SR9009 attenuates inflammation-related NPMSC pyroptosis and IVDD through NR1D1/NLRP3/IL-1β pathway

Summary

Intervertebral disc is a highly rhythmical tissue. As a key factor linking biorhythm and inflammatory response, the shielding effect of NR1D1 in the process of intervertebral disc degeneration remains unclear. Here, we first confirmed that NR1D1 in the nucleus pulposus tissue presents periodic rhythmic changes and decreases in expression with intervertebral disc degeneration. Second, when NR1D1 was activated by SR9009 in vitro, NLRP3 inflammasome assembly and IL-1β production were inhibited, while ECM synthesis was increased. Finally, the vivo experiments further confirmed that the activation of NR1D1 can delay the process of disc degeneration to a certain extent. Mechanistically, we demonstrate that NR1D1 can bind to IL-1β and NLRP3 promoters, and that the NR1D1/NLRP3/IL-1β pathway is involved in this process. Our results demonstrate that the activation of NR1D1 can effectively reduce IL-1β secretion, alleviate LPS-induced NPMSC pyroptosis, and protect ECM degeneration.

Graphical abstract

Highlights

• •NR1D1 decreases with the aggravation of intervertebral disc degeneration
• •The inhibitory effect of NR1D1 on inflammation is effective in intervertebral disc
• •NR1D1 activation can inhibit the assembly of NLRP3 inflammasome and the secretion of IL-1β

Orthopedics; Molecular biology; Cell biology

Introduction

Low back pain is primary factors by IVDD, which poses a huge burden on individual patients and society.^1,2 However, there is still a lack of effective therapy to repair the damaged structure of intervertebral disc (IVD).^3,4 In recent years, the treatment of intervertebral disc degeneration has entered the stage of regeneration and functional reconstruction with the development of tissue engineering.^5,6 As mesenchymal stem cells have the ability of proliferation, differentiation and self-renewal, stem cell therapy has become a hot spot in the study of IVDD. Chen and other studies have found that nucleus pulposus-derived cell is better adapted to the hyperosmotic and hypoxia microenvironment than exogenous stem cells.^7,8 IVDD is a multifactorial disease characterized by a dynamic imbalance between catabolism and anabolism, such as nucleus pulposus mesenchymal stem cells (NPMSC) cell survival or extracellular matrix (ECM) degradation. The intervertebral disc consists of the inner gelatinous nucleus pulposus and the outer fibrous cartilage ring. Inflammation is the main and remarkable factor of IVDD. Recent researches have shown that inflammatory cytokines, such as interleukin-1 β and tumor necrosis factor-α, are closely related to extracellular matrix degradation or NPMSC cell survival.⁹ In addition, Injury, abnormal load, infection and other initial factors can lead to the increase of IL-1 β in the intervertebral disc, which can promote the intervertebral disc cells to produce chemokines and induce leukocyte migrate to the intervertebral disc to secrete more inflammatory factors, thus aggravating the inflammatory reaction and degeneration of the intervertebral disc.¹¹ Therefore, a better acknowledge of the mechanism of inflammatory cytokine synthesis and secretion may provide an effective therapeutic target for IVDD.

Intervertebral disc is a kind of highly rhythmic tissue that experiences circadian cycles from high load to low load.¹⁰ The physiology and behavior of mammals are affected by the biological clock. In recent years, researchers have identified the important relationship between the biological clock and inflammatory response.^11,12 Aging or day-night reversal can disrupt the biological rhythm of tissues and organs, causing the aggravation of inflammatory response and the accumulation of local inflammatory factors, which can also increase the risk of many inflammation-related diseases.^12,13 The maintenance and regulation of the biological clock depends on a variety of transcriptional and inhibitory molecules, including nuclear receptor subfamily 1D group 1 (NR1D1).¹⁸ our research confirmed that the circadian rhythm of the intervertebral disc is destroyed with degeneration and aging. Also, our results have shown that NR1D1 is a key factor in the connection between biorhythm and inflammation, and it can play an anti-inflammatory role through nucleotide-binding oligomerization domain-like receptors (NLRP3) inflammatory bodies.^14,15

SR9009 is a small molecule agonist targeting of NR1D1, which is related to the extensive range of physiological functions, including circadian rhythm regulation and anti-inflammatory. Recent studies have shown that NR1D1 represses the synthesis of NLRP3 inflammatory bodies directly and activation of NR1D1 protects C57 mice against dextran sulfate sodium-induced colitis.¹⁵ Although these findings indicate that NR1D1 is the negative regulators of inflammation, whether it can play an anti-inflammatory role in the process of IVDD and its mechanism is not clear. In our study, we sought to explore the effect of SR9009 on NPMSC under LPS-induced inflammation condition and its potential mechanism in vivo and in vitro, which provided compelling evidence of NR1D1 as a potential therapeutic target for IVDD.

Results

Identification of differentially expressed genes and enrichment pathway analyses

The study included 4 healthy nucleus pulposus mesenchymal stem cell samples and 4 degenerative nucleus pulposus mesenchymal stem cell samples from SD rats (Figures 1A, 1B, and S1). A total of 936 DEGs were identified after analyzing with LIMMA software package in R language. Among them, compared with healthy NPMSC samples, 713 were up-regulated and 218 down-regulated in the degenerative NPMSC group, especially the down-regulation of NR1D1 (Figures 1E and 1F).

Figure 1.

Selection of DEGs and function annotation

(A) and (B) heatmap of DEGs (218 upregulated and 713 downregulated genes); (C) KEGG pathway analysis of upregulated DEGs; (D) Reactome pathway analysis of upregulated DEGs.

(E) and (F) heatmap and q-PCR result of DEGs of selected mRNA.

In order to have a better understanding of DEGS, we carried out KEGG and Reactome pathway enrichment analysis. The up-regulated DEGS is mainly concentrated in the pathways related to IVDD (Figures 1C and 1D), such as ECM-receptor interaction, TGF-beta signal pathway and Cytokine-cytokine receptor interaction. However, the down-regulated DEGS had no significant enrichment in any way.

Biological rhythm disruption and nucleotide-binding oligomerization domain-like receptors 3 inflammasome components are elevated in human intervertebral disc degeneration tissue specimens

The degree of IVDD was evaluated by magnetic resonance imaging (MRI) (Pfirrmann grading system). We choosed 3 patients with 2° or less of degeneration as the Mild degenerative group and 3 patients with grade four or more as the Severe degenerative group. The MRI and sample images of these two groups are shown in Figure 2A. Immunohistochemical staining showed that the protein levels of type II collagen and Aggrecan in Severe degenerative intervertebral disc tissues were significantly lower than those in Mild degenerative tissues (Figure 2C). In order to study the role of NR1D1 in the process of IVDD, we detected the mRNA expression and protein levels of NR1D1 and inflammatory body components such as NLRP3, Caspase-1 and IL-1β in mild and severe degenerative intervertebral disc tissues (Figures 2B–2D and 2F). As shown in Figure 2D, the mRNA expression of NR1D1 in severe degenerative intervertebral disc tissue is significantly lower than that in mild degenerative tissue. Immunohistochemical staining showed that the protein level of NR1D1 in severe degenerative intervertebral disc tissue was significantly lower than that in the mild group (Figure 2E). Reverse transcription-polymerase chain reaction showed that the expression of NLRP3, Caspase 1 and IL-1β in severe degenerative intervertebral disc tissues was significantly higher than that in the mild group (Figure 2F). Immunohistochemical staining showed that the protein levels of NLRP3, Caspase-1 and IL-1β in severe degenerative intervertebral disc tissues were significantly higher than those in the mild group (Figure 2G). Therefore, there is a negative correlation between NR1D1 and IVDD and a positive correlation between NLRP3 inflammatory bodies and IVDD.

Figure 2.

Biological rhythm disruption and NLRP3 inflammasome components are elevated in human IVDD tissue specimens

(A) MRI images of Mild and Severe degenerated intervertebral discs.

(B) The mRNA expressions of COL-2, Aggrecan.

(C) Histochemical stain of a disc specimen; collagen Ⅱ and aggrecan contents were significantly lower in the Severe IVDD specimen than in the Mild IVDD specimen. Scale bar = 50 μm.

(D) The mRNA expressions of NR1D1 in Mild and Severe IVDD specimens were detected by RT-PCR.

(E) Histochemical stain of disc specimens; the NR1D1 contents were significantly lower in the severe IVDD specimen than in the mild IVDD specimen. Scale bar = 100 μm.

(F) The mRNA expression of NLRP3, CASP1 and IL-1β in Mild and Severe IVDD specimens were detected by RT-PCR.

(G) Histochemical stain of disc specimens; the NLRP3, caspase-1 and IL-1β contents were significantly higher in the severe group than in the mild group. Scale bar = 50 μm.

(H) Quantitative analysis of the mean density of collagen Ⅱ, aggrecan.NR1D1, NLRP3, CASP1 and IL-1β in two groups. Data are represented as mean ± SD (n = 3). Significant differences between groups are indicated as ∗p < 0.01, compared with the normal group.

Nuclear receptor subfamily 1D group 1 inhibit nucleotide-binding oligomerization domain-like receptors 3 inflammasome activation and IL-1β secretion and synthesis in vitro

NLRP3, ASC and caspase1 are important components of NLRP3 inflammatory bodies, which are essential for assembly and activation. In order to study the effect of NR1D1 on the activation of NLRP3 inflammatory bodies and the secretion of IL-1β, we first constructed NR1D1-siRNAs. RT-PCR and Wb assay results showed that after NR1D1 was successfully interfered, the mRNA and protein expression levels of NLRP3, ASC, caspase1 and IL-1β activated by LPS, were significantly increased compared with the blank control group (Figures 3A–3C; Tables 1 and S2). In addition, Tunnel staining results showed that when NR1D1 was interfered successfully, the level of pyroptosis in the NR1D1-Si-RNA group was significantly higher than that in the blank control group (Figure 3D).

Figure 3.

The effect of NR1D1 on the activation of NLRP3 inflammatory bodies and the secretion of IL-1β

(A) The mRNA expression of NR1D1, NLRP3, ASC, CASP1 and IL-1β in the different groups.

(B and C) The protein expressions and quantitative analysis of NR1D1, NLRP3, ASC, CASP1 and IL-1β in the different groups.

(D) TUNEL assay and Quantitative analysis results of NPMSCs. (White scale bar = 50 μm).

(E) The ChIP-seq and ChIP-qPCR of NR1D1 and NLRP3; NR1D1 and IL-1β. All data are expressed as the mean ± SD. ^∗∗: p < 0.01 compared with the control group; ^#: p < 0.01 compared with the LPS+ATP-NC-siRNA group.

Table 1.

Primers used for reverse transcription quantitative polymerase chain reaction analysis of gene expression

Gene	Primer sequence
GAPDH	Forward TCAACGACCACTTTGTCAAGCTCAGCT
	Reverse GGTGGTCCAGGGGTCTTAC
Aggrecan	Forward CTACCAGTGGATCGGCCTGAA
	Reverse CGTGCCAGATCATCACCACA
Collagen II	Forward GGTAAGTGGGGCAAGACTGTTA
	Reverse TGTTGTTTCTGGGTTCAGGTTT
MMP-13	Forward CCAGACTTCACGATGGCATTG
	Reverse GGCATCTCCTCCATAATTTGGC
NR1D1	Forward CTTCCCACCATCACCTACTGG
	Reverse ACTCGGCTGCTGTCTTCCAT
NLRP3	Forward TCTGTTCATTGGCTGCGGAT
	Reverse TAGCCGCAAAGAACTCCTGG
Caspase 1	Forward CCGGGCAAGCCAGATGTTTA
	Reverse GCGCCACCTTCTTTGTTCAG
ASC	Forward GGACAGTACCAGGCAGTTCG
	Reverse GTCACCAAGTAGGGCTGTGT
IL-1β	Forward GGGATGATGACGACCTGCTA
	Reverse ACAGCACGAGGCATTTTTGT
Psmb6	Forward GCAGGTGTACTCTGTTCCCA
	Reverse TGCCTTCCCGATAGGTAGCA
Ceacam4	Forward GTACAAGGGAACCACTCCGA
	Reverse GTGTAGGCTCCCTCGTCCTT
Pfkfb2	Forward GCTATAAACCCCACGCCTCA
	Reverse GAGTGTTGGGGAGTTGGTCA

In order to further verify the regulatory effect of NR1D1 on NLRP3 and IL-1 β, we first found that there are four NR1D1 response element binding sites from 0.2 kb to 4.4kb upstream of the transcriptional initiation site of NLRP3 promoter sequence through MatInspector promoter analysis software (Figure 3E). Dashed arrow: transcriptional start site; solid arrow: predicted binding site). Then Chip assay was used to detect the binding of NR1D1 to NLRP3 promoter after LPS stimulation. The results showed that NR1D1 could bind to these four sites. In the same way, we also detected that NR1D1 can bind to two sites of IL-1β (Figure 3E). These findings indicate that NR1D1 can inhibit NLRP3 inflammasome activation and IL-1β secretion and synthesis in vitro.

The circadian rhythm of the intervertebral disc is destroyed with degeneration and aging

Previous RNA sequencing results showed that the differential expression of the NR1D1 gene in intervertebral disc changes with time. In order to verify the circadian rhythm of NR1D1 expression, 36 2-month-old C57BL/6 mice were killed every 4 h, and the nucleus pulposus of the intervertebral disc was taken. RT-PCR assay was used to quantitatively detect the relative expression of NR1D1 mRNA at each time point. The results of transmission electron microscopy showed that the NPMSCs with pyroptosis were enlarged with many vacuoles and the cell membrane ruptures and the organelles disappear (Figure 4A). In addition, the m-RNA of NR1D1 changed periodically with time (Figure 4B). Then the nucleus pulposus of the mice was obtained at 4 o’clock and 16:00 respectively, the Western-blot results showed that there was a diurnal difference in the level of NR1D1 in the intervertebral disc (Figures 4C–4F and S3).

Figure 4.

the circadian rhythm of NPMSC is destroyed with degeneration and aging

(A) Transmission electron microscopy images of normal and pyroptosis nucleus pulposus mesenchymal stem cells.

(B) The RT-PCR results showed that the m-RNA of NR1D1 changed periodically with time.

(C) and (F) The protein expressions and quantitative analysis of NR1D1 at 4:00 and 16:00.

(D) and (G) The protein expressions and quantitative analysis of NR1D1in health group and IVDD group.

(E–H) The protein expressions and quantitative analysis of NR1D1 in 2-month group and 14-month group. All data are the mean ± SD. ∗∗: p < 0.01 compared with the control group.

In order to further verify the changes of NR1D1 in the process of IVDD, we obtained degenerative and non-degenerative nucleus pulposus from surgery and tissue bank. Western blot was used to detect the expression level of NR1D1 protein in the two groups. The results showed that the expression of NR1D1 protein in the degenerative intervertebral disc decreased significantly than that in the non-degenerative group (Figures 4D–4G and S3). In addition,2-month-old and 14-month-old SD rats were killed to obtain nucleus pulposus tissue, and the expression level of NR1D1 protein was detected by the same method. The results showed that the expression of NR1D1 protein in the intervertebral disc of 14-month-old rats decreased significantly than that in the younger group (Figures 4E–4H and S3). These findings indicate that the circadian rhythm of the intervertebral disc is destroyed with degeneration and aging.

SR9009 alleviated lipopolysaccharide/Adenosine Triphosphate-induced decreased nucleus pulposus mesenchymal stem cell viability and secretive IL-1β level

As depicted in Figure 5A, SR9009 (0, 5, 10, 20, 40 μM) enhanced NPMSC viability at a certain concentration after 12h pre-incubation. Lipopolysaccharide/Adenosine Triphosphate decreased NPMSC viability in a dose-dependent manner. Lipopolysaccharide at 1 μg/ml led an appropriate inhibition of cell viability and thus this concentration was chosen to induce inflammatory injury in the subsequent experiment (Figure 5B, p < 0.05). However, different concentrations of SR9009 obviously improved cell viability induced by Lipopolysaccharide/Adenosine Triphosphate, and SR9009 showed maximum protective effect at the concentration of 10 μM. (Figure 5C, p < 0.05). In addition, the Elisa assay results showed that SR9009 decreased the secretive IL-1β levels in a dose and time-dependent manner. the secretive IL-1β levels in the SR9009 (10 mM) group was the lowest than that of the CON group and other intervention groups (Figure 5D, p < 0.05). And 10 mM SR9009 showed maximum protective effect at the time of 12 h (Figure 5E, p < 0.05). Thus, this concentration and time were used for the following experiments.

Figure 5.

SR9009 alleviated LPS-induced decreased NPMSC viability and secretive IL-1β level and enhanced cell proliferation

(A) The viability of NPMSC treated with different concentrations of SR9009 was detected by CCK-8.

(B) The viability of NPMSC treated with different concentrations of LPS+ATP was detected by CCK-8.

(C) The effect of SR9009 on the NPMSC viability induced by LPS+ATP.

(D) Elisa results of NPMSC treated with different concentrations of SR9009 and 1 μg/ml LPS+5mM ATP.

(E) Elisa results of NPMSC treated with different times of 10 μM SR9009 and 1ug/ml LPS+5mM ATP.

(F) EdU assay results of NPMSCs in the different groups. Green fluorescence represents cells in a proliferating state, and blue fluorescence represents cell nucleus (White scale bar = 100 μm; red scale bar = 25 μm).

(G) Quantitative analysis of EdU-staining positive cells. All data are the mean ± SD. ^∗: p < 0.05 and ^∗∗: p < 0.01 compared with the control group; ^#: p < 0.05.

SR9009 enhanced cell proliferation

The effect of SR9009 on the proliferation of NPMSCs was evaluated using an EdU staining kit. As shown in Figures 5F and 5G, the number of EdU-labeled NPMSCs treated with LPS+ATP was significantly lower than that of the control group (p < 0.05), and SR9009 partially decreased the number of EdU-labeled NPMSCs (p < 0.05). However, SR9009 significantly weakened the decreased proliferation effect of LPS+ATP (p < 0.05).

SR9009 regulates the pyroptosis level of nucleus pulposus mesenchymal stem cells stimulated by lipopolysaccharide

The protective effect of SR9009 against LPS/ATP-induced pyroptosis was evaluated using FLICA660 Caspase-1 Assay. Flow cytometry showed that that more cells appeared in the Q2 and Q3 quadrants in the LPS+ATP group, which indicates that the pyroptosis rate of NPMSCs in the LPS+ATP group was significantly higher than that in the control group. (p < 0.05, Figures 6A and 6B). The pyroptosis rate of NPMSCs was significantly increased after pretreatment with LPS+ATP (p < 0.05), but the presence of SR9009 significantly weakened the pyroptosis -promoting effect of LPS+ATP (p < 0.05). when the pyroptosis was inhibited by YVAD, the therapeutic effect of SR9009 was not significantly different from that of YVAD (p > 0.05).

Figure 6.

SR9009 regulates the pyroptosis level of NPMSC stimulated by LPS

(A) Pyroptosis level of NPMSCs detected by flow cytometry.

(B) Quantitative analysis of the pyroptosis rate of NPMSCs.

(C) TUNEL assay results of NPMSCs (White scale bar = 50 μm; red scale bar = 25 μm).

(D) Quantitative analysis of TUNEL staining positive cells.

(E) and (F) Immunofluorescence staining of NLRP3, ASC, CASP1 and NR1D1, IL-1β, GSDMD (Scale bar = 50 μm).

(G) Quantitative analysis of the fluorescence expressions of NLRP3, ASC, CASP1 and NR1D1, IL-1β, GSDMD.

(H), (I), and (J) The protein expression and quantitative analysis of NLRP3, ASC, CASP1 and NR1D1, IL-1β, GSDMD in the different groups. All data are the mean ± SD. ^∗∗: p < 0.01 compared with the control group; ^#: p < 0.01 and ^##: p < 0.01 compared with the LPS+ATP group; SLA: SR9009+LPS+ATP group.

The TUNEL assay was also used to assess cell pyroptosis. The DNA in the cell nucleus was broken, and the exposed 3′-OH linked to fluorescein-d-UTP under the catalysis of terminal deoxynucleotidyl transferase, which causes the pyroptosis cells labeled by red fluorescence. As shown in Figures 6C and 6D, the number of TUNEL-positive cells increased significantly after Lipopolysaccharide/Adenosine Triphosphate treatment, which is consistent with the flow cytometry results. Preincubation with SR9009 significantly attenuated the rate of apoptosis induced by Lipopolysaccharide/Adenosine Triphosphate (p < 0.05).

Immunofluorescence and Western blotting were adopted to assess the intracellular fluorescence and proteins of the NR1D1; NLRP3 inflammasome associated protein:NLRP3, Caspase-1 and ASC; pyroptosis-related protein GSDMD and IL-1β. (Figures 6E–6G). The results showed that in the LPS+ATP group, the fluorescence intensity and proteins levels of NLRP3, Caspase-1, ASC and IL-1β were significantly upregulated, but the fluorescence intensity, and the fluorescence intensity and proteins levels of NR1D1 were downregulated compared with levels in the control group (p < 0.05, Figures 6H–6J and S4). However, the fluorescence intensity and proteins levels of NLRP3, Caspase-1, ASC and IL-1β were downregulated and that of NR1D1 was upregulated in NPMSCs of the SLA group compared with those in the LPS+ATP group (p < 0.05, Figures 6H–6J and S4). In addition, the fluorescence intensity and protein levels of GSDMD in YVAD, SLA and LPS+ATP groups were significant increased compared with those in the control group (p < 0.05, Figures 6H–6J and S4).

SR9009 regulated the expressions of extracellular matrix-related genes and proteins

The expression changes of MMP-13 and Collagen II was evaluated through immunofluorescence assay. As shown in Figures 7A and 7B, the fluorescence intensity of Collagen II in the LPS+ATP group was decreased compared with that of the control group, but that of MMP-13 was increased. SR9009 pretreatment showed a protective effect on NPMSC, as the fluorescence intensity of Collagen II was enhanced and MMP-13 was weakened (p < 0.05, Figure 7C). Based on the immunofluorescence results, we further verified the mRNA expressions of the ECM of NPMSC. Lipopolysaccharide combined with Adenosine Triphosphate treatment significantly inhibited mRNA expressions of Collagen II and Aggrecan and promoted the expression of MMP-13 (p < 0.05, Figure 7D). SR9009 pretreatment showed a protective effect on NPMSC, as the mRNA expressions of collagen II and aggrecan were enhanced and MMP-13 was weakened. These results indicated that SR9009 could modulate the ECM metabolism in NPMSC.

Figure 7.

SR9009 regulated the expressions of ECM-related genes and proteins

(A), (B) and (C) Representative immunofluorescence photomicrograph and quantitative analysis of fluorescence results of collagen II and MMP-13 (100 ×, bar = 200 μm).

(D) The mRNA expressions of aggrecan, collagen II and MMP-13. All data are the mean ± SD. ∗: p < 0.05 compared with the control group.

SR9009 delays the process of intervertebral disc degeneration by inhibiting the activation of nucleotide-binding oligomerization domain-like receptors 3 inflammasome and the secretion of IL-1β in vivo

Radiographic and magnetic resonance imaging evaluation

Intervertebral height (DHI) was evaluated by X-ray. There was no significant difference in DHI among the three groups before puncture. However, at 6 weeks after operation, the DHI in the IVDD group (0.049 ± 0.003) was significantly lower than that in the control group (0.0987 ± 0.021) (p < 0.01, Figures 8A and 8C). In addition, DHI in the SR9009 group (0.072 ± 0.007) was higher than that in the IVDD group (p < 0.01, Figures 8A and 8C). Furthermore, the degree of intervertebral disc degeneration was evaluated by Pfirmann grade by MRI. The results showed that there was no significant difference among the three groups before puncture. Six weeks after the operation, the Pfirmann score in the IVDD group was significantly higher than that in the control group (p < 0.05, Figures 8B and 8D), while that in the SR9009 group was lower than that in the IVDD group (p < 0.05, Figures 8B and 8D). These results suggest that SR9009 intervention can delay the progress of IVDD in vivo.

Figure 8.

X-ray and magnetic resonance imaging (MRI) evaluation in intervertebral disc degeneration (IVDD) model at 0-week and 6-week after puncturing

(A) and (C) The X-ray scans and quantitative analysis of disc height index (DHI) in the different groups (control group, IVDD group, and SR9009 group).

(B) and (D) The MRI images and quantitative analysis of Pfirrmann grades in the different groups.

(E–G) The Hematoxylin-eosin (HE), Alcian blue (A-B), and safranin-O/fast green (S-O) staining at 6 weeks after a puncture in the control group, intervertebral disc degeneration (IVDD) group, and SR9009 group; (H) Quantitative analysis of histological score in the different groups.

(I–M) Protein levels of extracellular matrix components collagen Ⅱ and aggrecan, NR1D1, NLRP3 and IL-1b in rat NPMSCs of different groups (Scale bar = 500 μm and 50 μm). All data are expressed as the mean ± SD. ^∗: p < 0.01 compared with the IVDD group. ^∗∗: p < 0.01and ^#: p < 0.05 compared with the IVDD group.

Histologic analysis and immunohistochemistry staining

In the control group, HE, Alcian Blue and Safranin O-Fast Green (S-O) staining showed well-structured gel-like NP inside and concentric annular fibrous annulus outside. In the IVDD group, most of the NP tissue disappeared, the well-structured IVD tissue was damaged, and the histological score was significantly lower than that in the control group (p < 0.01, Figures 8E–8H). Interestingly, there was still a small amount of NP tissue in the SR9009 group, and the histological score in the IVDD group was higher than that in the IVDD group (p < 0.01, Figures 8E–8H.

Immunohistochemistry staining showed that in the SD rat samples, the expression of NR1D1 in the IVDD group was significantly lower than that in the SR9009 group, while the expression of NLRP3 inflammasome -related proteins, NLRP3, Caspase1 and IL-1β, were significantly increased (Figures 8K–8M). In addition, the expression of ECM-related protein collagen-II and Aggrecan of NP tissue in the SR9009 group was significantly higher than those in the IVDD group (Figures 8I and 8J). These results suggest that SR9009 can effectively inhibit the activation of NLRP3 inflammatory bodies and reduce the secretion and synthesis of IL-1β in the process of intervertebral disc degeneration by activating NR1D1 in vivo, thus inhibiting the inflammatory response and attenuating the progression of IVDD.

Discussion

Low back pain (LBP) is very common in the general population, and it is the world-wide primary cause of physical disability and dysfunction.¹ Intervertebral Disc degeneration (IVDD) is not only one of the most common causes of low back pain, but also the initiating factor of spinal degenerative disease.^2,3 Existing studies have confirmed that inflammatory response and inflammatory factors play an important role in IVDD-related low back pain,⁴ especially IL-1β. Injury, abnormal load, infection and other initial factors can lead to the increase of IL-1β in the intervertebral disc and promote the intervertebral disc cells to produce chemokines that can induce leukocytes to migrate into the intervertebral disc, and then secrete more inflammatory factors, aggravating the inflammatory reaction of the intervertebral disc.¹⁶ Our results also confirmed that the amount of IL-1β in the severe IVDD increased significantly comparing with the mild group. The accumulated IL-1β of the intervertebral disc can inhibit matrix synthesis and metabolism, reducing the content of aggrecan and type II collagen, and promote the expression of catabolism-related genes such as matrix metalloproteinases. In addition, our study also found that IL-1β can induce excessive pyroptosis of NPMSCs, further reducing the ability of intervertebral disc matrix synthesis and accelerating the progress of IVDD. Johnson et al. also found that the concentrated IL-1β of the intervertebral disc can stimulate the dorsal root ganglion of the spinal nerve through acid-sensing ion channel 3 and transient receptor potential channels, which can directly induce low back pain.¹¹ Therefore, if we can find a way to inhibit the production of IL-1β in the intervertebral disc, we can effectively alleviate the process of intervertebral disc degeneration and relieve the low back pain.

Nucleotide-binding oligomeric domain protein-like receptor family 3 (NLRP3), an important part of innate immunity inflammatory body, play an important role in the immune response and the occurrence and development of many diseases.^17,18 After binding to its specific receptor Toll-like receptor 4 (TLR4), lipopolysaccharide (LPS) can initiate the transcriptional expression of IL-1 β and NLRP3 through NF-κB and MAPK pathway.¹⁹ On this basis, ATP can promote intracellular potassium to outflow and mediate the assembly of NLRP3, apoptosis-related spot-like protein (ASC) and caspase-1 into NLRP3 inflammatory body protein chimera, which finally promote the maturation and secretion of IL-1β. In this study, LPS + ATP was used to induce inflammatory injury of NPMSC. In this study, we found that LPS could reduce the activity of NPMSC in rats in a dose-and concentration-dependent manner after NPMSC was pretreated with different concentrations of LPS+ATP. CCK-8 results showed that 1 μg/ml LPS+5mM ATP could induce an appropriate degree of pyroptosis. Therefore, in the subsequent experiment, this concentration was selected to induce NPMSC inflammatory injury.

Intervertebral disc is a kind of highly rhythmic tissue that experiences circadian cycles from high load to low load.^20,21 Dudek et al. have found that many key biological clock genes show circadian differential expression in normal intervertebral discs,²⁶ including Nr1d1 and brain muscle aromatic hydrocarbon receptor nuclear translocation factor-like protein 1 (Bmal1). the biorhythm of these genes in degenerative intervertebral discs is disordered. Nr1d1 is a key factor in the connection between biorhythm and inflammation.^24,25,27 It can exert an anti-inflammatory effect through NLRP3 inflammatory bodies.^28,30 Activated NR1D1 alleviated colitis in mice, but this protective effect was lost in NR1D1-deficient mice and NLRP3-deficient mice. It was confirmed that NR1D1 activation could inhibit the role of NLRP3 inflammatory bodies. Increasing the activity of NR1D1 protein can inhibit the production of NLRP3 inflammatory bodies and IL-1 β, and then reduce the myocardial and hepatocyte scorch death caused by inflammation. the results of previous studies fully prove that there is a certain correlation among biorhythm, inflammation, and IVDD in the intervertebral disc, but they do not further explore the specific mechanism of the correlation between the three. In our study, the expression of NR1D1 in NPMSC of the degenerative intervertebral disc was significantly lower than that in the non-degenerative group. Similarly, the expression of NR1D1 protein in intervertebral disc nucleus pulposus of 14-month-old rats was significantly lower than that of 2-month-old rats. This indicates that with the increase of age or the aggravation of intervertebral disc degeneration, the activity of NR1D1 protein decreases, and its inhibitory effect on the production of NLRP3 inflammatory bodies and IL-1β will be weakened.

SR9009, as an agonist of NR1D1 synthesis, is non-toxic and shows extensive protective effects in vivo, such as regulating lipid metabolism.^29,31 In general, pyroptosis of NPMSC play an important role in the pathophysiological process of IDD. As far as we know, there are no reports about the impact of SR9009 on NPMSC so far. Therefore, we designed experiments to evaluate the effect of SR9009 on LPS-induced NPMSC inflammatory injury and its possible mechanism. These results suggest that SR9009 has a protective effect on the decrease of NPMSC activity induced by LPS. The results of Wb and immunofluorescence showed that compared with the control group, the protein expression of inflammatory body complex: NLRP3, ASC, Caspase1 and IL-1β was significantly increased in the LPS+ATP group. In the SR9009+LPS+ATP group, the upward trend of these proteins was significantly reversed. This trend was also seen in the YVAD group. As an inhibitor of pyroptosis, YVAD can effectively inhibit the assembly of inflammatory bodies and reduce the death of cells. After using SR9009, the expression of NR1D1 was significantly increased compared with the control group, while in the LPS+ATP group, the expression of NR1D1 was significantly decreased. GSDMD as the executor of pyroptosis, the full-length protein before cleavage is inactive, while after LPS induction, GSDMD produces active N-terminal fragments through cleavage, which binds to the membrane and punches holes, thus triggering pyroptosis. Therefore, the expression of GSDMD-N protein in the LPS+ATP group was significantly higher than that in the control group. The results of Caspase 1 Flow and TUNEL further confirmed that SR9009 could significantly inhibit the pyroptosis of NPMSC induced by LPS. Therefore, the above results suggest that SR9009 has a protective effect on excessive pyroptosis of NPMSC induced by LPS.

Collagen II and Aggrecan are two characteristic markers of IDD, and matrix metalloproteinase-13 can regulate the metabolism of these two proteins.^22,23 In this study, LPS negatively regulated the expression of aggrecan and type II collagen, while up-regulated the expression of matrix metalloproteinase-13. In addition, pre-treatment of SR9009 can reverse this phenomenon. Our present study results showed that SR9009 can promote the expression of extracellular matrix by alleviating the inflammatory injury.

In general, we found that the activation of NR1D1 may play a regulatory role in the process of IVDD (Figure 9). On the one hand, we found that there were four binding sites between NR1D1 and NLRP3, -4.4 kb, −4.2 kb, −1.2 kb and −0.2 kb, respectively. The results of Wb also showed that the proteins of NLRP3; caspase-1 and IL-1β in the LPS-induced group were significantly higher than those in the control group. After SR9009 stimulation, the above proteins were significantly higher than those in the LPS group. These indicated that SR9009 inhibited the excessive pyroptosis of NPMSC and the degeneration of ECM through the NR1D1/NLRP3/IL-1β pathway. On the other hand, the two binding sites of NR1D1 and IL-1β are 2.4 kb and 0.2 kb, respectively. This provides the possibility for SR9009 to activate NR1D1 to inhibit the aggregation of IL-1β.

Figure 9.

Schematic of the protective effects of SR9009

(A) clinical sample collection and analysis of NR1D1 levels.

(B) IVDD model of SD rat.

(C) SR9009 protected NPMSC from pyroptosis by activating NR1D1 to inhibit the assembly of NLRP3 inflammasome and the secretion and synthesis of IL-1β in vitro and vivo.

Limitations of the study

This study has some limitations. First, our original intention was to sequence the collected degenerative clinical samples and normal clinical samples. However, the amount of RNA that can be extracted from clinical samples at the time of sequencing is extremely low to be sequenced. In the end, we had to select cells to sequence. The results are somewhat less accurate than clinical samples. Secondly, in this study, we mainly focused on nucleus pulposus mesenchymal stem cells, although the results of animal experiments were consistent. However, whether it also has corresponding effects on nucleus pulposus cells is not reflected in this article. This will also be our next research focus. Third, we were unable to obtain truly healthy or non-degenerative nucleus pulposus tissue, and we only included nucleus pulposus tissue from relatively young patients undergoing foraminal endoscopic surgery as a relatively healthy group.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
NR1D1	Bioss	bsm-33343M
NLRP3	Bioss	bs-8878R
caspase-1	abcam	no. ab56416
IL-1β	ABclonal	no. A11025
Collagen-Ⅱ	CST	13141
Aggrecan	CST	3033
ASC	Proteintech	no. 66444-1-Ig
GADPH	ABclonal	no. AC004
GSDMD	Bioss	no. bsm-33282M
Biological samples
Lipopolysaccharide	Jian cheng	catalog no. E004
F12 DMEM complete medium	Gibco	11320033
Fetal bovine serum	Gibco	A5669701
Collagenase type II	Gibco	17101015
Penicillin-streptomycin	Gibco	15140122
Chemicals, peptides, and recombinant proteins
SR9009	Solarbio	no. SG8180
Deposited data
RNA sequencing	Genome Sequence Archive (GSA: CRA015650)	https://ngdc.cncb.ac.cn/gsa/s/VxWdBYjk
Experimental models: Cell lines
Nucleus pulposus mesenchymal stem cells	This paper	N/A
Oligonucleotides
NR1D1-specific SiRNAs sequence: CCCACAUACUUCCCACCAUT TA UGGUGGGAAGUAUGUGGGTT	This paper	N/A
NR1D1-specific SiRNAs sequence: GCCAAUCAUGCAUCAGGUAT TU ACCUGAUGCAUGAUUGGCTT	This paper	N/A
NR1D1-specific SiRNAs sequence: CCUGCUCAAUGCCAUGUUUT T AAACAUGGCAUUGAGCAGGTT	This paper	N/A
Software and algorithms
GraphPad Prism 9.5.1	GraphPad Software Kaplan-Meier Log rank Mantel-Cox Cox proportional hazard Non-parametric Mann-Whitney	https://www.graphpad.com/
Flow cytometry	BD Company	N/A
Transmission electron microscope	Hitachi	H7650
Other
Cell counting kit-8	Beyotime	C0042
EdU cell proliferation detection kit	Beyotime	C0071S
TUNEL kit	Beyotime	no. C1099

Resource availability

Lead contact

Further information and requests should be directed to the lead contact, Xiao-Fei Cheng(13651925069@163.com).

Materials availability

All relevant data are within the manuscript, supporting information files, and depositories. RNA sequencing was deposited in the Genome Sequence Archive. Accession numbers are listed in the key resources table. All data are publicly available as of publication. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Data and code availability

• •This paper does not report the original code.
• •The data sources of this study are presented in the “STAR Methods” sections.
• •Any additional information required to the data reported in this paper is available from the lead contact upon request.

Experimental model and study participant details

Clinical tissue sample

The experimental protocols were approved by the Ethics Committee of Shandong Medical Biotechnology Research Center (2021110015) and informed consent was obtained from all subjects. The healthy nucleus pulposus tissue came from 20 to 30 years old patients (male 2, female 1; age 26–30 years, mean 28.2 years; Pfirrmann ≤ II grade), and the degenerative group received posterior lumbar interbody fusion (PLIF) (male 1, female 2; age 65–75 years, mean 70.4 years; Pfirrmann ≥ IV grade). After collection, some of the samples were fixed with 4% paraformaldehyde (pH7.4) for histological analysis, and the other part was frozen in liquid nitrogen for subsequent RNA sequencing and other experiments.

Method details

RNA sequence

Total RNA was extracted from NPMSC derived from Health group (n = 4) and IVDD group (n = 4). Then they were conveyed to GeneChem company (shanghai, china) to establish the FPKM values of all genes. heatmaps were created, and Pearson’s correlation analysis was performed. In our studies, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed to evaluate the biological function of DEGs. differentially expressed genes (DEGs) were defined as fold changes >1.4 and p < 0.05.

NPMSC isolation and culture

The NP samples were collected from SD rats (weight, 200–220 g; age, 4 months), which purchased from the Laboratory Animal Center of Shandong Medical Biotechnology Research Center. All procedures were approved by the Ethics Committee of Shandong Medical Biotechnology Research Center (2021110015). In brief, The NP samples were separated and collected in aseptic conditions, then washed with PBS containing 0.5% penicillin-streptomycin (Gibco, USA). After twice cleaning, the NP samples were cut into 1 mm∗1 mm∗1mm pieces and incubated with collagenase type II (Gibco, USA) for 6 h at 37°C under 5% CO₂. The NP tissue was then resuspened with phosphate-buffer saline and centrifuged at 1000 rpm for 5 min. Last, the deposition was resuspended in F12 DMEM complete medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA) and cultured at 37°C under 5% CO₂. The cultured medium was refreshed every 2 days. The cells were subcultured in 1:2 after the adherent cells reached 90%. The adherent cells were photographed with a microscope (Olympus, Japan). The P3 cells were harvested for subsequent experiments.

Intervention of Lipopolysaccharide/Adenosine Triphosphate and SR9009 on NPMSC

The NPMSC were incubated with a graded concentration of SR9009 (Solarbio, Beijing, catalog no. SG8180) (0–40 μM) to evaluate the protective effect of SR9009 on Lipopolysaccharide/Adenosine Triphosphate-induced inflammatory injury. Based on the data showed in “Results” section, NPMSC were prior to be incubated with 10 μM SR9009 for 12 h and then 1 μg/ml Lipopolysaccharide (Nan Jing, Jian cheng, catalog no. E004) for 24 h and 5 mM ATP for last half hour as the intervention for the follow-up experiment according to Wang et al. description for inflammation model.²⁷ The cells were divided into four groups according to different treatment: (A) CON group: blank control; (B) LPS+ATP group: 1 μg/ml Lipopolysaccharide+5mM Adenosine Triphosphate; (C) SR9009 group: 10 μM SR9009; (D) S + L + A group: 10 μM SR9009 + 1 μg/ml Lipopolysaccharide + 5mM Adenosine Triphosphate; (E) YVAD group: 10 μM YVAD + 1 μg/ml Lipopolysaccharide +5 mM Adenosine Triphosphate.

Small interfering RNA(Si-RNA) transfection

The P3 cells were inoculated in 6-well plates at a ratio of 5 × 10⁶ per well. When the cells reached 60%–70% fusion, they were transfected with negative control or siRNA targeting NR1D1 (RiboBio, Guangzhou, Guangdong, China). the NR1D1-specific SiRNAs sequence is as follows.

• (1)CCCACAUACUUCCCACCAUT TAUGGUGGGAAGUAUGUGGGTT
• (2)GCCAAUCAUGCAUCAGGUAT TUACCUGAUGCAUGAUUGGCTT;
• (3)CCUGCUCAAUGCCAUGUUUT TAAACAUGGCAUUGAGCAGGTT.

Then, 260 μL serum-free optical MEM (Invitgen, CA, USA) were used to dissolve 6 μL small interference RNA or 9 μL liposome 3000 (Invitgen, CA, USA), respectively. the mixture was added to the cell after mixing them together. Last, the cells were collected for RNA extraction/protein.

ChIP assays

ChIP assays were performed using the Enzymatic chromatin IP Kit (Magnetic Beads). The P3 NPMSC were cultured in T25 dishes and treated with LPS (1 μg/mL) or vehicle for 1 h. then, the P3 cells were crosslinked with 1% formaldehyde for 20 min at room temperature. After termination by the addition of glycine, DNA was digested with Micrococcal Nuclease and sheared chromatin was immnunoprecipitated with anti- NR1D1 or normal rabbit IgG. Immunoprecipitated chromatin was decrosslinked at 65°C for 4 h and purified by using spin columns.

Transmission electron microscope

LPS-treated and normal MSCs were treated with 4% paraformaldehyde and immersed in a mixture of 2.5% glutaraldehyde −1.5% paraformaldehyde −0.1MPBS at 4°C for several days. The sample was then soaked in a mixture of 1% osmic acid and 1.5% potassium ferrocyanide at 4°C for 2h. After dehydration with gradient alcohol and acetone, the sample was soaked in epoxy resin. Finally cut into 90nm and place on the copper groove grid. They were then treated with uranyl acetate and lead citrate for 30 and 5 min, respectively. Finally, images are generated using a transmission electron microscope (H7650, Hitachi, Japan).

Cell viability assay

The cell counting kit-8 (CCK-8, Beyotime, China) was adopted to assess the cytotoxicity of SR9009 on NPMSC. In brief, P3 NPMSC were seeded into 96-well plates in 1 × 10⁴ cells/well. When cells reached 60% fusion, 10 μL working solution was added to each well after being separately treated as described above for different time node. The OD value was measured with a microplate reader at 450 nm (Bio–Rad, Hercules, United States) after 2 h. The cell viability was calculated as follow:

cell viability (100% of control) = [(Ae-Ab)/(Ac-Ab)] × 100% (Equation 1)

where Ae, Ab, and Ac represent the A450 of the treatment, blank, and control groups, respectively.

5-Ethynyl-2′-deoxyuridine (EdU) incorporation assay

The EdU cell proliferation detection kit (Beyotime, China) was adopted to evaluate cell proliferation. The P3 cells were seeded into 6-well plates in 4 × 10⁴-5×10⁴ cells/well. The cells were incubated with working solution for 3 h, then fixed with 4% paraformaldehyde for 20 min and permeated with 0.5% Triton X-100 for 15 min. Last, incubated with Click Reaction Mixture for 40 min. After washing with PBS, the cells were counterstained with Hoechst 33342 in the dark. The EdU-positive nuclei was determined under a fluorescence microscope.

ELISA assay

The Abcam’s IL-1β enzyme-linked immunosorbent Assay was used to assess the secretion and synthesis of IL-1β in different intervention groups. Brief, P₃ NPMSC were seeded into 96-well plates at the density of 1 × 10⁴ cells/well with different intervention. The cell culture supernatants were collected and centrifuged at 1000g for 10 min. Prepare as much reagent as is needed on the day of the experiment according to the protocol of the kit. The collected supernatants were added 100μL into 96-well plates. Every well was added 50 μL 1×biotinylated IL-1β antibody at room temperature for 3 h. then, remove the cover and wash the plate with 300μL wash buffer. Next, all wells were added 100 μL 1× streptavidin-HRP solution. After three times washed with 300 μL washing buffer, every well was added 100 μL chromogen TMB substrate solution in the dark for 30 min. Last, 200 μL stop reagent was added into each well. The absorbance of each well was read on a spectrophotometer at 450 nm.

Flow cytometry

To evaluate pyroptosis in rat NPMSC, we purchased FLICA 660 Caspase-1 Assay (KeyGen, China). In brief, according to the manufacturer’s instructions, each group cells were digested with none-EDTA trypsin, then resuscitated with FLICA buffer, and incubated 20min with 10μL Caspase 1 and 200μL Hoechst. The positive rates of caspase 1 and Hoechst were analyzed at 660nm by flow cytometry (BD Company, USA).

TUNEL method

The TUNEL kit is often used to test the level of DNA damage. P₃ cells were fixed with 4% paraformaldehyde for 20 min, then incubated with 0.2% Triton X-100 for 10 min. Last, Cells were incubated with TUNEL (Beyotime, China, no. C1099) according to the manufacturer’s instruction, then nucleus were counterstained with 4′,6′-diamidino-2-phenylindole (DAPI, Sigma, USA, no. D-9562) for 10 min. The samples were captured under fluorescence microscope (Olympus Europe GmbH, Germany).

Immunofluorescence

The P₃ NPMSC were fixed with paraformaldehyde (4%) for 20 min. Then they were washed twice with PBS containing 0.5% Triton X-100 for 20 min. After that the cells were incubated with 15% bovine serum albumin for 2 h at room temperature, rinsed with PBS and incubated with primary antibodies: collagen II (Bioss, China, catalog no. bs-10579R) (1:200), matrix metalloproteinase 13 (MMP-13) (Bioss, China, catalog no. bs-10240R) (1:200), NR1D1 (1:1000, Bioss, China, catalog no. bsm-33343M), NLRP3 (1:1000, Bioss, China, catalog no. bs-8878R), ASC (1:1000, Proteintech, USA, catalog no. 66444-1-Ig), caspase-1 (1:1000,abcam, China, catalog no. ab56416), IL-1β (1:1000, ABclonal, Wuhan, China, catalog no. A11025), GADPH (1:10000, ABclonal, Wuhan, China, catalog no. AC004), GSDMD (1:1000, Bioss, China, catalog no. bsm-33282M) overnight (4°C). The second day, the plates were incubated with secondary antibody (1:500) (Bioss, China, catalog no. bs-0248M-FITC) for 2 h. The cell nucleus was labeled by DAPI for 5 min and captured under fluorescence microscope.

Western blot

The Total Extraction Sample Kit was used to collect cell proteins. according to the manufacturer’s instruction, BCA protein assay kit (Beyotime, China, catalog no. P0011) was adopted to assess the protein concentration of different groups. Equal aliquots of the obtained protein were loaded and separated by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE). 5% Non-Fat milk was used to block the membranes for 1 h after electrotransfered onto PVDF membranes (Millipore, USA, catalog no. IPVH 20200), and then followed by incubation with primary antibodies overnight at 4°C. The primary antibodies used were as follows: NR1D1 (1:1000, Bioss, China, catalog no. bsm-33343M), NLRP3 (1:1000, Bioss, China, catalog no. bs-8878R), ASC (1:1000, Proteintech, USA, catalog no. 66444-1-Ig), caspase-1 (1:1000,abcam, China, catalog no. ab56416), IL-1β (1:1000, ABclonal, Wuhan, China, catalog no. A11025), GADPH (1:10000, ABclonal, Wuhan, China, catalog no. AC004), GSDMD (1:1000, Bioss, China, catalog no. bsm-33282M). After that, the membranes were incubated with the secondary antibodies for 1 h. The bands were captured by a computer imaging system. The expression level was semi-quantified by ImageJ software (NIH, USA).

Real-time PCR

Quantification of mRNA levels of MMP-13, Aggrecan, Collagen Ⅱ, NR1D1, NLRP3, Caspase 1, ASC, IL-1β, Psmb6, Ceacam4 and Pfkfb2 were evaluated after different inventions. Total RNA from NPMSC were obtained using TRIzol reagent (Invitrogen, US, no.15569-087) according to the manufacturer’s instructions. SYBR Premix Ex Taq (Vazyme biotech, Nanjing, China, catalog no. Q111-02) and Prime Script-RT reagent kit (Vazyme biotech, Nanjing, China, R123-01) were used for reverse transcription reaction from RNA to cDNA. The mRNA level was evaluated by the 2^−ΔΔCt method. Primer Premier 5.0 software were adopted to design the primers sequences (Table 1).

IVDD model induction

18 SD rats were randomly divided into three groups (n = 6 per group:3 female; 3 male, weight:200–250 g; age: 4 months): Control group, DMSO group, and SR9009 group. The IVDD model was established according to Jia et al.²⁸ Briefly, SD rats were placed in a prone position after anesthesia (intraperitoneal injection, 1% pentobarbital sodium at 0.1 mg/kg) and a percutaneous needle puncture was performed with a 21G needle in the Co 6–7. After 21G needle was inserted in the middle of the disc, the needle was held for 5 s and rotated 180°. The SR9009 was dissolved in DMSO and further diluted in saline immediately before situ injection. One week of puncture, the SR9009 group received 10 mg/mL SR9009.²⁹ Meanwhile, the Control group and IVDD group received an equal amount of saline supplemented with the required volume of DMSO.

X-Ray and magnetic resonance imaging (MRI) analysis

X-ray and MRI scans were taken prepuncture and at 6 weeks after the puncture, respectively. The disc height index (DHI) was measured by X-ray.³⁰ And the Pfirrmann grade of IVDD was measured by sagittal T2-weighted images photoed by A 7.0-T MRI scanning system (Philips Intera Achieva 7.0 MR, Netherlands).³¹

Immunohistochemistry (IHC) and histologic analysis

SD rats were sacrificed by an anesthesia overdose after 4 weeks of treatment. The IVD specimens were harvested and fixed with paraformaldehyde (4%), decalcified with a 10% ethylenediaminetetraacetic acid solution, and embedded in paraffin. The part specimens were cut into 6 μm sections and the slices were then stained with safranin-O/fast green (S-O)hematoxylin-eosin (HE) and. the other specimens were incubated with the following primary antibodies: anti- NR1D1 (1:400, Bioss, China, catalog no. bsm-33343M), anti-NLRP3 (1:400, Bioss, China, catalog no. bs-8878R), anti-caspase-1(1:500, abcam, China, catalog no. ab56416), anti-IL-1β (1:500, ABclonal, Wuhan, China, catalog no. A11025), anti-Collagen-Ⅱ (1:400, 13141, Cell Signaling Technology), and anti- Aggrecan (1:400, 3033, Cell Signaling Technology). Histologic images were assessed following the histologic grading scale criteria reported by Norcross et al.³²

Quantification and statistical analysis

Each measurement was conducted in triplicate. Results were expressed as mean ± standard deviation. All statistical analysis was conducted using SPSS 18.0 (IBM, Chicago, IL, USA). The one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test was used for analyzing data from multiple groups and a difference was regarded statistically significant when the p < 0.05.

Published: April 16, 2024