ABSTRACT.
Considering the potential risks associated with occult hepatitis B virus (HBV) infection, this study was designed to investigate the magnitude and genotypic pattern of occult HBV infection among hemodialysis patients. All patients on regular hemodialysis attending the dialysis centers located in southern Iran and 277 nonhemodialysis controls were invited to participate in this study. Serum samples were tested for detection of hepatitis B core antibody (HBcAb) and hepatitis B surface antigen (HBsAg) by competitive enzyme immunoassay and sandwich ELISA, respectively. The molecular evaluation of HBV infection was conducted by two nested polymerase chain reaction (PCR) assays, targeting S, X, and precore regions of HBV genome, and sequencing by Sanger dideoxy sequencing technology. Moreover, HBV viremic samples were tested for hepatitis C virus (HCV) coinfection by HCV Ab ELISA and seminested reverse transcriptase PCR. Of 279 hemodialysis patients, five (1.8%) were positive for HBsAg, 66 (23.7%) were positive for HBcAb, and 32 (11.5%) had HBV viremia with HBV genotype D, sub-genotype D3 and subtype ayw2. Moreover, 90.6% of the hemodialysis patients with HBV viremia had occult HBV infection. Hemodialysis patients (11.5%) had significantly higher prevalence of HBV viremia than nonhemodialysis controls (1.08%; P = 0.0001). The prevalence of HBV viremia among hemodialysis patients was not statistically associated with duration of hemodialysis, age and gender distribution. In contrast, HBV viremia was significantly associated with place of residency and ethnicity, with residents of Dashtestan and Arab having had significantly higher prevalence of HBV viremia compared with the residents of other cities and Fars patients. Notably, 27.6% and 6.9% of hemodialysis patients infected with occult HBV infection were also positive for anti-HCV antibodies and HCV viremia, respectively. High prevalence of occult HBV infection was detected in hemodialysis patients, whereas 62% of patients with occult HBV infection were negative for HBcAb. Therefore, screening of all hemodialysis patients by sensitive molecular tests, regardless of the pattern of HBV serological markers, is recommended to increase the diagnosis rate of HBV infection.
INTRODUCTION
Occult hepatitis B virus (HBV) infection (OBI) is defined as the presence of low levels of HBV DNA (< 200 IU/mL) in serum and hepatocytes of HBV surface antigen (HBsAg)-negative individuals. These patients might be positive or negative for the serological markers of previous infection.1–3 Occult HBV infection usually occurs after acute self-limited or chronic hepatitis B in which HBsAg is absent or undetectable due to suppression of viral replication and HBsAg expression under the host immune responses or mutations in the S region of the genome and the production of the modified HBsAg that is unrecognizable by routinely used HBsAg detection assays.4 In addition to the host and viral factors, hepatitis C virus (HCV) coinfection might have a role in the development of occult HBV infection through inhibition of HBV replication and HBsAg expression.5
Occult HBV infection has potential risks of transmission, reactivation, and liver disease progression among hemodialysis patients.4,5 Due to immunosuppressed state, shared dialysis machines, exposure to invasive procedures, frequent transfusion requirements, and a low response to HBV vaccination, patients on regular hemodialysis are at increased risk of HBV transmission.1,4 Occult HBV infection might reactivate after renal transplantation or other immunosuppressive conditions such as HIV infection or chemotherapy.4,6 Occult HBV infection reactivation might also occur in HCV-coinfected patients receiving direct-acting antivirals.1 Occult HBV infection can progress to liver fibrosis, cirrhosis, and hepatocellular carcinoma due to persistent necrotic inflammation of the liver and the oncogenicity effects of HBV.2,7 Moreover, it can cause a poor response to antivirals.5
The prevalence of HBV and HCV infection in Iran has been reported to be 3% and 0.3% among the general population, respectively.8,9 The national HBV vaccination program of infants since 1993 and high-risk groups since 2006 in Iran has had a significant role in decreasing the burden of HBV infection in the country.10 The global prevalence of occult HBV infection among hemodialysis patients varies considerably from 0% to 58%,1 depending on the endemicity of HBV infection in different geographic regions and the sensitivity of the assays used for detection in different studies.4,6 The prevalence of occult HBV infection in different populations and regions of Iran is quite variable, ranging from 0% to 63%.2 According to a recent meta-analysis study, the overall prevalence of occult HBV infection among hemodialysis patients in Iran is 2.49%.2 The diagnosis of occult HBV infection and the evaluation of the prevalence rate in hemodialysis patients are important to prevent the potential risks associated with occult HBV infection. Nevertheless, there is no report on the magnitude of occult HBV infection among hemodialysis patients in the South of Iran. Therefore, this study was designed to evaluate the prevalence rate and the genotypic pattern of occult HBV infection among patients on regular hemodialysis in this region.
MATERIALS AND METHODS
Sample collection.
All patients on regular hemodialysis attending the hemodialysis centers located in southern Iran were invited to participate in this study. A total of 279 hemodialysis patients (128 females and 151 males) from dialysis centers in Genaveh, Dashtestan, and Bushehr cities were enrolled in this study. The mean age ± SD of hemodialysis patients was 59.92 ± 14.27 years with a range of 21 to 87 years. Moreover, 277 volunteers, who were matched with the hemodialysis patients in age (± 3 years), date of participation, and sex, were included in the study as a control group. The mean age ± SD of the controls, including 173 males and 104 females, was 45.58 ± 8.33 years with a range of 20 to 93 years. The controls were recruited from outpatient subjects attending the laboratories of these centers for blood tests and did not have a history of blood transfusion or hemodialysis. All participants were requested to give written informed consent to use their leftover serum samples for HBV detection and analysis. The sociodemographic characteristics such as age, gender, place of residence, ethnicity, education level, history of HBV vaccination, duration of hemodialysis, and liver enzyme levels were collected by interview using a questionnaire and from the medical records of the participants at the hemodialysis centers. This study was funded by the Deputy Research and Affairs of the Bushehr University of Medical Sciences with grant number 3224 and was approved by the Ethics Committee of the University with research project number IR.BPUMS.REC.1395.181.
Laboratory methods.
Serum samples of all participants were tested for the presence of hepatitis B core antibody (HBcAb) and hepatitis B surface antigen (HBsAg) using HBcAb and HBsAg one—Version ULTRA ELISA kits (DIA.PRO, Milan, Italy) manually according to the manufacturer’s instructions. The sensitivity and specificity of these kits were 100%. Furthermore, all serum samples were tested for the presence of HBV viremia by two nested polymerase chain reaction (PCR) assays, targeting the S, X, and precore regions of the HBV genome. Briefly, the High Pure Viral Nucleic Acid kit (Roche, Mannheim, Germany) was used to extract HBV DNA from the serum samples according to the manufacturer’s instructions. The 447-bp length fragment from the S region was amplified in the first round PCR using outer primers GAGTCTAGACTCGTGGTGGACTTC (244–267) and AAATKGCACTAGTAAACTGAGCCA (668–691). The second-round PCR was performed using inner primers CGTGGTGGACTTCTCTCAATTTTC (255–278), and GCCARGAGAAACGGRCTGAGGCCC (648–671).11,12 The amplified 416-bp length fragments from the second-round PCR were sequenced by Sanger dideoxy sequencing technology to determine the genotypes of HBV (Macrogen Co., Seoul, Korea). After sequencing, the genotypes, subgenotypes and subtypes were determined by blasting in NCBI. Moreover, the 789-bp and 740-bp length fragments from the X and pre-C region were amplified using outer primers GCATGGAGACCACCGTGAAC (1,606–1,625) and AGGCGAGGGAGTTCTTCTTC (2,376–2,395) and inner primers CATAAGAGGACTCTTGGACT (1,653–1,672) and GCGAGGGAGTTCTTCTTC (2,376–2,393), respectively.11,12 PCR-grade water with PCR reagents and a known HBV positive serum sample were used as the negative and positive controls of the PCR assay, respectively. Furthermore, positive cases were retested to ensure the accuracy of the study and the absence of accidental contamination or technical errors. The HBV viremic samples were tested for HCV coinfection by HCV Ab ELISA kit (DIA.PRO) and seminested reverse transcriptase PCR as described previously.13–15 The specificity and sensitivity of this HCV Ab ELISA kit were 99.5% and 100%, respectively.
Statistical analysis.
Statistical analyses were performed by SPSS 17 package program (SPSS Inc., Chicago, IL), and P values < 0.05 were defined significant. The data were analyzed by Student’s t test and χ2 test or Fisher exact test. Logistic regression analysis was used to evaluate the risk factors associated with HBV infection among hemodialysis patients, and odds ratio (OR) with 95% CIs was determined.
RESULTS
Of 279 hemodialysis patients, five (1.8%, 95% CI: 0.79–4.12%) were positive for HBsAg, and 66 cases (23.7%, 95% CI: 19.05–28.99%) were positive for HBcAb. Of 277 controls, four (1.4%, 95% CI: 0.59–3.64%) were positive for HBsAg, and 40 subjects (14.4%, 95% CI: 10.80–19.07%) were positive for HBcAb. The hemodialysis patients had a significantly higher HBcAb prevalence than the controls (P = 0.007) so that the prevalence of HBcAb in the hemodialysis group was 1.6 times higher than that in the control group (Table 1). The seroprevalence of HBsAg and HBcAb among hemodialysis patients was not statistically associated with duration of hemodialysis, gender distribution, ethnicity, place of residency, and level of education (Tables 2 and 3). HBsAg seropositive hemodialysis cases had a lower mean age (55.60 ± 9.74) compared with HBsAg seronegative patients (60.00 ± 14.34), although this difference was not statistically significant (P = 0.496).
Table 1.
Prevalence of HbsAg, HBcAb, and HBV viremia in hemodialysis patients and nonhemodialysis controls
| Variable | Nonhemodialysis participants, N = 277 | Hemodialysis participants, N = 279 | P value |
|---|---|---|---|
| HBsAg, n (%) | 0.504 | ||
| Negative | 273 (98.6) | 274 (98.2) | |
| Positive | 4 (1.4) | 5 (1.8) | |
| HBcAb, n (%) | 0.007 | ||
| Negative | 237 (85.6) | 213 (76.3) | |
| Positive | 40 (14.4) | 66 (23.7) | |
| HBV DNA, n (%) | 0.0001 | ||
| Negative | 274 (98.92) | 247 (88.53) | |
| Positive | 3 (1.08) | 32 (11.47) | |
| OBI, n (%) | 0.0001 | ||
| Negative | 272 (99.63) | 245 (89.42) | |
| Positive | 1 (0.37) | 29 (10.58) |
HBcAb = hepatitis B core antigen; HBsAg = hepatitis B surface antigen; HBV = hepatitis B virus; OBI = occult B virus.
Table 2.
Prevalence of HBsAg according to sociodemographic and qualitative variables among hemodialysis patients
| Variable | All participants, N = 279 | HBsAg-negative subjects, N = 274 (98.2%) | HBsAg-positive subjects, N = 5 (1.8%) | P value |
|---|---|---|---|---|
| Age group (years), n (%) | 0.005 | |||
| ≤ 39 | 28 (10.0) | 28 (100.0) | 0 (0.0) | |
| 40–49 | 27 (9.7) | 24 (88.9) | 3 (11.1) | |
| 50–59 | 68 (24.4) | 68 (100.0) | 0 (0.0) | |
| 60–69 | 83 (29.7) | 81 (97.6) | 2 (2.4) | |
| 70–79 | 54 (19.4) | 54 (100.0) | 0 (0.0) | |
| ≥ 80 | 19 (6.8) | 19 (100.0) | 0 (0.0) | |
| Gender, n (%) | 0.577 | |||
| Female | 128 (45.9) | 126 (98.4) | 2 (1.6) | |
| Male | 151 (54.1) | 148 (98.0) | 3 (2.0) | |
| Place of residence (city), n (%) | 0.491 | |||
| Bushehr | 176 (63.1) | 174 (98.9) | 2 (1.1) | |
| Dashtestan | 57 (20.4) | 55 (96.5) | 2 (3.5) | |
| Genaveh | 46 (16.5) | 45 (97.8) | 1 (2.2) | |
| Ethnicity, n (%) | 0.648 | |||
| Fars | 256 (91.8) | 251 (98.0) | 5 (2.0) | |
| Arab | 23 (8.2) | 23 (100.0) | 0 (0.0) | |
| Duration of hemodialysis (years), n (%) | 0.227 | |||
| < 1 | 43 (15.4) | 43 (100.0) | 0 (0.0) | |
| 1–2 | 105 (37.6) | 101 (96.2) | 4 (3.8) | |
| 3–4 | 58 (20.8) | 58 (100.0) | 0 (0.0) | |
| > 4 | 73 (26.2) | 72 (98.6) | 1 (1.4) | |
| Education, n (%) | 0.773 | |||
| Under diploma | 231 (82.8) | 227 (98.3) | 4 (1.7) | |
| Diploma | 34 (12.2) | 33 (97.1) | 1 (2.9) | |
| Upper diploma | 14 (5.0) | 14 (100.0) | 0 (0.0) |
HBsAg = hepatitis B surface antigen.
Table 3.
Prevalence of HBcAb according to sociodemographic and qualitative variables among hemodialysis patients
| Variable | All participants, N = 279 | HBcAb-negative subjects, N = 213 (76.34%) | HBcAb-positive subjects, N = 66 (23.66%) | P value |
|---|---|---|---|---|
| Age group (years), n (%) | 0.003 | |||
| ≤ 39 | 28 (10.0) | 26 (92.9) | 2 (7.1) | |
| 40–49 | 27 (9.7) | 24 (88.9) | 3 (11.1) | |
| 50–59 | 68 (24.4) | 57 (83.8) | 11 (16.2) | |
| 60–69 | 83 (29.7) | 54 (65.1) | 29 (34.9) | |
| 70–79 | 54 (19.4) | 36 (66.7) | 18 (33.3) | |
| ≥ 80 | 19 (6.8) | 16 (84.2) | 3 (15.8) | |
| Gender, n (%) | 0.116 | |||
| Female | 128 (45.9) | 93 (72.7) | 35 (27.3) | |
| Male | 151 (54.1) | 120 (79.5) | 31 (20.5) | |
| Place of residence (city), n (%) | 0.254 | |||
| Bushehr | 176 (63.1) | 140 (79.5) | 36 (20.5) | |
| Dashtestan | 57 (20.4) | 40 (70.2) | 17 (29.8) | |
| Genaveh | 46 (16.5) | 33 (71.7) | 13 (28.3) | |
| Ethnicity | 0.473 | |||
| Fars | 256 (91.8) | 196 (76.6) | 60 (23.4) | |
| Arab | 23 (8.2) | 17 (73.9) | 6 (26.1) | |
| Duration of hemodialysis (years), n (%) | 0.798 | |||
| < 1 | 43 (15.4) | 32 (74.4) | 11 (25.6) | |
| 1–2 | 105 (37.6) | 83 (79.0) | 22 (21.0) | |
| 3–4 | 58 (20.8) | 42 (72.4) | 16 (27.6) | |
| > 4 | 73 (26.2) | 56 (76.7) | 17 (23.3) | |
| Education, n (%) | 0.210 | |||
| Under diploma | 231 (82.8) | 173 (74.9) | 58 (25.1) | |
| Diploma | 34 (12.2) | 30 (88.2) | 4 (11.8) | |
| Upper diploma | 14 (5.0) | 10 (71.4) | 4 (28.6) |
HBcAb = hepatitis B core antigen.
Hepatitis B core antigen seroprevalence was significantly higher among the hemodialysis patients aged > 60 years (32%, 95% CI: 24.94–40.06%) compared with the hemodialysis patients aged < 60 years (13%, 95% CI: 7.85–20.56%; P = 0.003). Overall, the seroprevalence of HBcAb increased with age, so that the highest rate of HBcAb seroprevalence was found in the age group 60 to 69 years (34.9%) followed by the age group 70 to 79 years (33.3%), whereas the lowest HBcAb seroprevalence was observed in the age group ≤ 39 years (7.1%) followed by the age group 40 to 49 years (11.1%) (Table 3). Hepatitis B core antigen seropositivity among hemodialysis patients was significantly associated with age distribution, so that the age group 60 to 69 years (OR: 6.98; 95% CI: 1.55–31.52; P = 0.01) and the age group 70 to 79 years (OR: 6.50; 95% CI: 1.39–30.49; P = 0.02) had significantly higher HBcAb seroprevalence compared with the other age groups (Table 4). Moreover, HBcAb seropositive hemodialysis patients had significantly higher mean age (64.62 ± 11.28) compared with HBcAb seronegative hemodialysis patients (58.46 ± 14.80) (P = 0.002).
Table 4.
Logistic regression analysis of age distribution with the prevalence of HBcAb among hemodialysis patients
| Variable | All participants, N = 279 (100%) | HBcAb-negative subjects, N = 213 (76.34%) | HBcAb positive subjects, N = 66 (23.66%) | aOR (95% CI) | P value |
|---|---|---|---|---|---|
| Age group (years) | |||||
| ≤ 39 | 28 (10.0%) | 26 (92.9%) | 2 (7.1%) | 1 | |
| 40–49 | 27 (9.7%) | 24 (88.9%) | 3 (11.1%) | 1.63 (0.25–10.58) | 0.61 |
| 50–59 | 68 (24.4%) | 57 (83.8%) | 11 (16.2%) | 2.51 (0.52–12.14) | 0.25 |
| 60–69 | 83 (29.7%) | 54 (65.1%) | 29 (34.9%) | 6.98 (1.55–31.52) | 0.01 |
| 70–79 | 54 (19.4%) | 36 (66.7%) | 18 (33.3%) | 6.50 (1.39–30.49) | 0.02 |
| ≥ 80 | 19 (6.8%) | 16 (84.2%) | 3 (15.8%) | 2.44 (0.37–16.21) | 0.36 |
aOR = adjusted odds ratio; HBcAb = hepatitis B core antigen.
According to the molecular evaluation, 32 of 279 hemodialysis patients (11.5%, 95% CI: 8.24–15.74%) had HBV viremia compared with three of 277 nonhemodialysis controls (1.08%, 95% CI: 0.39–3.12%). The prevalence of HBV viremia among the hemodialysis patients was significantly higher than HBV viremia among the controls (P = 0.0001). The prevalence of HBV viremia was higher among the hemodialysis patients aged 40 to 49 years (22.2%), female hemodialysis patients (11.7%), patients with 1 to 2 years on regular hemodialysis (14.3%), and upper diploma patients (28.6%). Nevertheless, HBV viremia among hemodialysis patients was not statistically associated with these variables (Table 5). In contrast, HBV viremia was associated with place of residency and ethnicity, so that residents of Dashtestan (21.1%) and Arab hemodialysis patients (26.1%) had significantly higher prevalence of HBV viremia compared with the residents of other cities (OR: 2.86; 95% CI: 1.25–6.55; P = 0.013) and Fars hemodialysis patients (10.2%; OR: 3.12; 95% CI: 1.13–8.62; P = 0.028) (Table 6). The mean age of hemodialysis patients with HBV viremia (58.59 ± 16.07) was lower than that of HBV DNA-negative hemodialysis patients (60.01 ± 14.05), but this difference was not statistically significant (P = 0.578). All participants with HBV viremia were infected with HBV genotype D, subgenotype D3 and subtype ayw2, and had normal levels of liver enzymes. The same genotypic pattern was found in the control group. Occult HBV infection was detected in 29 of 279 hemodialysis patients (10.4%, 95% CI: 7.33–14.52%), of which 3.9% (11/279) were positive for HBcAb but negative for HBsAg and 6.45% (18/279) were negative for both HBsAg and HBcAb. In addition, one of the controls had occult HBV infection (0.37%). The hemodialysis patients had a significantly higher prevalence of occult HBV infection than the controls (P = 0.0001). Overall, 90.6% (29/32) of the hemodialysis patients with HBV viremia had occult HBV infection. The samples of these patients became positive in the second round of PCR (Figures 1 and 2). Notably, 27.6% and 6.9% of hemodialysis patients infected with occult HBV infection were also positive for anti-HCV antibodies and HCV viremia, respectively, whereas those patients without occult HBV infection did not have HCV coinfection.
Table 5.
Prevalence of HBV viremia according to sociodemographic and qualitative variables among hemodialysis patients
| Variable | All participants, N = 279 | HBV DNA–negative subjects, N = 247 (88.53%) | HBV–DNA positive subjects, N = 32 (11.47%) | P value |
|---|---|---|---|---|
| Age groups, n (%) | 0.259 | |||
| ≤ 39 | 28 (10.0) | 25 (89.3) | 3 (10.7) | |
| 40–49 | 27 (9.7) | 21 (77.8) | 6 (22.2) | |
| 50–59 | 68 (24.4) | 64 (94.1) | 4 (5.9) | |
| 60–69 | 83 (29.7) | 73 (88.0) | 10 (12.0) | |
| 70–79 | 54 (19.4) | 46 (85.2) | 8 (14.8) | |
| ≥ 80 | 19 (6.8) | 18 (94.7) | 1 (5.3) | |
| Gender, n (%) | 0.526 | |||
| Female | 128 (45.9) | 113 (88.3) | 15 (11.7) | |
| Male | 151 (54.1) | 134 (88.7) | 17 (11.3) | |
| Place of residence (city), n (%) | 0.035 | |||
| Bushehr | 176 (63.1) | 161 (91.5) | 15 (8.5) | |
| Dashtestan | 57 (20.4) | 45 (78.9) | 12 (21.1) | |
| Genaveh | 46 (16.5) | 41 (89.1) | 5 (10.9) | |
| Ethnicity, n (%) | 0.034 | |||
| Fars | 256 (91.8) | 230 (89.8) | 26 (10.2) | |
| Arab | 23 (8.2) | 17 (73.9) | 6 (26.1) | |
| Duration of hemodialysis (years), n (%) | 0.498 | |||
| < 1 | 43 (15.4) | 38 (88.4) | 5 (11.6) | |
| 1–2 | 105 (37.6) | 90 (85.7) | 15 (14.3) | |
| 3–4 | 58 (20.8) | 51 (87.9) | 7 (12.1) | |
| > 4 | 73 (26.2) | 68 (93.2) | 5 (6.8) | |
| Education, n (%) | 0.116 | |||
| Under diploma | 231 (82.8) | 207 (89.6) | 24 (10.4) | |
| Diploma | 34 (12.2) | 30 (88.2) | 4 (11.8) | |
| Upper diploma | 14 (5.0) | 10 (71.4) | 4 (28.6) | |
| HBcAb test, n (%) | 0.007 | |||
| Negative | 213 (76.3) | 195 (91.55) | 18 (8.45) | |
| Positive | 66 (23.7) | 52 (78.8) | 14 (21.2) | |
| HBsAg test, n (%) | 0.012 | |||
| Negative | 274 (76.3) | 245 (89.4) | 29 (10.6) | |
| Positive | 5 (23.7) | 2 (40) | 3 (60) |
HBcAb = hepatitis B core antigen; HBsAg = hepatitis B surface antigen; HBV = hepatitis B virus.
Table 6.
Logistic regression analysis of place of residency and ethnicity with the prevalence of HBV viremia among hemodialysis patients
| Variable | All participants, N = 279 (100%) | HBV DNA–negative subjects, N = 247 (88.53%) | HBV DNA–positive subjects, N = 32 (11.47%) | aOR (95% CI) | P value |
|---|---|---|---|---|---|
| Place of residence (city) | |||||
| Bushehr | 176 (63.1%) | 161 (91.5%) | 15 (8.5%) | 1 | |
| Dashtestan | 57 (20.4%) | 45 (78.9%) | 12 (21.1%) | 2.86 (1.25–6.55) | 0.013 |
| Genaveh | 46 (16.5%) | 41 (89.1%) | 5 (10.9%) | 1.31 (0.45–3.811) | 0.621 |
| Ethnicity | |||||
| Fars | 256 (91.8%) | 230 (89.8%) | 26 (10.2%) | 1 | |
| Arab | 23 (8.2%) | 17 (73.9%) | 6 (26.1%) | 3.12 (1.13–8.62) | 0.028 |
aOR = adjusted odds ratio; HBV = hepatitis B virus.
Figure 1.
Electrophoresis of polymerase chain reaction products of S region of hepatitis B virus genome extracted from serum samples of hemodialysis patients with occult infection on 2% agarose gel. 3, 4, 5 and 6 = amplified products (≈417 bp); L = 100-bp DNA ladder; N = negative control; P = positive control.
Figure 2.
Electrophoresis of polymerase chain reaction products of X and pre-C region of hepatitis B virus genome extracted from serum samples of hemodialysis patients with occult infection on 2% agarose gel. 1 and 2 = amplified products (≈735 bp); L = 1 kbp DNA ladder; N = negative control; P = positive control.
DISCUSSION
Occult HBV infection is a risk factor for HBV transmission, reactivation, and hepatic disease development among hemodialysis patients.6 Nevertheless, there is no recommendation regarding the detection of HBV DNA in this group of patients in Iran. Therefore, this study was designed to investigate the prevalence rate of occult HBV infection among hemodialysis patients. This study demonstrates the importance of detecting occult HBV infection in hemodialysis units, given that some of the cases with negative HBV serological markers might be positive for HBV DNA. This was observed in this study, as 18 of 213 hemodialysis patients who were negative for HBsAg and HBcAb (8.4%, 95% CI: 5.41–12.96%), and 11 of 62 hemodialysis patients who were negative for HBsAg but positive for HBcAb (17.7%, 95% CI: 10.2–29.04%) had HBV viremia. Overall, 62% (18/29) of hemodialysis patients with occult HBV infection were negative for HBcAb. This finding contradicts previous studies in Iran that considered the diagnosis of occult HBV infection only in HBcAb seropositive hemodialysis patients.16–18 Therefore, all hemodialysis patients, regardless of the pattern of HBV serological markers, should be screened for occult HBV infection.
In this study, 10.4% of the hemodialysis patients had occult HBV infection compared with 0.37% of the nonhemodialysis controls. Therefore, the hemodialysis cases had a significantly higher prevalence of occult HBV infection than the controls. Further, the prevalence of occult HBV infection reported in this study is considerably higher than that expected for occult HBV infection among hemodialysis patients in Iran, which was estimated at 2.5%.2 The high prevalence of occult HBV infection in the hemodialysis patients of this region is a cause of concern and demands strict infection control measures in dialysis services. Given that screening of hemodialysis patients based on HBsAg marker cannot detect occult HBV infection, it seems advisable to include sensitive molecular tests such as nested PCR and real-time PCR in the screening process of hemodialysis patients to increase the detection rate of HBV infection. This screening policy in combination with dialysis-specific preventive measures, including isolation decisions, training the medical staff and active vaccination, can minimize the risk of HBV transmission in dialysis centers.4
The prevalence of 10.4% for occult HBV infection reported in this study is higher than those observed among hemodialysis patients in the other parts of Iran, 0.0% in Guilan (northern Iran),19 0.0% in Isfahan (central Iran),18 0.8% in Yazd (central Iran),17 0.5% in Tehran (north-central Iran),20 4.7% in Ahvaz (southwestern Iran),21 and 6% in Zanjan (western Iran).22 The prevalence of occult HBV infection detected in this study is also higher than those reported among hemodialysis patients of some other regions and countries, 0.0% in Al-Nasiriyah, Iraq23; 0.3% in eastern Japan24; 0.9% in central Greece25; 1.3% in South Korea26; 2.2% in London, United Kingdom27; and 2.3% in northeastern Brazil28 but lower than those reported among hemodialysis patients in Egypt (32%)29 and Sudan (15.9%).30 These discrepancies in the prevalence of occult HBV infection may attributable to differences in the endemicity of HBV infection in different geographic regions, preventive measures in hemodialysis units, and the sensitivity and specificity of the detection method used in different studies.
In this study, to evaluate the detection value of two regions of HBV genome, all serum samples were tested by two PCR assays, targeting the S, X, and pre-C regions. Of 32 HBV DNA-positive hemodialysis patients, 26 cases were positive by PCR amplifying the S, X, and pre-C regions, four cases were positive in the S region alone, and two cases were positive in the X and pre-C region alone. Furthermore, nested PCR or two-step PCR technique was used to detect occult HBV infection in hemodialysis patients. Nested PCR assay has high sensitivity for the detection of samples with low virus levels31 so that those cases with occult HBV infection were detected in the second round of PCR, whereas they were negative in the first round of PCR. According to a recent meta-analysis study, nested PCR assay showed a higher detection rate of occult HBV infection among hemodialysis patients compared with real-time PCR and one-step PCR assays.2 In addition, those studies using real-time PCR assay17,18,20 to detect HBV DNA have reported a lower prevalence rate than the studies using nested PCR assay.21,22,32 However, the probability of contamination with PCR product during procedures that can result in false-positive results considers as the main limitation of the nested-PCR method.31 In the present study, strict quality controls and positive and negative controls were applied to avoid contamination and to ensure the accuracy of the results. Another issue is the presence of PCR reaction inhibitors that may result in false-negative results. In this study, the High Pure Viral Nucleic Acid kit (Roche, Mannheim, Germany) was used to extract HBV DNA from the serum samples. Compared with the manual method, the nucleic acid extraction kit is able to remove PCR inhibitors effectively.33
In this study, the prevalence of occult HBV infection among hemodialysis patients was not statistically associated with duration of hemodialysis, age, gender distribution, and level of education, although the prevalence of HBV infection was higher in patients with 1 to 2 years on regular hemodialysis, the hemodialysis patients aged 40 to 49 years, female hemodialysis patients, and upper diploma patients. Similarly, recent studies in Zanjan (West of Iran) and Qazvin (West-Center of Iran) demonstrated that the prevalence of occult HBV infection among hemodialysis patients is not associated with age, gender, or duration of hemodialysis.22,34 Another study from Northeast Brazil reported no association between occult HBV infection and age, gender, kidney transplant, or time on hemodialysis.28 Previous studies from central Greece and Turkey reported no risk factor for occult HBV infection among hemodialysis patients.25,35 In contrast, occult HBV infection was associated with place of residency and ethnicity, so that residents of Dashtestan and Arab hemodialysis patients had significantly higher prevalence of HBV viremia compared with the residents of other cities (P = 0.035) and Fars hemodialysis patients (P = 0.034). The higher seroprevalence of occult HBV infection among hemodialysis patients residing in Dashtestan might be due to the higher prevalence of HBV infection in the general population of this city. Among patients of Arab ethnicity, three out of six positive cases had hemodialysis duration of more than 4 years, and the other three positive cases had hemodialysis duration of 1 to 2 years. As the duration of dialysis increases, the risk of being infected with HBV increases. Moreover, this study reported a gradual increase in HBcAb seropositivity with age, ranging from 7.1% in the age group ≤ 39 years to 33.3% in the age group 70 to 79 years. This increasing prevalence with age might be due to the compulsory vaccination of high-risk groups in the country since 2006 or less exposure to HBV in young ages.
In this study, anti-HCV antibodies and HCV viremia were detected in 27.6% and 6.9% of hemodialysis patients infected with occult HBV infection. The observation that HCV coinfection was only found in patients with occult HBV infection suggests that HCV infection could be a risk factor for the development of occult HBV infection through suppression of HBV replication and subsequently decreased expression of HBsAg, which may result in the absence of detectable HBsAg in serum samples. In addition to the interference with HBV replication and expression by HCV,5 similar transmission routes of HBV and HCV could account for the expected higher prevalence of coinfection of both viruses in hemodialysis patients.4 Overall, the association between occult HBV infection and HCV coinfection remains controversial. Some studies have confirmed this association,28,29,36 whereas others have demonstrated no such association in hemodialysis patients.25,35,37 These studies were performed in various regions with different sociodemographic characteristics and risk factors and failed to reach an overall consensus.
The results of the present study demonstrate that hemodialysis patients are prone to be infected with HBV. Considering HBV vaccination of high-risk groups in Iran since 2006,10 this is possibly due to either a transient response or a low response to HBV vaccination in hemodialysis patients as a result of impaired immunity associated with chronic kidney disease.38 Furthermore, levels of anti-HBsAb decline more rapidly in patients on maintenance hemodialysis compared with the general population. A double vaccine dose and a booster dose are therefore advised to maintain protective levels of anti-HBsAb in hemodialysis patients.27 In this study, all HBV-infected dialysis patients had normal levels of liver enzymes. Because serum levels of aminotransferases tend to be reduced in patients on maintenance hemodialysis, it is difficult to recognize HBV-mediated liver disease by liver function tests in these patients.5,38 Similarly, previous studies failed to report a relationship between serum aminotransferase levels and occult HBV infection in hemodialysis patients.35,37 Moreover, HBV genotype D reported in this study is the main genotype in Iran39 and is associated with progression to cirrhosis and hepatocellular carcinoma and worse disease outcomes.40,41
This is the first report on the magnitude and genotypic pattern of occult HBV infection among hemodialysis patients in southern Iran. The enrollment in the study of all patients on regular hemodialysis in this region increases the generalizability of the results. However, this study could not determine the transmission risk of occult HBV infection in dialysis settings because HBV viremia was measured on one occasion. As another limitation, this study was not able to confirm the association between the prevalence of occult HBV infection and HCV coinfection among hemodialysis patients due to the cross-sectional design of the study. Therefore, longitudinal studies are required to evaluate these assertions. Because the level of immunity against HBV was not determined in this study, we were not able to study the efficacy of HBV vaccination among the study population. Therefore, it is suggested to assess antibody to HBsAg among the hemodialysis population of this region. Furthermore, the cost-effectiveness of including sensitive molecular tests such as nested and real-time PCR to detect HBV infection needs to be evaluated in future studies. Given the high detection rate of occult HBV infection in this study, the implementation of nested PCR assay in the hemodialysis centers can improve infection control measures in dialysis services. Finally, given the short length of the fragments sequenced, it was impossible to check the mutations in the sequences, and therefore mutational analysis was not performed in this study.
CONCLUSION
This study reports a high prevalence of occult HBV infection among hemodialysis patients in southern Iran, whereas a significant percentage of the infected patients were negative for HBV serological markers. This demonstrates the importance of detecting occult HBV infection in hemodialysis centers, given that some of the cases with negative HBV serological markers might be indeed positive for HBV DNA. More important, all HBV-infected hemodialysis patients were asymptomatic and unaware of their infection. These infected but undiagnosed patients may contribute to HBV transmission in the dialysis units. Therefore, screening of all hemodialysis patients for occult HBV infection by sensitive molecular tests, regardless of the pattern of HBV serological markers, is recommended to identify an increasing number of HBV-infected patients. This screening policy in combination with infection control measures can minimize the risk of HBV transmission in dialysis centers.
Financial Disclosure
This study was funded by Bushehr University of Medical Sciences (Grant no. 3224). The institutional grant includes the financial assistance to meet all expenses, materials used, and essential equipment for conducting the study. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
ACKNOWLEDGMENTS
The American Society of Tropical Medicine and Hygiene (ASTMH) assisted with publication expenses.
REFERENCES
- 1. Ruiz-Calero Cendrero RM, Cancho Castellano B, Martín Hidalgo-Barquero MV, Cid Parra MC, Galán González J, Fernández Solís MA, Sánchez García O, 2020. When can it be useful to look for occult HBV in haemodialysis patients? Nefrologia 40: 115–119. [DOI] [PubMed] [Google Scholar]
- 2. Hedayati-Moghaddam MR, Soltanian H, Behzadifar M, 2020. Occult hepatitis B virus infection prevalence among different populations of Iran: a systematic review and meta-analysis. Hepat Mon 20: e101722. [Google Scholar]
- 3. Beykaso G, Mulu A, Giday M, Berhe N, Selamu M, Hailu D, Teklehaymanot T, 2022. Occult hepatitis B virus infection and its risks of cryptic transmission in southern Ethiopia. Infect Drug Resist 15: 619–630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Kwak M-S, Kim YJ, 2014. Occult hepatitis B virus infection. World J Hepatol 6: 860–869. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Aghakhani A, Banifazl M, Velayati AA, Eslamifar A, Ramezani A, 2012. Occult hepatitis B virus infection in hemodialysis patients: a concept for consideration. Ther Apher Dial 16: 328–333. [DOI] [PubMed] [Google Scholar]
- 6. Fontenele AM, Filho NS, Ferreira AS, 2013. Occult hepatitis B in patients on hemodialysis: a review. Ann Hepatol 12: 527–531. [PubMed] [Google Scholar]
- 7. Shokri S, Mahmoudvand S, Taherkhani R, Farshadpour F, Jalalian FA, 2019. Complexity on modulation of NF-kappaB pathways by hepatitis B and C: a double-edged sword in hepatocarcinogenesis. J Cell Physiol 234: 14734–14742. [DOI] [PubMed] [Google Scholar]
- 8. Mohammadi Z. et al. , 2016. Epidemiological profile of hepatitis B virus infection in Iran in the past 25 years; a systematic review and meta-analysis of general population studies. Middle East J Dig Dis 8: 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Mahmud S, Akbarzadeh V, Abu-Raddad LJ, 2018. The epidemiology of hepatitis C virus in Iran: systematic review and meta-analyses. Sci Rep 8: 150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Farshadpour F, Taherkhani R, Tajbakhsh S, Gholizadeh Tangestani M, Hajiani G, Sharifi N, Taherkhani S, Nejadbolkheyr A, 2016. Prevalence and trends of transfusion-transmissible viral infections among blood donors in south of Iran: an eleven-year retrospective study. PLoS One 11: e0157615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Taherkhani R, Farshadpour F, 2022. Prevalence, genotype distribution and mutations of hepatitis B virus and the associated risk factors among pregnant women residing in the northern shores of Persian Gulf, Iran. PLoS One 17: e0265063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Farshadpour F, Taherkhani R, Saberi F, 2022. Molecular evaluation of hepatitis B virus infection and predominant mutations of pre-core, basal core promoter and S regions in an Iranian population with type 2 diabetes mellitus: a case-control study. BMC Infect Dis 22: 553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Farshadpour F, Taherkhani R, Ravanbod MR, Eghbali SS, 2018. Prevalence and genotype distribution of hepatitis C virus infection among patients with type 2 diabetes mellitus. Med Princ Pract 27: 308–316. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Farshadpour F, Taherkhani R, Bakhtiari F, 2021. Prevalence and predominant genotype of hepatitis C virus infection and associated risk factors among pregnant women in Iran. BioMed Res Int 2021: 9294276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Farshadpour F, Taherkhani R, 2022. Prevalence and molecular evaluation of hepatitis C virus infection among multi-transfused thalassemia patients in south of Iran. Oman Med J 37: e427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Aghakhani A, Banifazl M, Kalantar E, Eslamifar A, Ahmadi F, Razeghi E, Atabak S, Amini M, Khadem-Sadegh A, Ramezani A, 2010. Occult hepatitis B virus infection in hemodialysis patients with isolated hepatitis B core antibody: a multicenter study. Ther Apher Dial 14: 349–353. [DOI] [PubMed] [Google Scholar]
- 17. Ayatollahi J, Jahanabadi S, Sharifyazdi M, Hemayati R, Vakili M, Shahcheraghi SH, 2016. The prevalence of occult hepatitis B virus in the hemodialysis patients in Yazd, Iran. Acta Med Iran 54: 784–787. [PubMed] [Google Scholar]
- 18. Kalantari H, Ferdowsi F, Yaran M, 2016. Prevalence of occult hepatitis B virus infection in hemodialysis patients in Isfahan, Iran. Adv Biomed Res 5: 151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Joukar F, Mansour-Ghanaei F, Besharati S, Khosh-Sorur M, 2012. Occult hepatitis B infection in a hemodialysis population in Guilan province, northern Iran. Hemodial Int 16: 294–297. [DOI] [PubMed] [Google Scholar]
- 20. Ranjbar M, Dadkhah M, Bokharaei Salim F, Daneshbodi M, Savaj S, Keyvani H, 2017. The prevalence of occult HBV infection among hemodialysis patients of Tehran, Iran. Mod Care J 14: e65546. [Google Scholar]
- 21. Samiei RN, Shokri S, Mahmoudvand S, Makvandi M, Shahbazian H, Shayanpur S, Nowrozi S, Nejad KH, 2018. Occult hepatitis B virus infection among hemodialysis patients. J Biol Res (Thessalon) 91: 7516. [Google Scholar]
- 22. Samadi E, Mirshahabi H, Motamed N, Sadeghi H, 2020. Prevalence of occult hepatitis B virus infection in hemodialysis patients using nested PCR. Rep Biochem Mol Biol 9: 82–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Musa MD, Ateya HK, 2020. Prevalence of overt and occult hepatitis B virus infections among 135 haemodialysis patients attending a haemodialysis centre at Al-Nasiriyah city, Iraq. Iran J Microbiol 12: 475–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Nagakawa O, Miyatomi Y, Shigeta Y, Inayama E, Murakami K, Sakai T, Kouno T, Masai M, Shirai K, Yoshida T, 2013. Occult hepatitis B virus infection in Japanese chronic hemodialysis patients. Ther Apher Dial 17: 289–292. [DOI] [PubMed] [Google Scholar]
- 25. Mina P, Georgiadou SP, Rizos C, Dalekos GN, Rigopoulou EI, 2010. Prevalence of occult hepatitis B virus infection in haemodialysis patients from central Greece. World J Gastroenterol 16: 225–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Kim SM, Kim HW, Lee JE, Lee EK, Shin HD, Song IH, 2014. Occult hepatitis B virus infection of hemodialysis patients: a cross-sectional study in a hepatitis B virus-endemic region. Hemodial Int 19: 66–71. [DOI] [PubMed] [Google Scholar]
- 27. Sowole L, Labbett W, Patel M, O’Riordan A, Cross J, Davenport A, Haque T, 2015. The prevalence of occult hepatitis B virus (HBV) infection in a large multi-ethnic haemodialysis cohort. BMC Nephrol 16: 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Fontenele AM, Gainer JB, da Silva E Silva DV, Cruz Santos MD, Salgado JV, Salgado Filho N, Ferreira AS, 2015. Occult hepatitis B among patients with chronic renal failure on hemodialysis from a capital city in northeast Brazil. Hemodial Int 19: 353–359. [DOI] [PubMed] [Google Scholar]
- 29. Helaly GF, El Ghazzawi EF, Shawky SM, Farag FM, 2015. Occult hepatitis B virus infection among chronic hemodialysis patients in Alexandria, Egypt. J Infect Public Health 8: 562–569. [DOI] [PubMed] [Google Scholar]
- 30. Samadi E, Mirshahabi H, Montame N, Sadeghi H, 2019. Prevalence of occult hepatitis B virus (HBV) infection among hemodialysis patients in Northern State, Sudan. Virol Immunol J 9: 82–88. [Google Scholar]
- 31. Taherkhani R, Farshadpour F, 2021. Molecular identification and clinical characteristics of mumps virus and human herpesviruses associated with aseptic meningitis in South of Iran. Virusdisease 32: 666–673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Hashemi SJ, Hajiani E, Masjedizadeh A, Makvandi M, Shahbazian H, Shayesteh A, Karimi M, 2015. A case–control study on occult hepatitis B infection in chronic hemodialysis patients from south-west of Iran. Govaresh 20: 135–140. [Google Scholar]
- 33. Farshadpour F, Taherkhani R, 2021. Molecular epidemiology of enteroviruses and predominance of echovirus 30 in an Iranian population with aseptic meningitis. J Neurovirol 27: 444–451. [DOI] [PubMed] [Google Scholar]
- 34. Haghazali S, AslaniMehr M, Charkhchian M, Alizadeh-Kavashkoohi S, Khabaz F, Rajabkhani Z, Mehdinejad P, Mohammadi Z, 2011. Occult HBV infection in hemodialysis patients in Qazvin. RJMS 18: 8–15. [Google Scholar]
- 35. Kanbay M, Gur G, Akcay A, Selcuk H, Yilmaz U, Arslan H, Boyacioglu S, Ozdemir FN, 2006. Is hepatitis C virus positivity a contributing factor to occult hepatitis B virus infection in hemodialysis patients? Dig Dis Sci 51: 1962–1966. [DOI] [PubMed] [Google Scholar]
- 36. Di Stefano M, Volpe A, Stallone G, Tartaglia L, Prato R, Martinelli D, Pastore G, Gesualdo L, Fiore JR, 2009. Occult HBV infection in hemodialysis setting is marked by presence of isolated antibodies to HBcAg and HCV. J Nephrol 22: 381–386. [PubMed] [Google Scholar]
- 37. Motta JS, Mello FC, Lago BV, Perez RM, Gomes SA, Figueiredo FF, 2010. Occult hepatitis B virus infection and lamivudine-resistant mutations in isolates from renal patients undergoing hemodialysis. J Gastroenterol Hepatol 25: 101–106. [DOI] [PubMed] [Google Scholar]
- 38. Ismail H, Soliman M, Ismail N, 2010. Occult hepatitis B virus infection in Egyptian hemodialysis patients with or without hepatitis C virus infection. Pathol Lab Med Int 2: 113–120. [Google Scholar]
- 39. Haghshenas MR, Arabi M, Mousavi T, 2014. Hepatitis B genotypes in Iran. Mater Sociomed 26: 129–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Lin CL, Kao JH, 2015. Hepatitis B virus genotypes and variants. Cold Spring Harb Perspect Med 5: a021436. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Sunbul M, 2014. Hepatitis B virus genotypes: global distribution and clinical importance. World J Gastroenterol 2014: 5427–5434. [DOI] [PMC free article] [PubMed] [Google Scholar]