Abstract
While conventional pathogenic protists have been extensively studied, there is an underappreciated constitutive protist microbiota that is an integral part of the vertebrate microbiome. The impact of these species on the host and their potential contributions to mucosal immune homeostasis remain poorly studied. Here, we show that the protozoan Tritrichomonas musculis activates the host epithelial inflammasome to induce IL-18 release. Epithelial-derived IL-18 promotes dendritic cell-driven Th1 and Th17 immunity and confers dramatic protection from mucosal bacterial infections. Along with its role as a “protistic” antibiotic, colonization with T. musculis exacerbates the development of T cell driven colitis and sporadic colorectal tumors. Our findings demonstrate a novel mutualistic host-protozoan interaction that increases mucosal host defenses at the cost of an increased risk of inflammatory disease.
Graphical Abstract
Introduction
The mammalian gut is host to a wide consortium of microbes from diverse phyla including viruses, prokaryotic bacteria and eukaryotic microbes. The latter, broadly referred to as the eukaryome (Lukes et al., 2015), is comprised of a myriad of fungi, helminths and protists. Several protists are known pathogens of the mouse and human intestine, these include the microsporidia (Encephalitizoan cuniculi) (Stentiford et al., 2016), Entamoeba histolytica (Moonah et al., 2013), Toxoplasma gondii (Molloy et al., 2013), Giardia spp. and Cryptosporidium spp. (Kotloff et al., 2013), and the host immune response induced upon colonization with these unicellular protozoan parasites is well studied in both patients and experimental settings. In contrast, it is increasingly evident that a constitutive protistic microbiota, which exists as an integral part of the vertebrate microbiome, inhabits mammalian intestinal tracts. The prevalence and classification of these protists, including stramenopiles (Blastocystis spp.), diplomonads (Enteromonas spp.), amoebozoa (Entamoeba dispar, Entamoeba coli) and parabasalids (Pentatrichomonas hominis, Dientamoeba fragilis), as commensal, pathobionts, or pathogens remains enigmatic and debated (Lukes et al., 2015). The impact of these species on the host in general and, in particular, on the immune system has been practically neglected.
In this study, we describe the critical contribution of the rodent parabasalid Tritrichomonas musculis (T.mu), a previously unrecognized commensal of the rodent microbial flora, in shaping the intestinal immune landscape. We show that intestinal colonization with T.mu leads to inflammasome activation in the epithelial compartment and the release of the inflammatory cytokine IL-18, which in turn contributes to host protection against mucosal bacterial infections but exacerbates disease sequelae in animal models of colitis and tumorogenesis. These results uncover a previously unappreciated mutualistic relationship between a protist and its host, and identify the critical contribution of protozoa to mucosal defenses.
Results
Identification of a gut protozoan commensal in mice
Routine phenotypic analysis of gut tissue revealed a significant expansion of the CD45+ hematopoietic cell compartment in the C57BL/6 (B6) mouse colony maintained “in-house” at the Mount Sinai animal facility (Fig. 1A–B) together with increased levels of IgA in the sera and colonic explants compared to commercially available mice purchased from Jackson Laboratories (Jax) (Fig. 1C). Remarkably, analysis of colonic luminal content revealed a large number of IgAintDAPI+ cells in in-house colonies, which were absent in commercial mice (Fig. 1D). Microscopic analysis of fecal material from in-house mice revealed the presence of unicellular flagellated microorganisms that resembled a parabasalid protozoan parasite (Fig. 1E) which were closely adherent to the intestinal epithelial surface (Fig. 1F). Molecular PCR-DNA sequencing at the 18S (Supplementary Fig. 1C) and ITS (Fig. 1H and Supplementary Fig. 1D–E) rDNA locus identified a new protozoan parasite referred to hereafter as Tritrichomonas musculis (T.mu), which is similar to, but distinct from, Tritrichomonas muris. Phylogenetic analysis of T.mu sequences obtained for GAPDH, a-tubulin, EF1a and MDH from metagenomic sequences obtained from FACS-purified T.mu isolated from infected B6 mice established that T.mu is indeed unique, with close ancestry to Tritrichomonas foetus (Supplementary Figure 1F–I). T.mu was also identified within 4 separate animal facilities within the intramural NIH animal facilities (Bethesda, MD) in addition to Mount Sinai animal facility indicating that the parasite was both widespread and common within East Coast research facilities.
Figure 1. Identification of a new protistic commensal in mice.
(A) Colonic LP cells were isolated from B6 mice obtained from commercial sources or bred at the Mount Sinai animal facility (in-house). Cells were stained with anti-CD45 antibodies and analyzed by flow cytometry. Colored contour plots show staining for CD45 on gated live LP cells. Numbers adjacent to gates represent percentages (+/− SEM). (B) Bar graph shows quantification of CD45.2+ cells. (C) Bar graph shows IgA concentrations in sera (mg/ml, left) or colonic tissue explants (mg/g, right). (D) Surface staining of IgA bound to intestinal microbes. Numbers adjacent to gates represent percentages. (E) Cytospins of sorted IgA+ cells in (D) were stained with Giemsa. Micrograph shows a representative staining of colonic lavage (40x magnification). Bar indicates 10µm. (F) Scanning electron microscopy (SEM) of colonic tissues from in-house mice. (G) Protozoa per gram of cecum were quantified in five in-house B6 animals naturally colonized with protozoa (B6 Nat) or five animals gavaged with 2 × 106 FACS sorted protozoa (B6 Gavage). Bar graph represents number of protozoa per gram of cecum. (H) DNA was isolated from FACS-purified protozoa and subjected to ITS PCR-DNA sequence analysis. Phylogenetic analysis was performed as described in Material and Methods. The sequence placed the rodent parabasalid, which we hereafter refer to as T. musculis (T.mu), as distinct and sister to a clade comprising the Tritrichomonadidae that shared 95% identity with T. muris. (I) Intestinal tissues were isolated from B6 mice 2 weeks after inoculation with purified T. mu, and paraffin-embedded sections were stained with H&E and PAS. (J) Pathological scoring of T. mu-inoculated cecums and colons was performed, assesing combined pathological score for colon tissue and colonic goblet cell hyperplasia (left) and cecum tissue and cecum goblet cell hyperplasia (right). Red dashed bar denotes borderline pathological score found in normal mice (score 0–2) (Barthel et al., 2003). Data shown represent 3 mice per group, whereof 4–5 high-power fields per tissue and animal were assessed. Statistical analysis was performed using unpaired Student’s t-test. Statistical significance is indicated by *P < 0.05, **P < 0.01, and ***P < 0.001Scale bar 100 mm (A–C) Data shown is representative of at least two independent experiments with at least three animals per experimental group. All data are shown as mean ± SEM. Student’s t-test was performed. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. See also Supplementary Fig. 1 and Supplementary Table 1.
D. fragilis is the closest human ortholog
Humans are likewise host to several enteric parabasalids, such as Pentatrichomonas hominis and Dientamoeba fragilis, but whether these protists are commensals, pathobionts, or pathogens is still debated. To determine if a T.mu orthologous sequence type is common in people, we screened 188 fecal samples collected from healthy adults with no gastro-intestinal clinical symptoms obtained from 9 health districts as part of a Colombian NIH Health Survey. A heterogeneous array of Dientamoeba fragilis sequences was detected in all health districts sampled (31/188; 16.5%) with the highest incidence (6/19; 31.6%) in the Fomeque region (Supplementary Table 1). To assay whether enteric parabasalids were found globally, we screened available Giardia positive fecal material obtained from 96 human individuals collected from South America, Africa, Europe and Asia. We identified a widespread distribution of the human T. mu ortholog (11/96; 11.5%) emphasizing the potentially unappreciated prevalence of T.mu orthologs in humans (Supplementary Fig. 1E).
Consistent with prior studies (Treuting et al., 2012), we found little if any T.mu in the small intestine of T.mu-bearing animals prompting us to focus mainly on immune changes in the colonic mucosa (data not shown). To directly address whether the presence of T.mu was responsible for the expansion of gut tissue-resident immune cells and increased IgA levels, we colonized commercial B6 mice with purified T.mu. We used fluorescent activated cell-sorting (FACS) to purify the protozoan (Supplementary Fig. 1A and data not shown) which was quadruple sorted and we confirmed the purity and reproducibility of our sorting method using mass spectrometry analysis of the FACS-sorted T.mu from B6 mice (Supplementary Fig. 1B).
Commercial B6 mice were colonized using a single gavage of purified T.mu and analyzed at different times after colonization. The colonization was life-long, and persisted in the offspring of the colonized animals for several generations (data not shown). Importantly, T.mu colonization frequency was identical in mice inoculated via oral gavage to in-house T.mu infected animals (Fig. 1G). Strikingly, and despite the extensive expansion of gut tissue-resident hematopoietic cells we failed to detect histological signs of mucosal injury in T.mu bearing mice, although a mild epithelial and goblet cell hyperplasia was noted in infected animals compared to non-infected controls (Fig. 1I,J). Altogether these results establish that T.mu is a constituent member of the microbial flora of adult mice capable of colonizing mice with no acute harm to the host and regardless of the preexisting microbial communities present.
T.mu colonization rapidly shapes the colonic tissue immune landscape
To directly address whether T.mu was responsible for the expansion of gut tissue-resident hematopoietic cells, we characterized the immune cell composition of T.mu-colonized mice using Flow cytometry and Cytometry by Time of Flight (CyTOF) analysis of colonic lamina propria (LP) isolated at different times after colonization (Fig. 2A–C). We observed a substantial increase in Ly6Chi monocytes, CD103−CD11b+ DCs, macrophages and neutrophils as early as one week after colonization, compared to PBS-gavaged mice (Fig. 2C–D). In contrast, migratory CD103+DCs and CD103+CD11b+ DCs were reduced in the colonic mucosa, in line with their superior ability to migrate to the mesenteric draining lymph nodes (MLNs) in response to inflammatory signals (Bogunovic et al., 2009; Bogunovic et al., 2012). Changes in myeloid cell composition were associated with increased production of tumor necrosis factor alpha (TNFα) by macrophages and infiltrating Ly6Chi monocytes (Fig. 2D,E). In addition to changes of the innate myeloid compartment, T.mu colonization also affected innate lymphoid cells (ILC) (Spits et al., 2013). While ILC did not expand in T.mu-colonized mice, we observed a substantial increase of IL-5 and IL-13 producing ILC2 in the colonic mucosa, similar to a recent report in the small intestine of mice colonized with the protozoa Tritrichomonas spp (Howitt et al., 2016). However, we also found that activation of ILC2 in T.mu-colonized mice was associated with a significant increase of GM-CSF-producing ILC3 (Supplementary Fig. 2 A – C).
Figure 2. Colonization with T.mu remodels the colonic mucosal immune tone.
(A) Groups of B6 mice were gavaged with 2 × 106 highly purified T.mu. Eight weeks later, colonic LP cells were stained with anti-CD45.2 antibodies and analyzed by flow cytometry. Colored contour plots show CD45+ cells. Numbers adjacent to gates represent percentages. (B) Bar graph shows absolute number of CD45.2+ cells in control (Ctrl) mice or mice inoculated with T.mu. (C) CyTOF analysis of colonic myeloid immune populations after colonization with purified T.mu. ViSNE dot plots show changes in immune cell composition after T.mu colonization. (D) Intracellular cytokine staining and flow cytometric analysis of TNFα-producing cells in the colonic tissue of T.mu colonized mice. Colored contour plots show staining for TNFα and MHCII within all CD45+ cells. Gates were drawn on TNFα+ MHCII+ cells and the expression of Ly6C and CD64 was analyzed. Numbers adjacent to gates represent percentages (E) Bar graphs show absolute numbers of all TNFα-producing cells and their distribution into the macrophage and monocyte population. (F–G) Mice were gavaged with purified T.mu and 14 days later, colonic LP CD4+ T cells were analyzed for the production of IL-17 and IFNγ (F) and for the production of IL-5 and IL-13 (G) by intracellular cytokine staining. Numbers adjacent to gates represent percentages. (H) Bar graphs show quantification of cytokine-producing cells. (I) Bar graphs show absolute numbers of IFNγ+, IL-17+ and IL-17+IFNγ+ (DP) Th cells. (J) IFNγ, IL-17 and IL-17+IFNγ+, production by CD4+ T cells isolated 7 days, 14 days, 28 days and 56 days after colonization with T.mu. Bar graphs show absolute numbers of Th cell-subsets. Data shown is representative of at least two independent experiments with at least 3 mice per group and experiment. All data are shown as mean ± SEM. Student’s t-test was performed. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. See also Supplementary Figures 2 and 3.
We also detected a drastic expansion of interferon γ (IFNγ)-producing CD4+ T helper cells (Th1) cells as early as one week after T.mu colonization, whereas we failed to detect any expansion of IL-5, IL-13 or IL-4 producing Th2 cells (Fig. 2F–I). CD4+IFNγ+Th1 cells peaked and plateaued around 2 months post colonization (Fig. 2J). We also observed an expansion of interleukin-17 (IL-17)-producing CD4+ Th cells (Th17), which increased around 2–3 weeks after colonization, but to a lower level than Th1 cells (Fig. 2F, 2J). In addition, we found that the number of activated CD44hiCD4+ T cells increased in the MLN (data not shown) and colonic LP (Supplementary Fig. 2D), while the number of proliferating CD4+Ki67+ T cells and CXCR3+CD4+ T cells expanded in the colonic LP two weeks after T.mu colonization (Supplementary Fig. 2D–E). These results suggest that colonization with T.mu promotes the priming of tissue-specific T effector responses in the MLN, followed by the accumulation and/or expansion of effector T cells in the colonic LP. To assess whether the drastic colonic immune modulation observed upon T.mu colonization was not solely due to a collateral effect related to the transfer of endosymbiotic or contaminating bacterial taxa we inoculated T.mu free mice with purified T.mu cultured in the presence of 5 antibiotics (Abx), as previously described (Saeki et al., 1983). Importantly, we observed a similar induction of colonic Th1 and Th17 immune responses in mice inoculated with purified and cultured Abx treated T.mu or untreated FACS-sorted T.mu (Supplementary Fig. 2F and Fig. 2F), suggesting that T.mu is the main driver of the colonic immune-modulatory effects observed in T.mu colonized animals. Consistent with the dominant Th1 cell induction, we observed a strong IFNγ-driven gene expression signature in the colonic mucosal epithelia of T.mu colonized mice (Supplementary Fig. 3), prompting us to probe the pathways that promoted T. mu-induction of Th1 and Th17 responses in mice.
Division of labor between distinct colonic tissue DC subsets helps shape mucosal immunity upon T.mu colonization
Tissue-resident DCs are most potent at driving mucosal-specific T cell effector responses upon migration, and antigen presentation in the T cell zone of tissue-draining LNs enriched in naïve T cells (Iwasaki, 2007). CCR7 is a chemokine receptor that controls DC migration from the mucosal tissues to the MLN, and Ccr7−/− mice lack migratory DCs in the MLN (Jang et al., 2006). Colonization with T.mu did not lead to Th1 and Th17 cell expansion in Ccr7-deficient mice (Fig. 3A), suggesting that DC migration may be required to promote T effector cell responses upon T.mu colonization in vivo. However, since CCR7 is also required for T cell entry into the LN (Forster et al., 1999), failure to induce effector cell responses in T.mu colonized Ccr7-deficient mice may also be due to T cell intrinsic defects.
Figure 3. Distinct DC subsets control T.mu associated immune responses.
(A–G) Mice were gavaged with purified T.mu 14 days prior to analysis. Colonic LP cells were isolated from (A) Ccr7−/−, (B) Batf3−/−, (E) Irf8ΔDC, (H) Irf4ΔDC. Cells were incubated in the presence of brefeldin A, Ionomycin and PMA for 4h and stained with anti-CD45, CD3, CD4, IL-17 and IFNγ. IL-17 and IFNγ-producing CD4+ T cells were analyzed using flow cytometry. Bar graphs show quantification of absolute numbers of cytokine-producing colonic Th cells. Colonic LP cells isolated from indicated knock out mice were stained with anti-CD45, MHCII, CD11c, CD11b, CD103, CD64 and Ly6C. DC populations were analyzed by gating on CD45+ MHCII+ CD11c+ CD64− Ly6c− cells. (C, D, F and G) contour plots show the abundance of CD103+ DC, CD103+CD11b+ DC and CD103−CD11b+ DC within the colonic LP of WT, Batf3−/−, Irf8ΔDC, Irf4ΔDC mice. Data shown is representative of at least 3 independent experiments with at least 3 mice per experimental group for each genotype. All data are shown as mean ± SEM. Student’s t-test was performed. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. See also Supplementary Figure 4.
LP DCs are heterogeneous and consist of functionally specialized subsets that arise from distinct differentiation lineages. CD103+CD11b+F4/80−Flt3+ DCs which require the transcription factor Interferon Regulatory Factor 4 (IRF4) for their differentiation, are more potent at driving Th2 and Th17 differentiation in the mucosal tissues (Gao et al., 2013; Murphy, 2013; Persson et al., 2013; Schlitzer et al., 2013; Tussiwand et al., 2015). CD103+CD11b−F4/80−Flt3+ DCs arise independently of IRF4 and require the transcription factors IRF8, Basic Leucine Zipper Transcription Factor ATF-like 3 (BATF3) and Inhibitor of DNA binding 2 (ID2) for their differentiation, and are more potent at driving CD8+ T cell immunity (Bogunovic et al., 2009; Edelson et al., 2010; Helft et al., 2010; Varol et al., 2009). To directly examine the contribution of each DC subset to the induction of T effector cells upon T.mu colonization, we used DC-specific knock-out lines that lack distinct DC subsets. We found that Batf3−/− mice that lack CD103+CD11b− DCs but not CD103+CD11b+ DCs in the colonic LP, failed to expand CD4+IFNγ+ Th cells upon T.mu colonization, whereas expansion of CD4+IL-17+ Th17 cells was intact and slightly increased in the colonic mucosa of T.mu-colonized mice, compared to mice free of T.mu (Fig. 3B,D). In addition to Batf3-deficient mice, Irf8-deficient mice should also be unable to mount T.mu-specific Th1 responses, since IRF8 is required for the differentiation of the CD103+ DC lineage (Helft et al., 2010). Because IRF8 has pleiotropic effects in hematopoietic cell differentiation, we crossed Cd11cCre mice with Irf8flox/flox mice (Irf8ΔDC mice) to specifically delete Irf8 in CD11c+ DCs. Importantly, similar to Batf3−/− mice, Irf8ΔDC mice lacked CD103+CD11b− DC and failed to expand CD4+IFNγ+ Th1 cells upon T.mu colonization (Fig. 3E–F), whereas CD4+IL-17+ Th17 cells expanded similarly in Irf8ΔDC and Irf8flox/flox mice colonized with T.mu. To probe the contribution of CD103+CD11b+F4/80−Flt3+ DC to immune changes induced upon T.mu-colonization, we deleted Irf4 in CD11c+ DCs (Cd11cCre x Irf4flox/flox (Irf4ΔDC)) leading to the depletion of CD103+CD11b+ DCs in the colonic LP (Fig. 3G). Two weeks post colonization with T.mu, expansion of CD4+IFNγ+ Th1 cells was similar in Irf4ΔDC and Irf4flox/flox mice, whereas CD4+IL-17+ Th17 cells expanded less prominently in the colonic mucosa of Irf4ΔDC mice (Fig. 3H). Altogether, these results establish the distinct contribution of CD103+CD11b− DC and CD103+CD11b+ DC to the induction of Th1 and Th17 immunity, respectively, upon T.mu colonization.
Given the significant accumulation of Ly6Chi monocytes observed in T.mu-colonized mice, we asked whether monocytes and macrophages help shape T cell responses observed after T.mu colonization. CCR2 is a chemokine receptor that is highly expressed on monocytes and is required for efficient monocyte egress from the bone marrow leading to reduced monocyte accumulation in tissues of Ccr2-deficient mice (Serbina and Pamer, 2006). Interestingly, while Ccr2-deletion led to a drastic reduction of colonic tissue-infiltrating monocytes, we did not observe any changes in the number of IFNγ+ and IL-17+ T effector cells at two weeks following T.mu colonization (Supplementary Fig. 4A), in addition T cell responses were independent of TLR5 signaling and Myd88 signaling in macrophages and intestinal epithelial cells (Supplementary Fig. 6). Importantly, T.mu engraftment efficiency was identical in mice lacking DC or monocytes populations suggesting that differences in T.mu colonization resistance were not responsible for the immune phenotype observed in these mice (Supplementary Fig. 4B). Altogether, these results reveal a critical role for tissue-resident DC to the induction of a diverse effector response to T.mu-colonization.
To examine whether T.mu was directly responsible for the induction of Th1 and Th17 responses in the colonic mucosa, we colonized germ-free (GF) mice with T.mu and probed the expansion of IFNγ and IL-17 T cells in the colonic mucosa two weeks after colonization. We found that similar to our observations in conventional mice, T.mu colonization led to an expansion of Th1 and Th17 cells in GF mice. Interestingly, T.mu colonization of GF mice led to a slightly stronger Th17 cell response compared to conventional mice, (Supplementary Fig. 5A–B). Increased Th17 response observed in these mice may be due either to increased T.mu colonization (Supplementary Fig. 5C) or modulation of Th17 responses by the commensal bacterial flora.
T.mu shapes colonic adaptive immunity via ASC and IL-18 activation
The initiation of T helper responses requires the orchestrated actions of cytokines to induce and amplify their effector polarization. Interleukin-12 (IL-12) and IL-18 have been associated with induction of Th1 immunity (Boraschi and Dinarello, 2006; Sims and Smith, 2010; Trinchieri, 2003). We found that IL-18 was released at high levels in the colonic tissue upon T.mu colonization (Fig. 4A) and that IL-18 receptor alpha (IL-18Rα) was expressed at high levels in colonic-infiltrating T cells (Supplementary Fig. 2G) prompting us to examine whether increased production of IL-18 contributed to the induction of Th1 response in T.mu colonized mice. We found that absence of IL-18 completely abrogated the expansion not only of CD4+IFNγ+ Th1 but also CD4+IL-17+ Th17 cells upon colonization with T.mu, compared to control mice (Fig. 4B). Abrogation of the Th1 and Th17 response observed in T.mu infected il18−/− mice was not due to reduced T.mu colonization as T.mu colonization efficiency was identical in il18−/− mice that have been either gavaged with purified T.mu or cohoused with T.mu infected mice (Supplementary Fig. 4B)
Figure 4. Inflammasome activation promotes T.mu associated immune responses.
(A) Tissue culture supernatants of tissue explants or RNA, isolated from total colonic tissue were analyzed. Supernatants were analyzed for the presence of IL-18 protein using ELISA. Quantitative RT-PCR was performed to measure IL-18 RNA on whole colonic tissue. Bar graphs show pg/ml of IL-18 or relative expression of Il18 normalized to Hprt. (B–E) Mice were gavaged with purified T.mu 14 days prior to analysis. Colonic LP cells were isolated from (B) Il18−/−, (C) Lethally irradiated bone marrow chimeric mice reconstituted with Il18+/+ or Il18−/−bone marrow cells, at least 8 weeks prior to inoculation with T.mu (D) Asc−/−, (E) Il1r1−/−, mice. Cells were incubated in the presence of brefeldin A, Ionomycin and PMA for 4h and then stained with anti-CD45, CD3, CD4, IL-17 and IFNγ. IFNγ and IL-17 production by CD4+ T cells was analyzed using flow cytometry. Bar graphs show quantification of colonic Th cells producing IFNγ only, IL-17 only or IL-17 and IFNγ (DP). Data shown is representative of at least 3 independent experiments with at least 3–4 mice per experimental group for each genotype. All data are shown as mean ± SEM. Student’s t-test was performed. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. See also Supplementary Figures 4 and 6.
Release of mature and bioactive IL-18 requires cleavage of the precursor form of IL-18 by active Caspase-1 (Gu et al., 1997). Activation of Caspase-1 is driven by the assembly of cytosolic multiprotein complexes called ‘inflammasomes’ and requires, in most cases, the adaptor apoptosis-associated speck-like protein containing a CARD (ASC) (Schroder and Tschopp, 2010). IL-18 is produced by many different cell types including intestinal epithelial cells, stromal and hematopoietic cells (Boraschi and Dinarello, 2006; Dinarello et al., 2013; Sims and Smith, 2010). To examine the contribution of the epithelial or hematopoietic compartment to IL-18 production upon T.mu infection, we generated (Il18−/− -> wild type) bone marrow chimeric mice that specifically lack IL-18 in the mucosal hematopoietic compartment. We found that (Il18−/−-> wild type) bone marrow chimeric mice responded similarly to (wild type -> wild type) bone marrow chimeric controls to T.mu colonization, suggesting that epithelial production of IL-18 controlled T.mu driven Th1 and Th17 response in the colon (Fig. 4C).
To further probe the key role of IL-18 in host response to T.mu infection, we colonized Asc−/− mice that are unable to produce active Caspase 1 and bioactive IL-18. Consistent with the results observed in Il18−/− mice, Asc−/− mice failed to mount Th1 and Th17 responses upon T.mu colonization, further establishing the key role of the inflammasome in T.mu-associated adaptive immune responses (Fig. 4D). ASC-driven Caspase 1 activation can also cleave the precursor form of IL-1β (Schroder and Tschopp, 2010; Sims and Smith, 2010). However, we found that induction of CD4+IFNγ+ Th1 and CD4+IL-17+ Th17 response upon T.mu colonization was less affected in mice lacking Il1r1 (Fig. 4E).
T.mu colonization protects from mucosal bacterial infection through activation of the inflammasome
The expansion of a strong Th1 immune response mostly in the large intestine and cecum of colonized mice led us to explore a potential mutualistic role for T.mu in shaping host mucosal defenses. Thus, we probed the contribution of T.mu to modulating the clinical outcome of enterocolitis driven by Salmonella typhimurium infection, one of the leading causes of enterocolitis in developing countries (Barthel et al., 2003). Strikingly, we found that while Salmonella infection causes massive cecal inflammation in mice free of T.mu, the cecum of T.mu-colonized mice remained almost unaffected by the bacterial pathogen (Fig. 5A), despite the fact that Salmonella colonized as efficiently T.mu-inoculated as T.mu-free mice (Fig. 5B). All pathological parameters including colonic infiltration of polymorphonuclear granulocytes, submucosal edema, reduction of goblet cells number and epithelial cell integrity were dramatically improved in mice that were colonized with T.mu prior to the infection with Salmonella (Fig. 5A). Accordingly, we found that Salmonella colony-forming units (CFU) were strongly reduced in the MLN and spleen of mice inoculated with T.mu compared to T.mu free animals (Fig. 5B). Since our results above established that epithelial release of IL-18 was critical to shape T.mu–induced immunity, we asked whether IL-18 contributed to T.mu-mediated protection against mucosal Salmonella infection. Importantly, we found that injection of neutralizing anti-IL-18 antibody strongly reduced the protective effects of the T.mu-colonization in Salmonella-infected mice compared to control mice reflected by increased inflammation (Fig. 5C) and increased Salmonella infection (Fig. 5D) observed in the group treated with IL-18 blocking antibody in comparison to isotype control treated mice. These data establish that the presence of T.mu in the microbial flora significantly protects against mucosal infection through the induction of inflammasome-driven IL-18 release by the colonic epithelium.
Figure 5. T.mu protects against mucosal infection through inflammasome activation.
(A) Groups of mice were either gavaged with purified T.mu or left untreated 14 days prior to Salmonella typhimurium infection. Cecum weight was measured and pathological scoring was performed on H&E stained sections. Data shown is representative of 3 individual experiments with 5 mice per experiment and experimental condition. (B) S. typhimurium colony-forming units (CFU) were measured in the fecal pellet, the cecum, spleen and MLN 48h after infection. (C) Groups of mice were gavaged with purified T.mu 14 days prior to S. typhimurium infection and injected for three consecutive days with 200 ug of either isotype control IgG or anti-IL18 neutralizing antibody right before S. typhimurium infection. Cecum weight was measured and pathological scoring was performed on H&E stained sections. (D) CFU of S. typhimurium were measured in the MLN and spleen 48h after infection. Data shown is representative of at least 2–3 independent experiments with at least 5 mice per group and experiment. All data are shown as mean ± SEM. Student’s t-test was performed. Statistical significance is indicated by *P < 0.05, **P < 0.01, ***P < 0.001; ns, not significant. Scale bar 100 mm.
T.mu colonization increases susceptibility to pathogenic inflammation
The sustained levels of inflammatory molecules found in the colonic tissues prompted us to test whether T.mu could also contribute to pathogenic inflammation in infected mice. Thus, conventional or GF, immunodeficient recombination-activating gene 2 (Rag2−/−) mice were colonized with T.mu two weeks prior to injecting highly purified CD4+CD45RBhi effector T cells. Consistent with prior reports, injection of effector T cells in Rag2−/− animals led to consistent weight loss, associated with intestinal inflammation, whereas GF mice were protected from disease (Feng et al., 2010; Read and Powrie, 2001). Importantly, conventional and GF animals colonized with T.mu prior to T cell transfer had a more aggravated disease, with increased weight loss starting approximately two weeks after T cell transfer, which correlated with more severe pathological score compared to control mice (Fig. 6A).
Figure 6. T.mu exacerbates pathogenic inflammation.
(A) Groups of GF Rag2−/− mice were left untreated (black), conventionalized (pink) or inoculated with quadruple sorted T.mu (blue). Groups of conventional Rag2−/− mice were left untreated (grey) or inoculated with purified T.mu (purple). Conventionalization of mice was carried out 4 to 6 weeks prior to adoptive transfer of sorted splenic CD45RBhi CD4+ T cells. Gavage with T.mu was performed 2 weeks prior to T cell transfer. Weight loss was monitored weekly and end-point assessment of the disease score was performed using histology assessing degree of inflammation, epithelial erosion, ulceration and hyperplasia, mucin depletion and goblet cell numbers. Pie charts and histology show the clinical assessment of colitis. Data shown is representative of at least 3–4 individual experiments with at least 3–4 mice per experimental group. Scale bar 100 mm. (B and C) Epithelial cell death and epithelial proliferation in colonic tissues of naïve or T.mu inoculated mice. Representative staining of DNA (DAPI blue) and TUNEL (green) in naïve (top row) or T.mu colonized (bottom row) groups. (C) Ki67 staining in colonic tissue of naïve or T.mu inoculated mice. Representative staining of DNA (DAPI blue) and Ki67 (red) in naïve (top row) or T.mu colonized (bottom row). Scatter dot plots show quantification of TUNEL+ cells and Ki67+ cells. (D) Quantitative RT-PCR on T.mu-driven intestinal target genes (Nos2, Tnfa, Reg3g and Reg3b), normalized to Hprt. (E and F) Apc+/min mice were left untreated or inoculated with purified T.mu. (E) Tumor burden and size was measured 8–12 weeks later. Micrographs of formalin-fixed colonic tissue counterstained with methylene blue (0.5% PBS) show representative tumor burden in Apc+/min mice untreated or inoculated with T.mu. (F) Bar graphs show tumor counts and size. Data shown is representative of at least 3 individual experiments with 3–5 mice per experimental condition. All data are shown as mean ± SEM. Student’s t-test or One-way ANOVA Bonferroni’s multiple comparison T test was performed for (A) Statistical significance is indicated by *P < 0.05, **P < 0.01, and ***P < 0.001. See also Supplementary Figure 5.
Sustained tissue inflammation also prompted us to assess the impact of T.mu on epithelial cell damage. We found that as early as 30 days post-colonization, T.mu led to a significant increase in apoptotic epithelial cells at the tip of the villi and an increased number of proliferating epithelial cells at the villi crypts (Fig. 6B–C), confirming our finding of mild epithelial hyperplasia in T.mu infected mice (Fig. 1I–J). T.mu-induced epithelial cell activation was associated with increased expression levels of epithelial Nitric Oxide Synthase 2 (Nos2), TNFα (Tnfa) and IL-22 target genes (Fig. 6D and Supplementary Fig. 3), which together with IL-17 have been implicated in exacerbating colorectal cancer (CRC) development (Grivennikov et al., 2012; Kirchberger et al., 2013; Popivanova et al., 2008; Shaked et al., 2012 ). The loss of the tumor suppressor gene Adenomatous polyposis coli (Apc) increases the development of intestinal tumors in humans. Apcmin/+ mice that carry a truncation mutation in the Apc gene are commonly used as a model of sporadic CRC (Heyer et al., 1999). Colonization of Apcmin/+ mice with T.mu revealed a significant increase in the burden, but not the size, of the colonic tumors around 3–4 months following colonization (Fig. 6F). These results demonstrate that prolonged T.mu colonization can exacerbate the development of tumors in the large intestine of its vertebrate host (Fig. 6E–F).
Discussion
Here we report the identification of a previously unknown mutualistic interaction between the intestinal protozoan commensal T.mu and its vertebrate host. We found that T.mu engrafts into an established ecosystem, leading to long-lasting colonization without causing any pathological injuries to its host. We also show that T.mu colonization completely remodeled the composition and functional state of the mucosal tissue-resident immune system and increased host protection against mucosal bacterial infections.
Colonization with T.mu led to a significant expansion of Th1 cells and Th17 effector cells in the colonic mucosa which was dependent on distinct DC subsets and their ability to migrate to the draining LN but also required the production of IL-18 by the epithelial cells. These results together with the high expression of IL-18Rα on colonic-infiltrating effector T cells (Supplementary Fig. 2G) suggest that T.mu-specific T cell immunity is likely initiated in the draining LN by migratory colonic DCs and is likely further propagated at the tissue site by epithelial IL-18.
It is well established that trichomonad flagellates of insects (i.e., Oxymonads, Trichonymphids and Cristomonads) form endosymbiotic partnerships with bacteria (Hongoh et al., 2008) (Noda et al., 2009), but it is less clear whether the same is true for flagellated trichomonads of the enteric cavities of animals. Whereas many animal-sourced flagellates can only be maintained as xenic cultures, others such as the oral and vaginal flagellates of humans, Trichomonas tenax and Trichomonas vaginalis respectively, can be readily adapted to grow axenically (Diamond, 1962). We found that T.mu cultured in vitro in Abx-rich media or isolated from Abx-treated mice harbor different bacterial taxa (data not shown) but yet produce an equivalent immunomodulation of the colonic mucosa as that from FACS-sorted T.mu transferred from untreated mice, which argues against specific bacterial taxa as the sole agent(s) responsible for the modulation of colonic immunity and supports an instructive role for T.mu in remodeling the mucosal tissue-resident immune system. Regardless, whether the immunomodulatory phenotype observed in infected animals is mediated exclusively by T.mu, an associated microbial symbiont, or from the composite of a protozoan-microbial endosymbiotic interaction, it is our belief that the protist and any associated microbial symbiont should be treated as a single microbial unit that possesses distinct immunomodulatory properties. Importantly, differences in the microbial composition from different mouse strains did not influence T.mu colonization efficiency. Future studies, however, are needed to assess the degree to which shifts in microbial composition or function that naturally occur in response to T.mu colonization contribute to or modulate the colonic immune system. Importantly, the presence of T.mu in several East Coast research institutions and its highly immune-modulatory effects in the host further emphasizes the need for animal cohousing in experimental immunology research. The cost of cohousing experiments would thus need to be taken into account by funding agencies to facilitate the implementation of these additional controls throughout our research community.
Interestingly, T.mu colonization induced the activation of ILC3 and ILC2. ILC2 activation observed in our study was consistent with recent data showing an expansion of IL-13 and IL-5 producing ILC2 in animals infected with Tritrichomonas spp, which was critical to restrain protozoan loads in mucosal sites (Howitt et al., 2016). We were unable to verify the degree of homology between the Tritrichomonas species described here and the one described in this recently published study, and thus it remains unclear at this stage how related these two protozoan species are. However, despite the consistent activation of ILC2 in our study, Th2 effector cells were not expanded or activated in T.mu-colonized mice, whereas Th1 and Th17 responses dominated the colonic immune landscape of our mice.
Strikingly, we found that T.mu colonization conferred significant protection from Salmonella infection-driven enteritis in a manner that was fully dependent on the IL-18 inflammasome. Altogether these results uncover a formidable symbiotic host-protozoan interaction that promotes the release of anti-parasitic cytokines to control protozoan loads (Howitt et al., 2016) while inducing a T effector response to strengthen mucosal defenses against collateral infections such as Salmonella. However while serving a mutualistic relationship, T.mu colonization also increased murine susceptibility to inflammatory disease and cancer, consistent with prior literature showing that the IL-18/IL-18 receptor axis increases susceptibility to IBD and cancer in patients (Zitvogel et al., 2012).
Protists are common members of the constitutive microbiota in humans. However, while most attention has been focused on their pathogenic role in mucosal disease, little is known about their symbiotic relationships with their hosts. Our study identified T.mu’s closest human ortholog as D. fragilis, a unicellular parasite capable of inducing gastro-intestinal symptoms in infected human individuals (Barratt et al., 2011). Controversies are ongoing whether D. fragilis, and for that matter, other protist species such as Enteromonas spp., Entamoeba dispar, Entamoeba coli and the related parabasalid Pentatrichomonas hominis are commensals, pathobionts, or pathogens of the human intestinal tract (Lukes et al., 2015). Certainly D. fragilis has been identified as an etiological agent of irritable bowel syndrome (IBS) (Stark et al., 2007), but it has also been recognized for its potential protective effect against disease flares in patients with inflammatory bowel disease (IBD) (Petersen et al., 2013). Our findings in the murine system demonstrate a host-protozoan interaction that increases mucosal host defenses at the cost of increased risk of inflammatory disease and this may gleen new perspective on the etiology of inflammation and immune homeostasis in individuals colonized with D. fragilis
The strong mutualistic relationship between the protist T.mu and its rodent hosts highlight the need to expand our understanding of host-protozoan relationships in humans and explore the potential key contributions of commensal protozoa in shaping animal and human mucosal defenses. Interestingly, DNA sequencing of T.mu and D. fragilis in mouse and human reveal a strong genetic diversification of the protist between infected carriers. Phylogenetic classification may thus uncover strong geographical heterogeneity on the species level and could furthermore inform about functional and pathogenic differences between subspecies.
STAR METHODS
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for reagents may be directed to, and will be fulfilled by the corresponding author Miriam Merad (miriam.merad@mssm.edu)
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Animals
C57BL/6, B6.129P2(SJL)-Myd88tm1.1Defr/J (Myd88flox/flox), B6.129P2-Lyz2tm1(cre)Ifo/J (LysMCre), B6.Cg-Tg(Vil-cre) (VillinCre), B6.129S4-Ccr2tm1Ifc/J (Ccr2−/−), B6.129P2(C)-Ccr7tm1Rfor/J (Ccr7−/−), C57BL/6J-ApcMin/J (Apc+/Min), B6.129S1-Irf4tm1Rdf/J (Irf4flox/flox), B6(Cg)-Irf8tm1.1Hm/J (Irf8flox/flox), B6.129S2-Ifnar1tm1Agt/Mmjax (Ifnar−/−), 129S-Batf3tm1Kmm/J (Batf3−/−), NOD.Cg-Tg(Itgax-cre)1-1Reiz/PesaJ (CD11cCre), B6.129S1-Tlr5tm1Flv/J (Tlr5−/−), B6.129S7-Il1r1-tm1lmx/J (Il1r1−/−) and B6.129P2-Il18r1-tm1Aki/J (Il18−/−) mice were purchased from Jackson Laboratory. B6.129S6-Rag2tm1FwaN12 (Rag2−/−) mice were purchased from Taconic. Asc−/− mice were obtained from Millenium Inc. GF B6 and Rag2−/− mice were maintained in isolators at the Icahn School of Medicine at Mount Sinai Animal Facility. Unless otherwise stated, mice were used at 6–12 weeks of age. Experiments were carried out using age and gender matched groups. All animal procedures performed in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Mount Sinai School of Medicine.
Animals housed within the vivarium were maintained at specific pathogen free (SPF) health status in individually ventilated cage units that are changed on a weekly basis; cage bottoms are covered with autoclaved bedding and nesting material for enrichment. Mice were fed irradiated food and drink reverse osmosis water from autoclaved bottles or automatic watering system. All animals were manipulated under HEPA filtered air exchange stations or biosafety cabinets and users were required to use chlorine-based disinfectant (MB-10) on gloves and work surfaces within manipulations with animals. All animal users, non-animal users, and husbandry staff were required to wear personnel protection equipment (PPE) to enter the facility i.e. disposable gowns, gloves, head caps, and shoe covers.
Human Specimen
Assessing prevalence of T.mu orthologs in humans
Two human cohort populations were available for diagnostic screening. The first was comprised of fecal samples preserved in 100% ethanol collected from 188 otherwise healthy adult individuals from 9 regions in equatorial Colombia as part of a Colombian NIH health survey. The age of the individuals tested ranged between 16–41years-old. All samples were first screened by microscopy for the presence of Giardia spp., Entamoeba spp., Blastocystis hominis and Cryptosporidium spp. The second comprised 96 globally distributed fecal samples preserved in 100% ethanol from patients diagnosed Giardia positive by microscopy 16 samples each were collected from China, Colombia, Denmark, Ecuador, Egypt, and South Africa. All fecal samples were collected from nine locations across Colombia from asymptomatic adults. The adults provided written informed consent and ethical clearance for this study followed the ethics of Helsinki declaration. The study protocol was approved by the ethics committee from Universidad INCCA de Colombia under the Number 237894
METHOD DETAILS
Isolation of lamina propria and mesenteric lymph nodes leukocytes
Lamina propria lymphocytes were isolated as described (Vonarbourg et al., 2010). Briefly, the large intestines were incubated in EDTA supplemented Hank’s balanced salt solution (HBSS) without Ca2+ and Mg2+(Gibco) for 15–20 min at 37°C with mild agitation. The epithelial cell layer was removed by vortexing. Remaining sheets of LP were digested in collagenase (Sigma) and DNaseI (Sigma). The cells were resuspended in 5ml of 40% Percoll (GE Healthcare) and overlaid onto 5ml of 80% Percoll in a 15ml tube. Lymphocytes were collected at the interphase of the Percoll gradient, washed once and resuspended in media. Mesenteric lymph nodes were removed and cleaned from remaining mesenteric fat and digested with collagenase (Sigma) in Hank’s balanced salt solution (HBSS) with Ca2+ and Mg2+(Gibco) and 10% FBS for 15–20 min at 37°C. Cells we re washed using FACS buffer and filtered through 70µm cell strainer.
Antibodies
CD3e (clone 145-2C11, eBioscience), CD4 (clone GK1.5, eBioscience), CD11b (clone M1/70, eBioscience), CD11c (clone N418, eBioscience), CD45 (clone 30F11, eBioscience ), CD45.2 (clone 104, eBioscience) CD45RB (clone C363.16A, eBioscience), CXCR3 (clone CXCR3-173, Biolegend), CD44 (clone IM7, eBioscience), CD62L (clone MEL-14, Biolegend), Ly6C (clone AL-21, BD), B220 (clone RA3-6B2, eBioscience), ICOS (clone C398.4A , Biolegend), KLRG1 (clone 2F1/KLRG1, Biolegend), RORγt (clone B2D, eBioscience) IgA (clone S107, SouthernBiotech), CD64 (clone X54-5/7.1, Biolegend), CD103 (clone 2E7, eBioscience), F4/80 (clone BM8, Biolegend), I-A/I-E (clone M5/114.15.2, eBioscience), IFNγ (clone XMG1.2, eBioscience), IL-17A (clone eBio17B7, eBioscience), IL-22 (clone IL22JOP, eBioscience) Ki67 (clone SolA15, eBioscience) GM-CSF (clone MP1-22E9, eBioscience), IL-5 (clone TRFK5, eBioscience), IL-4 (clone 11B11, eBioscience), IL-13 (clone eBio1316H, eBioscience). Secondary antibodies, isotype controls and fluorophore-conjugated streptavidins were purchased from Biolegend and eBioscience.
Time of flight Mass cytometry (CyTOF) analysis
C57Bl/6 mice were gavaged with PBS or 2×106 highly purified T. mu prior to analysis. 14 days after inoculation, colonic LP cells were isolated from 2 PBS-treated and 2 T. musculis inoculated mice.
Cells from individual samples were bar-coded with anti-CD45 antibodies, pooled and stained with the following antibodies: Ly6G (141 Pr), CD11c (142 Nd), TCRb (143 Nd), CD8 (146 Nd), CD11b (148 Nd), CD19 (149 Sm), CD24 (150 Nd), CD25 (151 Eu), Siglec-F (152 Sm), NKp46 (153 Eu), CD64 (156 Gd), Foxp3 (158 Gd), CD62L (160 Gd), Tbet (161 Dy), Ly6c (162 Dy), RORgt (163 Dy), CD103 (164 Dy), CD117 (166 Er), Gata3 (167 Er), ST2 (168 Er), NK1.1 (170 Er), CD44 (171 Yb), CD4 (172 Yb), MHCII (174 Yb), CD127 (175 Lu), B220 (176 Yb), Cisplatin (195Pt)
All mass cytometry reagents were purchased from Fluidigm Inc. (former DVS) unless otherwise noted. LN and colons were dissociated into single-cell suspensions, washed with PBS containing 0.1% BSA and blocked with a commercial Fc-blocking reagent (BD Bioscience) to minimize non-specific antibody binding. The cells were then stained with a panel of metal-labeled antibodies against 26 cell surface markers for 30 minutes on ice, and then washed. All antibodies were either purchased pre-conjugated to metal tags, or conjugated in-house using MaxPar X8 conjugation kits according to the manufacturer’s instructions. After antibody staining, the cells were incubated with cisplatin for 5 minutes at RT as a viability dye for dead cell exclusion. The cells were then fixed and permeabilized with a commercial fix/perm buffer (BD Biosciences) and stained with antibodies against intracellular epitopes and stored in PBS containing 1.6% formaldehyde and a 1:4000 dilution of Ir nucleic acid intercalator to label all nucleated cells. Immediately prior to acquisition, the cells were washed in PBS, then in diH20 and resuspended in diH20 containing a 1/10 dilution of EQ 4 Element Calibration beads. After routine instrument tuning and optimization, the samples were acquired on a CyTOF2 Mass Cytometer in sequential 10 minute acquisitions at an acquisition rate of <500 events /s. The resulting FCS files were concatenated and normalized using a bead-based normalization algorithm in the CyTOF acquisition software and uploaded to Cytobank for analysis. FCS files were manually pre-gated on Ir193 DNA+ CD45+ events, excluding dead cells, doublets and DNA-negative debris, and the gated populations were then analyzed using viSNE (Amir el et al., 2013) based on all myeloid phenotypic markers. Putative cell populations on the resulting viSNE map were manually gated based on the expression of canonical markers, while allowing for visualization of additional heterogeneity within and outside of the labeled population bubbles.
Flow Cytometry analysis
Isolated cells were surface stained in FACS buffer (PBS w/o Ca2+ Mg2+ supplemented with 2% heat inactivated FBS and 5mM EDTA) for 20–30 min on ice. Staining for CXCR3 was performed for 30min at room temperature. Multiparameter analysis was performed on a LSR II Fortessa (BD) and analyzed with FlowJo software (Tree Star). Dead cells and doublets were excluded from all analysis. For the detection of cytokines, cells were cultured in media in the presence of Brefeldin A (10µg/ml) for 4h at 37°C. Ex vivo stimulations were carried out in the presence of Brefeldin A, phorbol 12-myristate 13-acetate (PMA) (Sigma) and Ionomycin (Sigma). Cells were fixed post stimulation using Cytofix/Cytoperm buffer (BD). Intracellular staining with anti-IFNγ, anti-IL-17A and anti-IL-22 was performed in FACS buffer containing 0.5% Saponin (Sigma). For the detection of transcription factors, cells were fixed and stained using the Foxp3-staining kit (eBioscience) according to the manufacturer’s instructions.
Detection of bacterial bound IgA
The cecum of mice was isolated, cut open and luminal content was washed out into 25ml of fresh cold PBS. Content was vortexed and filtered 2–3 times through 70µm cell strainer. Flow through was spun for 10min at 4000rpm at 4°C. Colle cted content was resuspended in 5–10ml of PBS and 500µl were stained with anti-IgA antibodies and DAPI. Cecal content from Rag2−/− mice served as a negative control for IgA binding.
Scanning Electron Microscopy
T.mu containing colonic and cecal tissue was fixed in 3% Glutaraldehyde/0.2M Sodium Cacodylate Buffer at pH7.3 for more than one hour. Fixative was washed away using 0.2M Sodium Cacodylate Buffer pH 7.3 for 10 minutes. Tissues were fixed in 1% Osmium Tetraoxide/0.2M Cacodylate Buffer pH 7.3 for one hour. After washing, tissues were dehydrated using increasing concentrations of Ethyl Alcohol (1× 10min 50%, 1× 10min 70%, 1× 10min 95%, 3× 10min 100%). After dehydration, tissues were critical point dried, mounted and sputter coated prior to imaging. Scanning electron pictures were taken on a Hitachi Field Emission S4300 scanning electron microscope.
Giemsa staining
T.mu were triple sorted into PBS and spun onto glass slides. Cells were semi-dried and fixed in cold methanol. Cells were stained with Giemsa (Sigma) according to the manufacturer’s instructions.
Purification of Tritrichomonas musculis (T.mu) from cecal content
The cecal content of T. mu containing mice was harvested into 30ml of sterile PBS and filtered several times through a 70µm cell strainer. The suspension was spun at 1000rpm for 5min at 4°C. The supernatant was discarded and the pellet was washed twice with 30ml PBS. The pellet was resuspended in sterile PBS after the final wash and cells were triple sorted into PBS on a FACS ARIA II using the 70µm nozzle at 70psi at 4°C. Purity was >99%. One to two million collected T. mu were gavaged into mice immediately after the sort.
Culture of Tritrichomonas musculis (T.mu)
Culture of T.musculis was performed as described in Saeki et al.(Saeki et al., 1983). Briefly, cecums of T.mu infected mice were flushed with PBS, passed through the 70 um cell strainers and spun down at 1000 rpm for 5 min. In order to enrich for T.mu containing fraction the 40/80 % percoll gradient centrifugation step was performed at 1000g for 15 minutes with breaks off and the T.mu were collected at the interphase. The interphase containing T.mu was spun down again at 1750 rpm for 10 min and resuspended in T.mu culture medium. T.mu culture medium was prepared as described by Saeki et al with the following modifications. Briefly cecums of mice were harvested and homogenized in PBS with 25 volumes of PBS per corresponding cecum weights. In order to get homogeneous suspension the cecum extract was stirred at 4 °C for 6 hrs and then spun down at 3500rpm for 10 min and the supernatant was filtered. The filtered cecal extract was used to resuspend the TrichoselTM broth (Becton Dickinson) and titrated to pH 7 with NaOH. The medium was then autoclaved prior to be supplemented with 10% heat-inactivated horse serum and with Abx against Gram positive and negative bacteria including vancomycin, gentamicin, streptomycin, penicillin and amphotericin B. 2 × 106 T.mu were inoculated per ml of growth media and cultured under anaerobic conditions for 3 days. After 3 days of cultures, the T.mu containing media was centrifuged at 1750 rpm for 10 min and 2 × 106 T.mu was inoculated per mouse as described above.
Quantification of T.mu colonization efficiency
Cecum of mice colonized with T.mu was excised weighted and cut longitudinally. Cecal content was harvested and resuspended in 10 ml of sterile PBS. Trophozoites were counted using hemocytometer and the numbers of T.mu trophozoites per gram of cecum were measured.
Pathological assessment of intestinal tissue
Cecums and colons were fixed, embedded in paraffin and sections were cut and stained with hematoxylin and eosin (H&E) and Periodic acid-Schiff (PAS) according to standard procedures. Pathological evaluation was performed by a pathologist assessing epithelial thickness, and epithelial integrity, submucosal edema, Goblet cell numbers, presence of polymorphonuclear granulocytes and a pathological score was assigned according to Barthel et al 2003.
Quantitative real-time PCR (Q-PCR)
Conventional reverse transcription, using the Sprint PowerScript reverse transcriptase (Clontech) was performed in accordance with the manufacturers’ instructions. Q-PCR was performed with SYBR GREEN on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). The PCR protocol consisted of one cycle at 95°C (10 min) followed by 40 cycles of 95°C (15 s) and 58°C (1 min). Expressi on of hypoxanthine-guanine phosphoribosyltransferase (Hprt) was used as a standard. The average threshold cycle number (CRtR) for each tested mRNA was used to quantify the relative expression of each gene: 2^-[Ct(gene)-Ct(Hprt)]. Primers are listed below:
Hprt (Fwd)_CCTGGTTCATCATCGCTAATC
Hprt (Rev)_TCCTCCTCAGACCGCTTTT
Tnfa (Fwd) TCTTCTCATTCCTGCTTGTGG
Tnfa (Rev) GGTCTGGGCCATAGAACTGA
Nos2 (Fwd) GGGCTGTCACGGAGATCA
Nos2 (Rev) CCATGATGGTCACATTCTGC
Reg3b (Fwd) CAGACCTGGTTTGATGCAGA
Reg3b (Rev) GAAGCCTCAGCGCTATTGAG
Reg3g (Fwd) ATGGCTCCTATTGCTATGCC
Reg3g (Rev) GATGTCCTGAGGGCCTCTT
ELISA
300–500µl of mouse blood was collected and serum was isolated using Serum/Gel Z/1.1 serum separation tubes (SARSTEDT, Germany) according to the manufacturers protocol. Serum was stored at −80°C. Immunoglobulins were abs orbed on high-bound plates (NUNC) and anti-IgA ELISA was performed using the anti-mouse IgA-HRP antibody (Southern Biotech). 200–300µg of ascending colonic tissue were cultured in 500ul of complete RPMI at 37°C and 5% CO 2. Supernatant was collected 24h later, transferred into sterile tubes and stored at −80°C. Detection of IL-18 from overnight tissue explants was performed using the IL-18 ELISA kit (eBioscience) according to the manufacturers protocol.
MALDI-TOF
T.mu cells were quadrupel sorted into sterile PBS. The cells were pelleted for 3 minutes at 15,000g. PBS was removed and the pellet resuspended in 100µL 70% ethanol. Fixed Trichomonas were pelleted again for 3 minutes at 15,000 g. The 70% ethanol was removed and the pellets were resuspended in 10µL 70% formic acid for lysis followed by the addition of 10µL acetonitrile. The formic acid and acetonitrile mixture was spun for 3 minutes at 15,000g and 1µL of the supernatant was spotted into the MALDI-TOF target plate. After the lysate was dry, 1 µl of α-cyano-4-hydroxycinnamic acid matrix was added on top of each spot. The target was then analyzed with a MALDI TOF BioTyper (Bruker) according to manufacturer’s instructions. Repetitive recordings were collected and these spectra used to create a reference spectrum, which was used for future identification and quality control of the Trichomonas at other time points.
RNAseq analysis of epithelial cells
RNA sequencing was performed on RNA isolated from whole colonic tissues or epithelial cells. Groups of age and gender-matched mice were colonized with purified T.mu and RNA was isolated using Trizol. RNA was purified using phenol/chloroform extraction. Quantification was performed using the Qubit RNA assay kit HS according to the manufacturers protocol. RNA was sequenced at the Broad Technology Services using the High-throughput eukaryote 3’ DGE library. RNA count analysis and visualization was done in R (https://www.R-project.org/). RNA counts were converted to log2-counts per million using the voom package (Law et al., 2014). Differential expression was quantified using the lmFit function in the limma package (Ritchie et al., 2015). Gene sets were downloaded from the MSigDB mouse ortholog website (Subramanian et al., 2005) (http://bioinf.wehi.edu.au/software/MSigDB/) and enrichment was computed using a hypergeometric test. Data was visualized using ggplot2. The reads were quality filtered as follows. First, the bases at the ends of the reads with quality less than 10 were trimmed. If the quality of the leftover part at the 20-th percentile was less than 5 or the length of the leftover part was less than 20 the read was discarded. If one of the paired end reads failed the quality control, the mate was discarded as well. Reads were aligned using STAR (Dobin et al., 2013) to the mouse genome. Counts for reads mapping to each gene were evaluated using the Subread package (Liao et al., 2013).
Phylogenetic and metagenomic sequencing of T.mu
DNA was isolated from FACS-purified protozoa and subjected to ITS PCR-DNA sequence analysis using pan-parabasalid primers anchored in the 18S [AATACGTCCCCTGCCCTTTGT] and 28S [TCCTCCGCTTAATGAGATGC] rDNA gene array that amplify across the polymorphic ITS region. PCR amplification consisted of 35 cycles of 40 sec at 95° C, 40 sec at 58° C, and 40 sec at 72° C. Phylogenetic analysis was inferred using RAxML methodology after alignment to related parabasalid sequences downloaded from GenBank. The sequence deposited in GenBank has accession number (T.musculis_18S.sqn Tritrichomonas KX000921 and T.musculis_ITS.sqn Tritrichomonas KX000922).Branching support was assessed using ML bootstrap analysis (1000 replications). Major groups are bracketed and labeled. The sequence placed the rodent parabasalid, which we hereafter refer to as T. musculis (T.mu), as distinct and sister to a clade comprising the Tritrichomonadidae that shared 95% identity with T. muris. T.mu was FACS-sorted and pulled from five in-house mice naturally colonized with T.mu. DNA was extracted using the Qiagen stool extraction kit according to manufacturer specifications. A paired-end TrueSeq nano DNA sequencing library (Illumina, Cat. No. 15041110) with an average insert size of 550 bp was prepared using 200 ng of input T.mu genomic DNA and run on an Illumina Mi-Seq platform. 35.61 million reads passed filtering T.mu sequences for the following genes alpha-Tubulin, EF1-alpha, GAPDH, and MDH were pulled from the metagenomic data for phylogenetic discrimination of T.mu from other enteric parabasailds as follows: reference sequences from the related parabasalids T. foetus and T.vaginalis for the 4 marker genes were downloaded from NCBI. BWA (v0.7.5a) was used to map reads against these 4 sequences. GATK (v3.5) in conjunction with Picard (v1.131) were used to select only high quality reads (average read depth for single copy loci was 20X) to produce a consensus sequence. No heterozygous SNP positions were identified in the regions mapped. Sequences were deposited in GenBank, with the following Accession IDs: KX492911, 12, 13, 14.
Salmonella Infection
Groups of age and gender matched C57BL/6 mice were either left untreated or were orally gavaged with 2×106 purified T.mu. 14 days after treatment mice were orally gavaged with Streptomycin and infected with Salmonella typhimurium as previously described (Barthel et al., 2003), Infection and Immunity. Colony-forming units of S typhimurium in fecal pellets, the cecum, the spleen and the mesenteric lymph nodes were measured on MacConkey agar plates containing Streptomycin 48h after infection. Cecal weight was recorded and caeca were fixed, embedded in paraffin and sections were cut and stained with hematoxylin and eosin (H&E) according to standard procedures. Pathological evaluation was performed by a pathologist in a blinded manner and scored as previously described (Barthel et al., 2003). For neutralization of IL-18, groups of Trichomonas infected mice were injected 3 times with 200µg of neutralizing anti-IL-18 antibody (YIGIF74-1G7, Bioxcell) prior to infection with Salmonella.
T cell transfer colitis
Groups of age and gender matched SPF or GF Rag2−/− mice were either gavaged with PBS or 1–2×106 highly purified T.mu. Conventionalized GF Rag2−/− mice were colonized with SPF Rag2−/− flora through fecal transplantation 4 weeks prior to gavage with PBS or T. musculis. Two weeks after gavage, 0.75–1×106 highly purified CD4+ CD45RBhi T cells were injected i.p. into mice. To purify CD45RBhi T cells spleens and lymph nodes of 6–8 week old mice were isolated and organs were mashed through a 70µm cell strainer. Leukocytes were obtained through red cell lysis and stained with biotinylated anti-CD4 antibodies followed by incubation with magnetic anti-biotin beads. The enriched lymphocyte fraction was stained with DAPI, anti-TCRb, anti-CD4, anti-CD45RB and anti-CD25 antibodies. TCRb+ CD4+ CD45RBhi CD25−cells were sorted on a BD FACS ARIA II into complete RPMI media containing 10% (heat inactivated) FBS. 0.75–1×106 T cells were injected i.p. into Rag2−/− mice.
Weight loss was monitored weekly and pathological evaluation of colons was performed as endpoint analysis on H&E stained sections of paraffin-embedded colons. Pathological scores were assessed by experimental pathologist in a blind fashion and calculated based on the previously established scoring method (Asseman et al., 1999).
Colorectal cancer model Apc+/min
Groups of 4-week-old Apc+/min mice were left untreated or were orally gavaged with 2×106 purified T.mu. 3–4 months later, mice were analyzed and tumor burden and tumor size were measured.
Immunofluorescence analysis
TUNEL staining was performed using the TUNEL staining kit (Roche) according to the manufacturer’s protocol. Ki67 staining was performed using anti-Ki67 antibody (clone: VPRMO4 Vector Lab) on paraffin-embedded sections. Antigen retrieval was performed in Demasking Solution at 800W for 15min (Vector Lab H-3300).
QUANTIFICATION AND STATISTICAL ANALYSIS
In each experiment, multiple mice were analyzed as biological replicates as indicated in all the figures. Graphs show mean ± SEM. Student’s t test or ONE-way ANOVA Bonferroni’s Multiple Comparison Test was used to determine significance. * p < 0.05, ** p < 0.01, *** p < 0.001.
DATA AND SOFTWARE AVAILABILITY
Data Resources
The accession number for the sequencing data reported in this paper is GSE8611.
The T.mu sequences have been deposited to the GenBank. The accession number for the T.mu sequences are as follows; T.musculis_18S.sqn Tritrichomonas KX000921, T.musculis_ITS.sqn Tritrichomonas KX000922, T.musculis a-tubulin, KX492911; T.musculis EF1a, KX492912; T.musculis GAPDH, KX492913; T.musculis, MDH, KX492914.
Supplementary Material
Methods and Resources
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse Ly6G-141Pr | Biolegend | RRID:AB_1089179 |
| Anti-mouse CD11c-142Nd | Fluidigm/DVS Sciences | Cat#:3142003C |
| Anti-mouse TCRb-143Nd | Fluidigm/DVS Sciences | Cat#:3143010B |
| Anti-mouse CD16/32-144Nd | Fluidigm/DVS Sciences | Cat#:3144009B |
| Anti-mouse CD8a-146Nd | Fluidigm/DVS Sciences | Cat#:3146003B |
| Anti-mouse CD45-147Sm | Fluidigm/DVS Sciences | Cat#:3147003B |
| Anti-mouse CD11b-148Nd | Fluidigm/DVS Sciences | Cat#:3148003B |
| Anti-mouse CD19-149Sm | Fluidigm/DVS Sciences | Cat#:3149002B |
| Anti-mouse IgM-151Eu | Fluidigm/DVS Sciences | Cat#:3151006B |
| Anti-mouse SiglecF-152Sm | eBioscience | RRID:AB_2572866 |
| Anti-mouse NKP46-153Eu | Fluidigm/DVS Sciences | Cat#:3153006B |
| Anti-mouse CD64-156Gd | Biolegend | RRID:AB_314486 |
| Anti-mouse FoxP3-158Gd | Fluidigm/DVS Sciences | Cat#:3158003A |
| Anti-mouse F4/80-159Tb | Fluidigm/DVS Sciences | Cat#:3159009B |
| Anti-mouse CD62L-160Gd | Fluidigm/DVS Sciences | Cat#:3160008B |
| Anti-human/mouse Tbet-161Dy | Biolegend | Cat#:644802 |
| Anti-mouse Ly6C-162Dy | Biolegend | Cat#:128002 |
| Anti-mouse RORgt-163Dy | eBioscience | RRID:AB_925759 |
| Anti-mouse CD103-164Dy | Biolegend | RRID:AB_535944 |
| Anti-mouse Gata3-167Er | Fluidigm/DVS Sciences | Cat#:3167007A |
| Anti-mouse ST2-168Er | Biolegend | RRID:AB_2561843 |
| Anti-mouse NK1.1-170Er | Fluidigm/DVS Sciences | Cat#:3170002B |
| Anti-human/mouse CD44-171Yb | Fluidigm/DVS Sciences | Cat#:3171003B |
| Anti-mouse CD4-172Yb | Fluidigm/DVS Sciences | Cat#:3145002B |
| Anti-mouse I-A/I-E-174Yb | Fluidigm/DVS Sciences | Cat#:3174003B |
| Anti-mouse CD127-175Lu | Fluidigm/DVS Sciences | Cat#:3175006B |
| Anti-mouse CD45R/B220-176Yb | Fluidigm/DVS Sciences | Cat#:3160012B |
| CD3e clone 145-2C11 | eBioscience | Cat#:45-0031-82 |
| CD4 clone GK1.5 | eBioscience | Cat#:25-0041-82 |
| CD11b clone M1/70 | eBioscience | Cat#:45-0112-82 |
| CD11c clone N418 | eBioscience | Cat#:25-0114-82 |
| CD45 clone 30F11 CD45.2 clone 104 | eBioscience eBioscience | Cat#:47-0451-82 Cat#:47-0454-82 |
| CD45RB clone C363.16A | eBioscience | Cat#:17-0455-81 |
| CXCR3 clone CXCR3-173 | Biolegend | Cat#:126514 |
| CD44 clone IM7 | eBioscience | Cat#:25-0441-82 |
| CD62L clone MEL-14 | Biolegend | Cat#:104406 |
| Ly6C clone AL-21 | BD | Cat#:553104 |
| B220 clone RA3-6B2 | eBioscience | Cat#:45-0452-82 |
| ICOS clone C398.4A | Biolegend | Cat#:313514 |
| KLRG1 clone 2F1/KLRG1 | Biolegend | Cat#:138410 |
| RORγt clone B2D | eBioscience | Cat#:14-6981-82 |
| IgA clone S107 | SouthernBiotech | Cat#:1040-02 |
| CD64 clone X54-5/7.1 | Biolegend | Cat#:139306 |
| CD103 clone 2E7 | eBioscience | Cat#:12-1031-83 |
| F4/80 clone BM8 I-A/I-E clone M5/114.15.2 | Biolegend eBioscience | Cat#:123120 Cat#:48-5321-82 |
| IFNγ clone XMG1.2 | eBioscience | Cat#:12-7311-82 |
| IL-17A eBio17B7 | eBioscience | Cat#:17-7177-81 |
| IL-22 clone IL22JOP | eBioscience | Cat#:17-7222-80 |
| Ki67 clone SolA15 | eBioscience | Cat#:12-5698-82 |
| GM-CSF clone MP1-22E9 | eBioscience | Cat#:12-7331-82 |
| IL-5 clone TRFK5 | eBioscience | Cat#:BMS179 |
| IL-4 clone 11B11 | eBioscience | Cat#:12-7041-81 |
| IL-13 clone eBio1316H | eBioscience | Cat#:25-7133-82 |
| CD3e clone 145-2C11 | eBioscience | Cat#:45-0031-82 |
| CD4 clone GK1.5 | eBioscience | Cat#:25-0041-82 |
| CD11b clone M1/70 | eBioscience | Cat#:45-0112-82 |
| CD11c clone N418 | eBioscience | Cat#:25-0114-82 |
| CD45 clone 30F11 | eBioscience | Cat#:47-0451-82 |
| CD45.2 clone 104 CD45RB clone C363.16A | eBioscience eBioscience | Cat#:47-0454-82 Cat#:17-0455-81 |
| CXCR3 clone CXCR3-173 | Biolegend | Cat#:126514 |
| CD44 clone IM7 | eBioscience | Cat#:25-0441-82 |
| CD62L clone MEL-14 | Biolegend | Cat#:104406 |
| Ly6C clone AL-21 | BD | Cat#:553104 |
| B220 clone RA3-6B2 | eBioscience | Cat#:45-0452-82 |
| ICOS clone C398.4A | Biolegend | Cat#:313514 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Brefeldin A | SIGMA | Cat#:B7651 |
| Phorbol 12-myristate 13-acetate | SIGMA | Cat#:79346 |
| Ionomycin | SIGMA | Cat#:I0634 |
| TRizol-reagent | Ambion | Cat#:15596026 |
| Formic Acid | SIGMA | Cat#:94318-250ML-F |
| Acetonitrile | SIGMA | Cat#:34967-250ML |
| HCCA | Bruker | Cat#:255344 |
| Critical Commercial Assays | ||
| Foxp3 / Transcription Factor Fixation/Permeabilization Concentrate and Diluent |
eBioscience | Cat#:00-5521-00 |
| Foxp3 / Transcription Factor Staining Buffer Set |
eBioscience | Cat#:00-5523-00 |
| Fixation/Permeabilization Concentrate |
eBioscience | Cat#:00-5123 |
| Permeabilization Buffer | eBioscience | Cat#:00-8333 |
| QIAquick 96 PCR Purification Kit | Qiagen | Cat#:28181 |
| Deposited Data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| human reference genome NCBI build 37, GRCh37 |
Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Experimental Models: Cell Lines | ||
| n.a. | ||
| Experimental Models: Organisms/Strains | ||
| Salmonella enterica serovar typhimurium |
ATCC | Stock#:14028 |
| B6.129P2(SJL)-Myd88tm1.1Defr/J (Myd88flox/flox) |
Jackson Laboratory | Stock#:006148 |
| B6.129P2-Lyz2tm1(cre)Ifo/J (LysMCre) | Jackson Laboratory | Stock#:004781 |
| B6.Cg-Tg(Vil-cre) (VillinCre) | Jackson Laboratory | Stock#:021504 |
| B6.129S4-Ccr2tm1Ifc/J (Ccr2−/−) | Jackson Laboratory | Stock#:004999 |
| B6.129P2(C)-Ccr7tm1Rfor/J (Ccr7−/−) | Jackson Laboratory | Stock#:006621 |
| C57BL/6J–ApcMin/J (Apc+/Min) | Jackson Laboratory | Stock#:002020 |
| B6.129S1-Irf4tm1Rdf/J (Irf4flox/flox) | Jackson Laboratory | Stock#:009380 |
| B6(Cg)-Irf8tm1.1Hm/J (Irf8flox/flox) | Jackson Laboratory | Stock#:014175 |
| B6.129S2-Ifnar1tm1Agt/Mmjax (Ifnar−/−) | Jackson Laboratory | Stock#:32045 |
| 129S–Batf3tm1Kmm/J (Batf3−/−) | Jackson Laboratory | Stock#:013755 |
| NOD.Cg-Tg(Itgax-cre)1-1Reiz/PesaJ (CD11cCre) |
Jackson Laboratory | Stock#:008068 |
| B6.129S1-Tlr5tm1Flv/J (Tlr5−/−) | Jackson Laboratory | Stock#:008377 |
| B6.129S7-Il1r1-tm1lmx/J (Il1r1−/−) | Jackson Laboratory | Stock#:003245 |
| B6.129P2-Il18r1-tm1Aki/J (Il18−/−) | Jackson Laboratory | Stock#:004130 |
| B6.129S6-Rag2tm1FwaN12 (Rag2−/−) | Taconic | Stock#:RAGN12 |
| Asc−/− | Millenium Inc. | n.a. |
| Recombinant DNA | ||
| n.a. | ||
| Sequence-Based Reagents | ||
|
Hprt (Fwd)_CCTGGTTCATCATCGCTA ATC |
Sigma | n.a. |
|
Hprt (Rev)_TCCTCCTCAGACCGCTTTT |
Sigma | n.a. |
|
Tnfa (Fwd) TCTTCTCATTCCTGCTTGTGG |
Sigma | n.a. |
|
Tnfa (Rev) GGTCTGGGCCATAGAACTGA |
Sigma | n.a. |
|
Nos2 (Fwd) GGGCTGTCACGGAGATCA |
Sigma | n.a. |
|
Nos2 (Rev) CCATGATGGTCACATTCTGC |
Sigma | n.a. |
|
Reg3b (Fwd) CAGACCTGGTTTGATGCAGA |
Sigma | n.a. |
|
Reg3b (Rev) GAAGCCTCAGCGCTATTGAG |
Sigma | n.a. |
|
Reg3g (Fwd) ATGGCTCCTATTGCTATGCC |
Sigma | n.a. |
|
Reg3g (Rev) GATGTCCTGAGGGCCTCTT |
Sigma | n.a. |
| Software and Algorithms | ||
| R | R Development Core Team (2008). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07- 0 |
http://www.R-project.org |
| limma |
Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K. (2015). limma powers differential expression analyses for RNA- sequencing and microarray studies. Nucleic Acids Research 43(7), e47. |
https://bioconductor.org/packages/release/bioc/html/limma.html |
| ggplot2 | H. Wickham. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York, 2009. |
http://ggplot2.org/ |
Acknowledgments
We thank the Merad laboratory for helpful discussions and input. We would like to thank Fiona Desland for critical review of the manuscript. We would like to thank Jordi Ochando and the Flow Cytometry facility for their excellent technical support and assistance with cell sorting. We would like to thank Steve Porcella (Genomics Unit, RTB, Rocky Mountain Labs, NIAID), Mariam Quinones (Bioinformatics and Computational Biology Branch, NIAID) and Jacquice Davis (NIAID Microbiome Program) for their assistance with metagenomic and 16S sequencing and analysis. This study used the Nephele platform from the NIAID Office of Cyber Infrastructure and Computational Biology (OCICB) in Bethesda, MD. M.M. is funded by NIH grants R01 CA154947A, R01 CA173861 and U01 AI095611. This work was supported in part by the National Institute of Allergy and Infectious Diseases, National Institutes of Health (Y.B. and M.E.G.). M.E.G. Is a Scholar of the Canadian Institute for Advanced Research (CIFAR) Integrated Microbial Biodiversity Program
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Authors Contribution
A.C., A.M., V.K. designed and analyzed the experiments and wrote the manuscript. A.K., J.D.R., A.R., R.R., I.M., R.N. performed experiments and analyzed data. E.D.A. and A.S. analyzed the RNAseq data. S.G., B.G., J.C. and J.F. provided intellectual expertise. Y.B. designed and funded experiments. M.E.G. designed and funded experiments and contributed to writing the manuscript. M.M designed and funded the study and wrote the manuscript .
REFERENCES
- Amir el AD, Davis KL, Tadmor MD, Simonds EF, Levine JH, Bendall SC, Shenfeld DK, Krishnaswamy S, Nolan GP, Pe’er D. viSNE enables visualization of high dimensional single-cell data and reveals phenotypic heterogeneity of leukemia. Nat Biotechnol. 2013;31:545–552. doi: 10.1038/nbt.2594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Asseman C, Mauze S, Leach MW, Coffman RL, Powrie F. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. J Exp Med. 1999;190:995–1004. doi: 10.1084/jem.190.7.995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barratt JL, Harkness J, Marriott D, Ellis JT, Stark D. The ambiguous life of Dientamoeba fragilis: the need to investigate current hypotheses on transmission. Parasitology. 2011;138:557–572. doi: 10.1017/S0031182010001733. [DOI] [PubMed] [Google Scholar]
- Barthel M, Hapfelmeier S, Quintanilla-Martinez L, Kremer M, Rohde M, Hogardt M, Pfeffer K, Russmann H, Hardt WD. Pretreatment of mice with streptomycin provides a Salmonella enterica serovar Typhimurium colitis model that allows analysis of both pathogen and host. Infect Immun. 2003;71:2839–2858. doi: 10.1128/IAI.71.5.2839-2858.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bogunovic M, Ginhoux F, Helft J, Shang L, Hashimoto D, Greter M, Liu K, Jakubzick C, Ingersoll MA, Leboeuf M, et al. Origin of the lamina propria dendritic cell network. Immunity. 2009;31:513–525. doi: 10.1016/j.immuni.2009.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bogunovic M, Mortha A, Muller PA, Merad M. Mononuclear phagocyte diversity in the intestine. Immunol Res. 2012 doi: 10.1007/s12026-012-8323-5. [DOI] [PubMed] [Google Scholar]
- Boraschi D, Dinarello CA. IL-18 in autoimmunity: review. Eur Cytokine Netw. 2006;17:224–252. [PubMed] [Google Scholar]
- Diamond LS. Axenic Cultivation of Trichomonas tenax, the Oral Flagellate of Man. Journal of Eukaryotic Microbiology. 1962;9:442–444. doi: 10.1111/j.1550-7408.1962.tb02650.x. [DOI] [PubMed] [Google Scholar]
- Dinarello CA, Novick D, Kim S, Kaplanski G. Interleukin-18 and IL-18 binding protein. Front Immunol. 2013;4:289. doi: 10.3389/fimmu.2013.00289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Edelson BT, Kc W, Juang R, Kohyama M, Benoit LA, Klekotka PA, Moon C, Albring JC, Ise W, Michael DG, et al. Peripheral CD103+ dendritic cells form a unified subset developmentally related to CD8alpha+ conventional dendritic cells. J Exp Med. 2010;207:823–836. doi: 10.1084/jem.20091627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng T, Wang L, Schoeb TR, Elson CO, Cong Y. Microbiota innate stimulation is a prerequisite for T cell spontaneous proliferation and induction of experimental colitis. J Exp Med. 2010;207:1321–1332. doi: 10.1084/jem.20092253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Forster R, Schubel A, Breitfeld D, Kremmer E, Renner-Muller I, Wolf E, Lipp M. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell. 1999;99:23–33. doi: 10.1016/s0092-8674(00)80059-8. [DOI] [PubMed] [Google Scholar]
- Gao Y, Nish SA, Jiang R, Hou L, Licona-Limon P, Weinstein JS, Zhao H, Medzhitov R. Control of T helper 2 responses by transcription factor IRF4-dependent dendritic cells. Immunity. 2013;39:722–732. doi: 10.1016/j.immuni.2013.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grivennikov SI, Wang K, Mucida D, Stewart CA, Schnabl B, Jauch D, Taniguchi K, Yu GY, Osterreicher CH, Hung KE, et al. Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth. Nature. 2012;491:254–258. doi: 10.1038/nature11465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu Y, Kuida K, Tsutsui H, Ku G, Hsiao K, Fleming MA, Hayashi N, Higashino K, Okamura H, Nakanishi K, et al. Activation of interferon-gamma inducing factor mediated by interleukin-1beta converting enzyme. Science. 1997;275:206–209. doi: 10.1126/science.275.5297.206. [DOI] [PubMed] [Google Scholar]
- Helft J, Ginhoux F, Bogunovic M, Merad M. Origin and functional heterogeneity of non-lymphoid tissue dendritic cells in mice. Immunol Rev. 2010;234:55–75. doi: 10.1111/j.0105-2896.2009.00885.x. [DOI] [PubMed] [Google Scholar]
- Heyer J, Yang K, Lipkin M, Edelmann W, Kucherlapati R. Mouse models for colorectal cancer. Oncogene. 1999;18:5325–5333. doi: 10.1038/sj.onc.1203036. [DOI] [PubMed] [Google Scholar]
- Hongoh Y, Sharma VK, Prakash T, Noda S, Taylor TD, Kudo T, Sakaki Y, Toyoda A, Hattori M, Ohkuma M. Complete genome of the uncultured Termite Group 1 bacteria in a single host protist cell. Proc Natl Acad Sci U S A. 2008;105:5555–5560. doi: 10.1073/pnas.0801389105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Howitt MR, Lavoie S, Michaud M, Blum AM, Tran SV, Weinstock JV, Gallini CA, Redding K, Margolskee RF, Osborne LC, et al. Tuft cells, taste-chemosensory cells, orchestrate parasite type 2 immunity in the gut. Science. 2016;351:1329–1333. doi: 10.1126/science.aaf1648. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iwasaki A. Mucosal dendritic cells. Annu Rev Immunol. 2007;25:381–418. doi: 10.1146/annurev.immunol.25.022106.141634. [DOI] [PubMed] [Google Scholar]
- Jang MH, Sougawa N, Tanaka T, Hirata T, Hiroi T, Tohya K, Guo Z, Umemoto E, Ebisuno Y, Yang BG, et al. CCR7 is critically important for migration of dendritic cells in intestinal lamina propria to mesenteric lymph nodes. J Immunol. 2006;176:803–810. doi: 10.4049/jimmunol.176.2.803. [DOI] [PubMed] [Google Scholar]
- Kirchberger S, Royston DJ, Boulard O, Thornton E, Franchini F, Szabady RL, Harrison O, Powrie F. Innate lymphoid cells sustain colon cancer through production of interleukin-22 in a mouse model. J Exp Med. 2013;210:917–931. doi: 10.1084/jem.20122308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow SO, Sur D, Breiman RF, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013;382:209–222. doi: 10.1016/S0140-6736(13)60844-2. [DOI] [PubMed] [Google Scholar]
- Law CW, Chen Y, Shi W, Smyth GK. voom: Precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 2014;15:R29. doi: 10.1186/gb-2014-15-2-r29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liao Y, Smyth GK, Shi W. The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res. 2013;41:e108. doi: 10.1093/nar/gkt214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lukes J, Stensvold CR, Jirku-Pomajbikova K, Wegener Parfrey L. Are Human Intestinal Eukaryotes Beneficial or Commensals? PLoS Pathog. 2015;11:e1005039. doi: 10.1371/journal.ppat.1005039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Molloy MJ, Grainger JR, Bouladoux N, Hand TW, Koo LY, Naik S, Quinones M, Dzutsev AK, Gao JL, Trinchieri G, et al. Intraluminal containment of commensal outgrowth in the gut during infection-induced dysbiosis. Cell Host Microbe. 2013;14:318–328. doi: 10.1016/j.chom.2013.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moonah SN, Jiang NM, Petri WA., Jr Host immune response to intestinal amebiasis. PLoS Pathog. 2013;9:e1003489. doi: 10.1371/journal.ppat.1003489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Murphy KM. Transcriptional control of dendritic cell development. Adv Immunol. 2013;120:239–267. doi: 10.1016/B978-0-12-417028-5.00009-0. [DOI] [PubMed] [Google Scholar]
- Noda S, Hongoh Y, Sato T, Ohkuma M. Complex coevolutionary history of symbiotic Bacteroidales bacteria of various protists in the gut of termites. BMC Evol Biol. 2009;9:158. doi: 10.1186/1471-2148-9-158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Persson EK, Uronen-Hansson H, Semmrich M, Rivollier A, Hagerbrand K, Marsal J, Gudjonsson S, Hakansson U, Reizis B, Kotarsky K, Agace WW. IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation. Immunity. 2013;38:958–969. doi: 10.1016/j.immuni.2013.03.009. [DOI] [PubMed] [Google Scholar]
- Petersen AM, Stensvold CR, Mirsepasi H, Engberg J, Friis-Moller A, Porsbo LJ, Hammerum AM, Nordgaard-Lassen I, Nielsen HV, Krogfelt KA. Active ulcerative colitis associated with low prevalence of Blastocystis and Dientamoeba fragilis infection. Scand J Gastroenterol. 2013;48:638–639. doi: 10.3109/00365521.2013.780094. [DOI] [PubMed] [Google Scholar]
- Popivanova BK, Kitamura K, Wu Y, Kondo T, Kagaya T, Kaneko S, Oshima M, Fujii C, Mukaida N. Blocking TNF-alpha in mice reduces colorectal carcinogenesis associated with chronic colitis. J Clin Invest. 2008;118:560–570. doi: 10.1172/JCI32453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Read S, Powrie F. Induction of inflammatory bowel disease in immunodeficient mice by depletion of regulatory T cells. Curr Protoc Immunol. 2001 doi: 10.1002/0471142735.im1513s30. Chapter 15 Unit 15 13. [DOI] [PubMed] [Google Scholar]
- Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47. doi: 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saeki H, Togo M, Imai S, Ishii T. A new method for the serial cultivation of Tritrichomonas muris. Nihon Juigaku Zasshi. 1983;45:151–156. doi: 10.1292/jvms1939.45.151. [DOI] [PubMed] [Google Scholar]
- Schlitzer A, McGovern N, Teo P, Zelante T, Atarashi K, Low D, Ho AW, See P, Shin A, Wasan PS, et al. IRF4 transcription factor-dependent CD11b+ dendritic cells in human and mouse control mucosal IL-17 cytokine responses. Immunity. 2013;38:970–983. doi: 10.1016/j.immuni.2013.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schroder K, Tschopp J. The inflammasomes. Cell. 2010;140:821–832. doi: 10.1016/j.cell.2010.01.040. [DOI] [PubMed] [Google Scholar]
- Serbina NV, Pamer EG. Monocyte emigration from bone marrow during bacterial infection requires signals mediated by chemokine receptor CCR2. Nat Immunol. 2006;7:311–317. doi: 10.1038/ni1309. [DOI] [PubMed] [Google Scholar]
- Shaked H, Hofseth LJ, Chumanevich A, Chumanevich AA, Wang J, Wang Y, Taniguchi K, Guma M, Shenouda S, Clevers H, et al. Chronic epithelial NF-kappaB activation accelerates APC loss and intestinal tumor initiation through iNOS up-regulation. Proc Natl Acad Sci U S A. 2012;109:14007–14012. doi: 10.1073/pnas.1211509109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sims JE, Smith DE. The IL-1 family: regulators of immunity. Nat Rev Immunol. 2010;10:89–102. doi: 10.1038/nri2691. [DOI] [PubMed] [Google Scholar]
- Spits H, Artis D, Colonna M, Diefenbach A, Di Santo JP, Eberl G, Koyasu S, Locksley RM, McKenzie AN, Mebius RE, et al. Innate lymphoid cells - a proposal for uniform nomenclature. Nat Rev Immunol. 2013;13:145–149. doi: 10.1038/nri3365. [DOI] [PubMed] [Google Scholar]
- Stark D, van Hal S, Marriott D, Ellis J, Harkness J. Irritable bowel syndrome: a review on the role of intestinal protozoa and the importance of their detection and diagnosis. Int J Parasitol. 2007;37:11–20. doi: 10.1016/j.ijpara.2006.09.009. [DOI] [PubMed] [Google Scholar]
- Stentiford GD, Becnel JJ, Weiss LM, Keeling PJ, Didier ES, Williams BA, Bjornson S, Kent ML, Freeman MA, Brown MJ, et al. Microsporidia-Emergent Pathogens in the Global Food Chain. Trends in Parasitology. 2016;32:336–348. doi: 10.1016/j.pt.2015.12.004. April 2, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Treuting PM, Clifford CB, Sellers RS, Brayton CF. Of mice and microflora: considerations for genetically engineered mice. Vet Pathol. 2012;49:44–63. doi: 10.1177/0300985811431446. [DOI] [PubMed] [Google Scholar]
- Trinchieri G. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol. 2003;3:133–146. doi: 10.1038/nri1001. [DOI] [PubMed] [Google Scholar]
- Tussiwand R, Everts B, Grajales-Reyes GE, Kretzer NM, Iwata A, Bagaitkar J, Wu X, Wong R, Anderson DA, Murphy TL, et al. Klf4 expression in conventional dendritic cells is required for T helper 2 cell responses. Immunity. 2015;42:916–928. doi: 10.1016/j.immuni.2015.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Varol C, Vallon-Eberhard A, Elinav E, Aychek T, Shapira Y, Luche H, Fehling HJ, Hardt WD, Shakhar G, Jung S. Intestinal lamina propria dendritic cell subsets have different origin and functions. Immunity. 2009;31:502–512. doi: 10.1016/j.immuni.2009.06.025. [DOI] [PubMed] [Google Scholar]
- Vonarbourg C, Mortha A, Bui VL, Hernandez PP, Kiss EA, Hoyler T, Flach M, Bengsch B, Thimme R, Holscher C, et al. Regulated expression of nuclear receptor RORgammat confers distinct functional fates to NK cell receptor-expressing RORgammat(+) innate lymphocytes. Immunity. 2010;33:736–751. doi: 10.1016/j.immuni.2010.10.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zitvogel L, Kepp O, Galluzzi L, Kroemer G. Inflammasomes in carcinogenesis and anticancer immune responses. Nat Immunol. 2012;13:343–351. doi: 10.1038/ni.2224. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







