ray J.; Schmitt M.; Cuming A. Germin, a protein marker of early plant development, is an oxalate oxidase. J. Biol. Chem. 1993, 268 (17), 12239–12242. 10.1016/S0021-9258(18)31377-2. [DOI] [PubMed] [Google Scholar]
- Blackwood E. M.; Kadonaga J. T. Going the distance: a current view of enhancer action. Science 1998, 281 (5373), 60–63. 10.1126/science.281.5373.60. [DOI] [PubMed] [Google Scholar]
- Nakata M.; Shiono T.; Watanabe Y.; Satoh T. Salt stress-induced dissociation from cells of a germin-like protein with Mn-SOD activity and an increase in its mRNA in a moss, Barbula unguiculata. Plant Cell Physiol. 2002, 43 (12), 1568–1574. 10.1093/pcp/pcf178. [DOI] [PubMed] [Google Scholar]
- Park C.-J.; An J.-M.; Shin Y.-C.; Kim K.-J.; Lee B.-J.; Paek K.-H. Molecular characterization of pepper germin-like protein as the novel PR-16 family of pathogenesis-related proteins isolated during the resistance response to viral and bacterial infection. Planta 2004, 219, 797–806. 10.1007/s00425-004-1290-x. [DOI] [PubMed] [Google Scholar]
- Allen B. L.; Taatjes D. J. The Mediator complex: a central integrator of transcription. Nat. Rev. Mol. Cell Biol. 2015, 16 (3), 155–166. 10.1038/nrm3951. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu M.; Han Y.-P.; Gao J.-G.; Wang X.-J.; Li W.-B. Identification and analysis of the germin-like gene family in soybean. BMC Genomics 2010, 11, 620 10.1186/1471-2164-11-620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bernier F.; Berna A. Germins and germin-like proteins: plant do-all proteins. But what do they do exactly?. Plant Physiol. Biochem. 2001, 39 (7–8), 545–554. 10.1016/S0981-9428(01)01285-2. [DOI] [Google Scholar]
- Yu F.; Huaxia Y.; Lu W.; Wu C.; Cao X.; Guo X. GhWRKY15, a member of the WRKY transcription factor family identified from cotton (Gossypium hirsutumL.), is involved in disease resistance and plant development. BMC Plant Biol. 2012, 12 (1), 144 10.1186/1471-2229-12-144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hajheidari M.; Huang S.-s. C. Elucidating the biology of transcription factor–DNA interaction for accurate identification of cis-regulatory elements. Curr. Opin. Plant Biol. 2022, 68, 102232 10.1016/j.pbi.2022.102232. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The authors confirm that the data supporting the findings of this study are available within the article [and/or] its Supporting Information.







