Skip to main content
NCBI home page
Journal of Microbiology and Biotechnology logoLink to Journal of Microbiology and Biotechnology
. 2023 Feb 6;33(5):644–655. doi: 10.4014/jmb.2211.11016

Characterization of a Potential Probiotic Lactiplantibacillus plantarum LRCC5310 by Comparative Genomic Analysis and its Vitamin B6 Production Ability

Yunjeong Lee 1,†, Nattira Jaikwang 1,†, Seong keun Kim 1,†, Jiseon Jeong 1, Ampaitip Sukhoom 2, Jong-Hwa Kim 1,*, Wonyong Kim 1,*
PMCID: PMC10236179  PMID: 36808111

Abstract

Safety assessment and functional analysis of probiotic candidates are important for their industrial applications. Lactiplantibacillus plantarum is one of the most widely recognized probiotic strains. In this study we aimed to determine the functional genes of L. plantarum LRCC5310, isolated from kimchi, using next-generation, whole-genome sequencing analysis. Genes were annotated using the Rapid Annotations using Subsystems Technology (RAST) server and the National Center for Biotechnology Information (NCBI) pipelines to establish the strain’s probiotic potential. Phylogenetic analysis of L. plantarum LRCC5310 and related strains showed that LRCC5310 belonged to L. plantarum. However, comparative analysis revealed genetic differences between L. plantarum strains. Carbon metabolic pathway analysis based on the Kyoto Encyclopedia of Genes and Genomes database showed that L. plantarum LRCC5310 is a homofermentative bacterium. Furthermore, gene annotation results indicated that the L. plantarum LRCC5310 genome encodes an almost complete vitamin B6 biosynthetic pathway. Among five L. plantarum strains, including L. plantarum ATCC 14917T, L. plantarum LRCC5310 detected the highest concentration of pyridoxal 5’-phosphate with 88.08 ± 0.67 nM in MRS broth. These results indicated that L. plantarum LRCC5310 could be used as a functional probiotic for vitamin B6 supplementation.

Keywords: Lactiplantibacillus plantarum, whole-genome analysis, vitamin B6, pyridoxal 5’-phosphate

Introduction

The Food and Agriculture Organization/World Health Organization defined probiotics as “live microorganisms which when administered in adequate amounts, confer a health benefit on the host” [1]. Several lactic acid bacteria (LAB) have been recognized as probiotics for their health benefits, including cholesterol-lowering [2] and diabetes-ameliorating effects [3]. Probiotics are now widely used in food products and health supplements because of their ability to produce beneficial metabolites, such as proteins, amino acids, and vitamins [4].

Lactiplantibacillus plantarum, reclassified from Lactobacillus plantarum, is one of the most widely known probiotic strains [5]. It has been isolated from various sources, including milk [6], fermented grains [7], cheese [8], and fermented vegetables [9], and is known to exert beneficial effects against obesity, diabetes, stress, and liver disorders [10]. To understand the mechanisms underlying its biological benefits, the complete genomes of several strains have been studied [11, 12]. Furthermore, as the beneficial effects may not be generalizable and shared among strains, functional analysis at the genome level is also important [13].

Vitamin B6 is a water-soluble vitamin consisting of six different compounds: pyridoxamine (PM), pyridoxine (PN), pyridoxal (PL) and their 5’ phosphorylated derivatives: pyridoxamine 5¢-phosphate (PMP), pyridoxine 5¢-phosphate (PNP), and pyridoxal 5¢-phosphate (PLP) [14]. PLP, the active form of vitamin B6, is required as a cofactor for more than 140 enzymatic reactions involved in the metabolism of amino acids, carbohydrate, and lipids [15, 16]. Many organisms, including fungi, archaea, and eubacteria, have the ability to synthesize vitamin B6. However, mammals are incapable of biosynthesizing vitamin B6 [17]. The process of chemical synthesis during industrial production of vitamin B6 leads to environmental pollution. Thus, the production of vitamin B6 by using a living organism is currently being spotlighted.

In the present study we isolated L. plantarum LRCC5310 during a screening for potential probiotic LAB strains in kimchi, a traditional Korean fermented food. We then used whole-genome analysis to determine the genetic characteristics and genes involved in the strain’s synthesis of vitamin B6 and identify its production of vitamin B6.

Materials and Methods

Phylogenetic Characteristics

Genomic DNA of L. plantarum LRCC5310 was extracted using a DNA extraction kit (Intron, Korea). The 16S rRNA gene sequence was amplified via polymerase chain reaction (PCR) using the universal primers 8F and 1525R [18]. The Accuprep PCR Purification Kit (Bioneer, Korea) was used to purify the amplified PCR products. Subsequently, the purified PCR amplicons were sequenced. The similarity of the obtained 16S rRNA gene sequence with closely related species was analyzed using the NCBI BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi) [19]. The 16S rRNA gene sequence of closely related strains in L. plantarum were derived from the NCBI database. The phylogenetic tree based on 16S rRNA gene sequence was constructed using the neighbor-joning method in MEGA 7 software [20]. Based on the phylogenetic tree, the reference strains L. plantarum ATCC 14917T (=KCTC 3108T), L. plantarum GD00040 (=KCCM 43412), L. plantarum JBE245 (=KCCM 43243), and L. plantarum ATCC 8014 (=KCTC 21024) were obtained from the Korean Collection for Type Cultures (KCTC) and Korean Culture Center of Microorganisms (KCCM).

Whole-Genome Sequencing and Gene Annotation

The genomic library of L. plantarum LRCC5310 was prepared using the 20 kb SMRTbell Libraries Prep Kit, and the whole genome was sequenced using the PacBio RSII platform (PacBio, USA). De novo assembly of the sequences was performed using Hierarchical Genome Assembly Process (version 3.0) in the PacBio SMRT Analysis software (version 2.3.0). The phylogenetic tree was constructed using the whole genome by using the Type (Strain) Genome Server (TYGS) (https://tygs.dsmz.de/) [21]. For the phylogenomic inference, pairwise comparisons of the genomes among the genus Laciplantibacillus members were conducted using the Genome BLAST Distance Phylogeny (GBDP) method. Whole-genome annotation was performed by the Rapid Annotations using Subsystems Technology (RAST) server [22]. The NCBI Prokaryotic Genomes Annotation Pipeline (version 4.1) [23] and PATRIC 3.6.12 (Pathosystems Resource Integration Center; https://www.patricbrc.org/) [24] were used to compare the annotated genomes. The protein functions were grouped based on the COG database using WebMGA online tools (version 2.2.15; http://weizhong-lab.ucsd.edu/webMGA/) [25], and the KEGG database [26] was used to construct the carbon metabolic pathway. The Comprehensive Antibiotic Resistance Database (CARD; version 3.1.3; https://card.mcmaster.ca) [27] and ResFinder (version 4.1; https://cge.cbs.dtu.dk/services/ResFinder/) [28] were used to detect antimicrobial resistance genes. Virulence genes were searched using the VFDB (http://www.mgc.ac.cn/cgi-bin/VFs) [29]. The PathogenFinder web server (https://cge.cbs.dtu.dk/services/PathogenFinder/) [30] was used to determine the pathogenic potential of the L. plantarum strain.

Metabolic Pathway of Carbon Sources

The carbon metabolic pathway of L. plantarum LRCC5310 was constructed based on the KEGG pathway and an NCBI protein BLAST search. Sucrose, lactose, galactose, glucose, and fructose metabolic pathways were mapped according to the KEGG pathway database, and protein BLAST was used to confirm the functions of the genes.

Comparative Genomic Analysis

In the comparative genome analysis of L. plantarum LRCC5310, the strains L. plantarum ATCC 14917T, L. plantarum GD00040, L. plantarum JBE245, and L. plantarum ATCC 8014 sequences were obtained from the NCBI database. The orthoANI and dDDH values between L. plantarum LRCC5310 and the selected L. plantarum strains were calculated using the orthoANI tool [31] and Genome-to-Genome Distance Calculator (http://ggdc.dsmz.de/ggdc.php) [32], respectively. The clustered regularly interspaced palindromic repeats (CRISPRs) were analyzed using CRISPRFinder [33]. Furthermore, the genome of L. plantarum LRCC5310 was compared with the four reference strains using the OrthoVenn2 web server (https://orthovenn2.bioinfotoolkits.net/home), while the circular comparison map of genome sequences was constructed using the Proksee web server (https://proksee.ca/projects/new).

Estimation of Pyridoxal 5’ -Phosphate Concentration

To detect the production of pyridoxal 5’ -phosphate (PLP) along with the cell growth, the L. plantarum strains were prepared according to [34] with slight modifications. The samples were precultured and inoculated (initial concentration; 1 × 107 CFU/ml) in MRS medium (BD Difco, USA) until exponential-phase growth. The cell-free supernatant was prepared by centrifugation (13,000 ×g for 10 min at 4°C) and sterile filtration using a 0.22-um filter. The concentration of PLP in the bacterial supernatants was measured with a Pyridoxal 5’ -Phosphate (VitB6) Assay Kit (Abcam, UK) following the manufacturer’s recommendations.

mRNA Expression Analysis of Vitamin B6 Metabolic Genes

The mRNA expression of the vitamin B6 metabolic genes, including gapB, SerC, dxs, SerA, PdxK, and PdxH, was confirmed by using real-time polymerase chain reaction (PCR). The L. plantarum strains were cultured at an initial concentration of 1 × 107 CFU/ml in MRS until an optical density (OD) of 0.4 at 600 nm was reached. Total RNA was isolated using the AccuPrep Bacterial RNA Extraction Kit (Bioneer, Republic of Korea) according to the manufacturer’s instructions, and cDNA was synthesized using a PrimeScript First-Strand cDNA Synthesis Kit (Takara, Japan). mRNA expression levels were analyzed with the ABI Fast 7500 Real-Time PCR system (Applied Biosystems, USA) and a SYBR Green PCR Kit (Qiagen, USA). The sequences of the vitamin B6 genes were obtained by the Rapid Annotations using Subsystems Technology (RAST) database and primer designs were performed using the Primer3Plus server (https://www.primer3plus.com) (Table 1). Lactobacillus-specific 16S rRNA primers were used as controls [35] and relative fold changes were determined using the 2-ΔΔCt method.

Table 1.

Primer sequences of vitamin B6 metabolic genes.

Gene Sequence (5’→3’) Tm (°C)
Lacto 16S F: TGGAAACAGGTGCTAATACCG
R: GTCCATTGTGGAAGATTCCC		 59.2
59.4
gapB F: GTCGTTTAGCATTCCGTCGT
R: CTGAAACGTCAGCGTTCAAA		 59.2
57.6
SerC F: CTGCCAGTTACGGGTCAAGT
R: TCATCACGGACAATGACGAT		 62.1
58.2
dxs F: GGGCGTAGTCGAATTAACCA
R: ATAGTCGTGGGGGCTTTCTT		 59.3
61.0
SerA F: CCAAATTGGGCAATCGTTAG
R: TGGCAAAGCGTTGACAATAA		 56.5
56.3
PdxK F: TCAGGGCTTTGATCAGGACT
R: CTTGCAGTGCTGGCAAAATA		 61.2
57.0
PdxH F: GTCGTCAACACCTGGAGTCA
R: TGTGGAAACCACAGCCAGTA		 62.5
61.3
Open in a new tab

Statistical Analysis

All results are presented as the mean ± standard error of the mean (SEM) of experiments performed in triplicate. One-way analysis of variance (ANOVA) was used to compare the results with GraphPad Prism (version 6.0.1). Statistical significance was accepted for p < 0.05.

Results

Phylogenetic Characterization

The 16S rRNA gene sequence of L. plantarum LRCC5310 was compared with related strains using the BLAST tool available on National Center for Biotechnology Information (NCBI) website, which revealed that L. plantarum LRCC5310 shared 100% similarity with other L. plantarum strains. The phylogenetic distance of this strain from other L. planatrum strains was inferred using the Genome BLAST Distance Phylogeny (GBDP) based on the 16S rRNA gene sequence. The phylogenetic analysis confirmed that this strain belonged to the L. plantarum group (Fig. 1).

Fig. 1. Phylogenetic tree constructed based on the 16S rRNA gene sequences of Lactiplantibacillus plantarum LRCC5310 and closely related L. plantarum strains.

Fig. 1

Open in a new tab

Bacillus substillis NCIB 3610T (CP020102) was used as an outgroup. The number of nodes indicates the percentage of bootstrapping based on 1,000 resampling repeats. Bar, 0.0002 substitutions per nucleotide position.

Genomic Characterization

L. plantarum LRCC5310 has a 3,269,650 bp-long circular chromosome, which contained 72 tRNAs, 16 rRNAs (n = 6, 5S rRNA; n = 5, 16S rRNA; n = 5, 23S rRNA) and 3,500 protein-coding sequences. The G+C content was 44.4% (Table 2). The phylogenetic tree based on the L. plantarum LRCC5310 whole genome was presented in Fig. 2 using TYGS. The protein function annotation of L. plantarum LRCC5310 was analyzed using WebMGA online tools, based on the COG database. The major categories (mostly >100 genes) of the annotated protein functions were translation, ribosomal structure, and biogenesis (J, 245 genes); transcription (K, 231 genes); replication, recombination, and repair (L, 238 genes); signal transduction mechanisms (T, 152 genes); cell wall, membrane, envelope biogenesis (M, 188 genes); intracellular trafficking, secretion, and vesicular transport (U, 158 genes); post-translational modification, protein turnover, and chaperones (O, 203 genes); energy production and conversion (C, 258 genes); carbohydrate transport and metabolism (G, 230 genes); amino acid transport and metabolism (G, 230 genes); coenzyme transport and metabolism (H, 179 genes); inorganic ion transport and metabolism (P, 212 genes); and general function prediction only (R, 702 genes) (Fig. 3).

Table 2.

Genomic characterization of Lactiplantibacillus plantarum LRCC5310 and other L. plantarum strains.

L. plantarum LRCC5310 L. plantarum ATCC 14917T L. plantarum GD00040 L. plantarum JBE245 L. plantarum ATCC 8014
Genome size (bp) 3,434,822 3,212,261 3,392,093 3,262,611 3,309,473
GC content (%) 44.4 44.6 44.2 44.5 44.5
Annotated genes 3,500 3,011 3,395 3,172 3,217
tRNAs 52 67 54 70 66
rRNAs 16 16 4 16 13
Open in a new tab

Fig. 2. Phylogenetic tree constructed from the whole-genome sequences of L. plantarum LRCC5310 and related species.

Fig. 2

Open in a new tab

GBDP pseudo-bootstrap support values (%) based on 100 replications are displayed above the branches; only values >70% are shown. Bar, 0.02 substitutions per nucleotide position.

Fig. 3. Protein functional annotation based on the clusters of orthologous genes (COG) database showing the categorized protein functions of Lactiplantibacillus plantarum LRCC5310.

Fig. 3

Open in a new tab

(A) Information storage and processing categories. (B) Cellular processes and signaling categories. (C) Metabolism categories.

The annotated functional genes analyzed using the RAST server were categorized as follows: amino acids and derivatives (16.0%); cofactors, vitamins, prosthetic groups, and pigments (8.5%); and carbohydrates (19.7%). The genes categorized as amino acids and their derivatives included genes related to glutamine, glutamate, aspartate, asparagine, and ammonia assimilation (20 genes); histidine metabolism (8 genes); arginine, urea cycle, and polyamines (21 genes); and lysine, threonine, methionine, and cysteine (80 genes). The cofactors, vitamins, prosthetic groups, and pigments category included those related to biotin (4 genes); riboflavin, flavin mononucleotide, and flavin adenine dinucleotide (20 genes); pyridoxine (9 genes); nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) (9 genes); folate and pterines (40 genes); lipoic acid (3 genes); and coenzyme A (7 genes). The carbohydrates category included genes related to central carbohydrate metabolism (66 genes), amino sugars (7 genes), di- and oligosaccharides (46 genes), one-carbon metabolism (16 genes), organic acids (12 genes), fermentation (43 genes), sugar alcohols (18 genes), polysaccharides (5 genes), and monosaccharides (20 genes; Table S1).

Although the results of the VFDB analysis revealed detection of several putative virulence genes (coverage of >70%, similarity >70%, and e-value <0.0001), they were identified as non-harmful factors (Table S2). According to the COG database, these genes are related to general cellular functions, including carbohydrate transport and metabolism (G), cell wall/membrane/envelope biogenesis (M), and posttranslational modification, protein turnover, and chaperones (O). Moreover, L. plantarum LRCC5310 was identified as a non-human pathogen using PathogenFinder, while ResFinder and CARD analyses did not reveal any specific antibiotic resistance genes.

Functional Annotation of the Genome

The genome annotation of L. plantarum LRCC5310 revealed the presence of genes related to probiotic functions, including acid tolerance, bile salt tolerance, exopolysaccharide (EPS) production, and adhesion (Table 3). The L. plantarum LRCC5310 genome was found to encode six adenosine triphosphate (ATP) synthases (beta, gamma, epsilon, and delta chain, and subunits b and c), seven L-lactate dehydrogenases, ten Na+/H+ antiporters, and pyruvate kinase, which are responsible for the acid tolerance of the cell. In addition, four choloylglycine hydrolases, cytidine triphosphate (CTP) synthase, and glucosamine-6-phosphate deaminase associated with bile salt tolerance were identified in the genome. Furthermore, genes associated with adhesion, such as EPS biosynthetic gene clusters, sortase A (LPXTG-specific), and fibronectin/fibrinogen-binding protein, were also identified in the genome.

Table 3.

Putative functional genes detected in the genome of Lactiplantibacillus plantarum LRCC5310.

Gene (number of gene) FigFam number Related function
ATP synthase beta chain FIG00040241 Acid tolerance
ATP synthase gamma chain FIG00023994
ATP synthase epsilon chain FIG00000249
ATP synthase delta chain FIG00000262
ATP synthase subunit b FIG00000186
ATP synthase subunit c FIG00017607
L-lactate dehydrogenase (7) FIG00000812
Na+/H+ antiporter (10) FIG00008246
Pyruvate kinase FIG000043
Choloylglycine hydrolase (4) FIG00009563 Bile salt tolerance
CTP synthase FIG00000176
Glucosamine-6-phosphate deaminase FIG00000645
EPS biosynthetic gene clusters Adhesion
Tyrosine-protein kinase transmembrane modulator EpsC FIG00002620
Tyrosine-protein kinase EpsD FIG00035701
Exopolysaccharide biosynthesis glycosyltransferase EpsF –
Sortase A, LPXTG specific FIG00007328
Fibronectin/fibrinogen-binding protein FIG00138381
Open in a new tab

Comparative Genomic Analysis

Comparison of the orthologous average nucleotide identity (orthoANI) and digital DNA–DNA hybridization (dDDH) values between L. plantarum LRCC5310 and four reference L. plantarum strains showed similarities in the range of 98.8–98.9% (Fig. 4) and 89.2–91.6% (Table S3), respectively. The functional annotation of clusters was compared between L. plantarum LRCC5310 and four reference strains through the Venn diagram (Fig. 5). The L. plantarum LRCC5310 formed 2,736 gene clusters, 2,357 of which were shared with four reference strains. Fig. 6 shows the comparative genome map exhibiting the similarties of the whole genomes of the L. plantarum strains. These results suggested that strain LRCC5310 belongs to L. plantarum.

Fig. 4. OrthoANI values of L. plantarum LRCC5310 and closely related L. plantarum strains.

Fig. 4

Open in a new tab

Fig. 5. Venn diagram representing the orthologous genes shared between L. plantarum LRCC5310 and other L. plantarum strains.

Fig. 5

Open in a new tab

Fig. 6. Circular comparison map of L. plantarum LRCC5310 and other L. plantarum strains using the Proksee server.

Fig. 6

Open in a new tab

CRISPRFinder analysis revealed that L. plantarum LRCC5310, L. plantarum JBE 245, and L. plantarum ATCC 8014 harbored CRISPRs at different loci (Table S4). However, CRISPRs were not detected in L. plantarum ATCC 14917T and L. plantarum GD00040. Compared with that in the four L. plantarum strains, L. plantarum LRCC5310 only harbored trehalose biosynthesis genes (GBE, 1,4-alpha-glucan (glycogen) branching enzyme; and TE, trehalose phosphorylase) and trehalose utilization genes (TreR: trehalose operon transcriptional repressor, TreC: trehalose-6-phosphate hydrolase, PGM: beta-phosphoglucomutase, and TPP: trehalose 6-phosphate phosphorylase). Moreover, the L-arabinose utilization genes (AraA: L-arabinose isomerase, AraD: L-ribulose-5-phosphate 4-epimerase, AraE: arabinose-proton symporter, AraK: ribulokinase, and AraR: transcriptional repressor of arabinoside utilization operon) were only detected in the L. plantarum LRCC5310 genome. These results suggested that L. plantarum LRCC5310 has certain genetic differences when compared to other L. plantarum strains.

Vitamin B6 Metabolic Pathway

Gene annotation using the RAST server revealed that L. plantarum LRCC5310 harbored genes for the vitamin B6 biosynthetic pathway (Table 4). Furthermore, it encoded the relevant enzymes involved in the de novo vitamin B6 biosynthesis and salvage pathways, including pyridoxine kinase, pyridoxamine 5¢-phosphate oxidase, 1-deoxy-D-xylulose 5-phosphate synthase, phosphoserine aminotransferase, D-3-phosphoglycerate dehydrogenase, and NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (Fig. 7). The pathways for carbon metabolism and vitamin B6 biosynthesis were mapped to one synthetic pathway (Fig. 8). For combined carbohydrate metabolism, including monosaccharide and polysaccharide metabolism, 234 genes were mapped on the KEGG pathway. Based on the identified metabolic pathway, L. plantarum LRCC5310 can produce pyruvate and synthesize vitamin B6 (pyridoxin) from monosaccharides via the glycolytic pathway, also known as the Embden-Meyerhof-Parnas pathway. However, L. plantarum LRCC5310 could not produce alcohol while producing pyruvate from glucose. These findings indicated that L. plantarum LRCC5310 can metabolize hexoses via the Embden-Meyerhof-Parnas pathway and can produce vitamin B6.

Table 4.

Vitamin B6 biosynthesis gene encoding enzymes detected from the genome of Lactiplantibacillus plantarum LRCC5310 and reference strains.

Gene EC Number Product
gapB EC 1.2.1.12 NAD-dependent glyceraldehyde-3-phosphate dehydrogenase
SerC EC 2.6.1.52 Phosphoserine aminotransferase
dxs EC 2.2.1.7 1-deoxy-D-xylulose 5-phosphate synthase
SerA EC 1.1.1.95 D-3-phosphoglycerate dehydrogenase
PdxK EC 2.7.1.35 Pyridoxal kinase
PdxH EC 1.4.3.5 Pyridoxamine ’-phosphate oxidase
Open in a new tab

Fig. 7. Pathways showing the three types of vitamin B6 biosynthesis: de novo pathway, alternative pathway, and salvage pathway.

Fig. 7

Open in a new tab

Lactiplantibacillus plantarum LRCC5310 encoded genes related to the de novo pathway of vitamin B6 biosynthesis.

Fig. 8. Carbon and vitamin B6 metabolic pathways of Lactiplantibacillus plantarum LRCC5310 showing the main carbon sources involved in vitamin B6 biosynthesis.

Fig. 8

Open in a new tab

Identification of Pyridoxal 5’-Phosphate Concentration

The concentration of PLP corresponded with the increase of cell growth (Fig. 9). However, PLP levels were not significantly different from 2–5 h based on OD at 600 nm (Fig. S1). Compared with L. plantarum LRCC5310, the PLP levels of L. plantarum KCCM 43412 and L. plantarum KCCM 43243 showed no significant differences at 2 h (p = 0.9999 and p = 0.9947, respectively). L. plantarum LRCC5310 showed significantly lower PLP secretion than L. plantarum KCTC 3108T (p = 0.0191), whereas the level was significantly higher than that of L. plantarum KCTC 21024 (p < 0.0001). At 8 h of culture, L. plantarum LRCC5310 (88.08 ± 0.67 nM) showed higher final concentration of PLP than L. plantarum KCTC 3108T (80.40 ± 0.73 nM; p < 0.0001), L. plantarum KCCM 43412 (82.27 ± 0.26 nM; p < 0.0001), L. plantarum KCCM 43243 (78.10 ± 0.39 nM; p < 0.0001) and L. plantarum KCTC 21024 (83.97 ± 0.04 nM; p = 0.0002).

Fig. 9. Concentration of pyridoxal 5’-phosphate produced by L. plantarum LRCC5310 and four L. plantarum strains.

Fig. 9

Open in a new tab

The PLP concentration was measured in the culture supernatant at specific time points. Significance with L. plantarum LRCC5310 is indicated as *p < 0.05, ** p < 0.001, *** p < 0.0005, **** p < 0.0001.

mRNA Expression Analysis of Vitamin B6 Metabolic Genes

The expression levels of the de novo vitamin B6 biosynthesis genes of L. plantarum LRCC5310, including gapB, SerC, dxs, and SerA, were significantly higher than those of the other L. plantarum strains (Fig. 10). Moreover, the expression levels of the salvage pathway- related genes of L. plantarum LRCC5310, such as PdxK and PdxH, were also significantly higher than those of the reference strains. These results were similar with those related to the PLP concentrations.

Fig. 10. mRNA expression of vitamin B6 metabolic genes in L. plantarum LRCC5310 and four other L. plantarum strains.

Fig. 10

Open in a new tab

Target mRNA expression levels including those of (A) gapB, (B) SerC, (C) dxs, (D) SerA, (E) PdxK, and (F) PdxH were determined by real-time PCR. Data are represented as mean ± standard error of the mean (SEM) and significance marks (*p < 0.05; **p < 0.001; ***p < 0.0005; ****p < 0.0001) indicate differences relative to the mean of L. plantarum LRCC5310.

Discussion

L. plantarum is a well-known probiotic strain that has been isolated from various environments and its safety and health-promoting effects for humans are widely reported. In the present study, the orthoANI analysis of L. plantarum LRCC5310 showed that this strain shares high similarity with other L. plantarum strains, while its G+C content coincides with the average value for the other L. plantarum strains [36]. The phylogenetic tree based on 16S rRNA genes supported these results and indicated that the strain LRCC5310 is indeed an L. plantarum strain.

Most LAB strains include only complete ribosomal RNA (rrn) operon; however, L. plantarum was shown to harbor an additional 5S rRNA gene in the ribosome region [37]. Moreover, other recent studies have shown that the genomes of several L. plantarum strains encode 16S rRNAs [38-39]. According to the gene annotation, L. plantarum LRCC5310 genome harbored the genes for 16 rRNAs, comprising 5 complete rrn operons and one additional 5S rRNA gene. This result suggested that the L. plantarum LRCC5310 genome shared similar characteristics with those of other L. plantarum strains.

The safety assessment of new probiotic candidates require evaluation as studies have reported infections due to the consumption of probiotics [40]. Moreover, the European Food Safety Authority recommends that bacterial strains that harbor antibiotic resistance genes should not be used as probiotics for animals and humans [41]. For the safety assessment of potential probiotic strains, a whole-genome analysis is therefore preferred [42]. According to the ResFinder and CARD results, L. plantarum LRCC5310 did not harbor antibiotic resistance genes. Certain virulence genes are involved in interactions of host-microbe, cell adhesion, and host defense [42]. Based on VFDB, virulence genes found in the genome of L. plantarumLRCC5310 are associated with host defense (clpP, groEL), cellular metabolism (lipid; gtaB, carbohydrate; eno), and adhesion (plr/gapA). clpP and groEL are related to overcoming the harsh conditions of acid and bile stress [43]. gtaB is associated with the production of cell wall components, such as glycolipids and capsular polysaccharides [44]. eno plays a role in the glucose metabolism pathway [45] and plr/gapA encode for cell adhesion-related functions [46]. These results showed that L. plantarum LRCC5310 is safe for use as a potential probiotic strain.

Probiotic strains need to survive the complexity of the gastrointestinal tract and tolerate acid stress and bile salt. L. plantarum LRCC5310 possesses several genes that enhance survival in the host. ATP synthases are known to be involved in regulation of cytoplasmic pH, which allows maintenance of pH homeostasis and protection induced by an acidic environment [47]. Desriac et al. [48] reported that lactate dehydrogenase restores NAD+/NADH balance and increases ATP production which improves acid tolerance. Na+/H+ antiporters are associated in Na+ and pH homeostasis [49]. Glucose-6-phosphate deaminase and pyruvate kinase are involved in acid/bile salt tolerance in bacteria [50]. Moreover, an important characteristic of probiotic strains is adhesion to mucosa or epithelium [51]. The genome of L. plantarum LRCC5310 contains EPS biosynthetic genes, which play a major role in adhesion and biofilm formation, as well as in antimicrobial and antioxidant properties [52]. Sortase A, an LPXTG-specific enzyme, is thought to cleave a covalently-anchored surface protein precursor, which is then subsequently transferred from the cell wall to the cell membrane [53]. Fibronectin links the cells with their extracellular matrix and is associated in adhesion [54]. In conclusion, L. plantarum LRCC5310 harbored genes related to probiotic functions.

Based on hexose metabolism, LAB can be classified into two types: heterofermentative and homofermentative. L. plantarum strains are homofermentative LAB that metabolize hexoses via the Embden-Meyerhof-Parnas pathway [55]. The carbon metabolic pathway based on in silico analysis showed that L. plantarum LRCC5310 can utilize galactose, glucose, and fructose via this pathway.

Moreover, the present study revealed that L. plantarum LRCC5310 and the reference strains harbored genes involved in vitamin B6 biosynthesis, while in the in vitro experiment, the PLP concentration and mRNA expression of L. plantarum LRCC5310 were higher than those of reference strains at the exponential phase. The active form of vitamin B6 is pyridoxal 5¢-phosphate (PLP), which acts as a coenzyme for regulating neurotransmitters as well as amino acid metabolism [56]. Furthermore, vitamin B6 can prevent the formation of advanced glycation end products and the onset of diabetes related to genotoxic compounds [57] while also reducing postprandial blood glucose levels by inhibiting α-glucosidase activity in the small intestine [58].

In the current study, we analyzed the complete genome of L. plantarum LRCC5310 and highlighted its genomic features, carbon metabolic pathway, and functional genes. Genomic analysis confirmed that L. plantarum LRCC5310 harbored vitamin B6 biosynthetic genes, which allow for the production and utilization of vitamin B6. In addition, L. plantarum LRCC5310 possessed genes involved in acid/bile salt tolerance and adhesion. These results suggest that L. plantarum LRCC5310 has the potential for use as a beneficial functional probiotic strain.

Supplemental Materials

jmb-33-5-644-supple.pdf (207.5KB, pdf)

Supplementary data for this paper are available on-line only at http://jmb.or.kr.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (NRF-2021R1C1C2003223 and NRF-2022R1A2C2012209), and the Chung-Ang University Research Grants in 2022.

Footnotes

Availability of Data

The data set of this study has been deposited in DDBJ/EMBL/GenBank International Nucleotide Sequence Database under the whole genome accession number: JAINTZ000000000 (https://www.ncbi.nlm.nih.gov/nuccore/JAINTZ000000000) and BioProject: PRJNA757840 (https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA757840).

Conflict of Interest

The authors have no financial conflicts of interest to declare.

References

  • 1.Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, et al. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014;11:506–514. doi: 10.1038/nrgastro.2014.66. [DOI] [PubMed] [Google Scholar]
  • 2.Kim DH, Jeong D, Kang IB, Kim H, Song KY, Seo KH. Dual function of Lactobacillus kefiri DH5 in preventing high‐fatdiet‐ induced obesity: direct reduction of cholesterol and upregulation of PPAR‐α in adipose tissue. Mol. Nutr. Food Res. 2017;61:1700252. doi: 10.1002/mnfr.201700252. [DOI] [PubMed] [Google Scholar]
  • 3.Bejar W, Hamden K, Ben Salah RB, Chouayekh H. Lactobacillus plantarum TN627 significantly reduces complications of alloxan-induced diabetes in rats. Anaerobe. 2013;24:4–11. doi: 10.1016/j.anaerobe.2013.08.006. [DOI] [PubMed] [Google Scholar]
  • 4.Lee ES, Song EJ, Nam YD, Lee SY. Probiotics in human health and disease: from nutribiotics to pharmabiotics. J. Microbiol. 2018;56:773–782. doi: 10.1007/s12275-018-8293-y. [DOI] [PubMed] [Google Scholar]
  • 5.Zheng J, Wittouck S, Salvetti E, Franz CM, Harris HM, Mattarelli P, et al. A taxonomic note on the genus Lactobacillus: description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020;70:2782–2858. doi: 10.1099/ijsem.0.004107. [DOI] [PubMed] [Google Scholar]
  • 6.Sankar NR, Priyanka VD, Reddy PS, Rajanikanth P, Kumar VK, Indira M. Purification and characterization of bacteriocin produced by Lactobacillus plantarum isolated from cow milk. Int. J. Microbiol. Res. 2012;3:133–137. [Google Scholar]
  • 7.Rejiniemon TS, Hussain RR, Rajamani B. In-vitro functional properties of Lactobacillus plantarum isolated from fermented ragi malt. S. Ind. J. Biol. Sci. 2015;1:15–23. doi: 10.22205/sijbs/2015/v1/i1/100437. [DOI] [Google Scholar]
  • 8.Ribeiro SC, Stanton C, Yang B, Ross RP, Silva CCG. Conjugated linoleic acid production and probiotic assessment of Lactobacillus plantarum isolated from Pico cheese. LWT. 2018;90:403–411. doi: 10.1016/j.lwt.2017.12.065. [DOI] [Google Scholar]
  • 9.Yang EJ, Chang HC. Antifungal activity of Lactobacillus plantarum isolated from kimchi. Microbiol. Biotechnol. Lett. 2008;36:276–284. [Google Scholar]
  • 10.Chong HX, Yusoff NAA, Hor YY, Lew LC, Jaafar M, Choi SB, et al. Lactobacillus plantarum DR7 alleviates stress and anxiety in adults: a randomised, double-blind, placebo-controlled study. Benef. Microbes. 2019;10:55–373. doi: 10.3920/BM2018.0135. [DOI] [PubMed] [Google Scholar]
  • 11.Spinler JK, Sontakke A, Hollister EB, Venable SF, Oh PL, Balderas MA, et al. From prediction to function using evolutionary genomics: human-specific ecotypes of Lactobacillus reuteri have diverse probiotic functions. Genome Biol. Evol. 2014;6:1772–1789. doi: 10.1093/gbe/evu137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Beck BR, Park GS, Lee YH, Im S, Jeong DY, Kang J. Whole genome analysis of Lactobacillus plantarum strains isolated from kimchi and determination of probiotic properties to treat mucosal infections by Candida albicans and Gardnerella vaginalis. Front. Microbiol. 2019;10:433. doi: 10.3389/fmicb.2019.00433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Douillard FP, Ribbera A, Jï HM, Kant R, Pietilä TE, Randazzo C, et al. Comparative genomic and functional analysis of Lactobacillus casei and Lactobacillus rhamnosus strains marketed as probiotics. Appl. Environ. Microbiol. 2013;79:1923–1933. doi: 10.1128/AEM.03467-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fitzpatrick TB, Amrhein N, Kappes B, Macheroux P, Tews I, Raschle T. Two independent routes of de novo vitamin B6 biosynthesis: not that different after all. Biochem. J. 2007;407:1–13. doi: 10.1042/BJ20070765. [DOI] [PubMed] [Google Scholar]
  • 15.Hellmann H, Mooney S. Vitamin B6: a molecule for human health? Molecules. 2010;15:442–459. doi: 10.3390/molecules15010442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Colinas M, Eisenhut M, Tohge T, Pesquera M, Fernie AR, Weber AP, et al. Balancing of B6 vitamers is essential for plant development and metabolism in Arabidopsis. Plant Cell. 2016;28:439–453. doi: 10.1105/tpc.15.01033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wrenger C, Eschbach ML, Müller IB, Warnecke D, Walter RD. Analysis of the vitamin B6 biosynthesis pathway in the human malaria parasite Plasmodium falciparum. J. Biol. Chem. 2005;280:5242–5248. doi: 10.1074/jbc.M412475200. [DOI] [PubMed] [Google Scholar]
  • 18.Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, editors. Nucleic Acid Techniques in Bacterial Systematic. John Wiley and Sons; New York, USA: 1991. pp. 115–175. [Google Scholar]
  • 19.Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL. NCBI BLAST: a better web interface. Nucleic Acids Res. 2008;36:W5–W9. doi: 10.1093/nar/gkn201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019;10:2182. doi: 10.1038/s41467-019-10210-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: rapid annotations using subsystems technology. BMC Genomics. 2008;9:75. doi: 10.1186/1471-2164-9-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, et al. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016;44:6614–6624. doi: 10.1093/nar/gkw569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Davis JJ, Wattam AR, Aziz RK, Brettin T, Butler R, Butler RM, et al. The PATRIC Bioinformatics Resource Center: expanding data and analysis capabilities. Nucleic Acids Res. 2020;48:D606–D612. doi: 10.1093/nar/gkz943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wu S, Zhu Z, Fu L, Niu B, Li W. WebMGA: a customizable web server for fast metagenomic sequence analysis. BMC Genomics. 2011;12:444. doi: 10.1186/1471-2164-12-444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kanehisa M, Goto S, Sato Y, Kawashima M, Furumichi M, Tanabe M. Data, information, knowledge and principle: back to metabolism in KEGG. Nucleic Acids Res. 2014;42:D199–D205. doi: 10.1093/nar/gkt1076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Alcock BP, Raphenya AR, Lau TT, Tsang KK, Bouchard M, Edalatmand A, et al. CARD 2020: antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2020;48:D517–D525. doi: 10.1093/nar/gkz935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bortolaia V, Kaas RS, Ruppe E, Roberts MC, Schwarz S, Cattoir V, et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020;75:3491–3500. doi: 10.1093/jac/dkaa345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu B, Zheng D, Jin Q, Chen L, Yang J. VFDB 2019: a comparative pathogenomic platform with an interactive web interface. Nucleic Acids Res. 2019;47:D687–D692. doi: 10.1093/nar/gky1080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cosentino S, Voldby Larsen M, Møller Aarestrup F, Lund O. PathogenFinder-distinguishing friend from foe using bacterial whole genome sequence data. PLoS One. 2013;8:e77302. doi: 10.1371/journal.pone.0077302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lee I, Kim YO, Park SC, Chun J. OrthoANI: an improved algorithm and software for calculating average nucleotide identity. Int. J. Syst. Evol. Microbiol. 2016;66:1100–1103. doi: 10.1099/ijsem.0.000760. [DOI] [PubMed] [Google Scholar]
  • 32.Meier-Kolthoff JP, Auch AF, Klenk HP, Göker M. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics. 2013;14:60. doi: 10.1186/1471-2105-14-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35:W52–W57. doi: 10.1093/nar/gkm360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Smetanková J, Hladíková Z, Valach F, Zimanová M, Kohajdová Z, Greif G, et al. Influence of aerobic and anaerobic conditions on the growth and metabolism of selected strains of Lactobacillus plantarum. Acta. Chimica. Slovaca. 2012;5:204. doi: 10.2478/v10188-012-0031-1. [DOI] [Google Scholar]
  • 35.Byun R, Nadkarni MA, Chhour KL, Martin FE, Jacques NA, Hunter N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J. Clin. Microbiol. 2004;42:3128–3136. doi: 10.1128/JCM.42.7.3128-3136.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yu J, Ahn S, Kim K, Caetano-Anolles K, Lee C, Kang J, et al. Comparative genomic analysis of Lactobacillus plantarum GB-LP1 isolated from traditional Korean fermented food. J. Microbiol. Biotechnol. 2017;27:1419–1427. doi: 10.4014/jmb.1704.04005. [DOI] [PubMed] [Google Scholar]
  • 37.Moghadam MS, Foo HL, Leow TC, Rahim RA, Loh TC. Novel bacteriocinogenic Lactobacillus plantarum strains and their differentiation by sequence analysis of 16S rDNA, 16S-23S and 23S-5S intergenic spacer regions and randomly amplified polymorphic DNA analysis. Food Technol. Biotechnol. 2010;48:476–483. [Google Scholar]
  • 38.El Halfawy NM, El Naggar MY, Andrews SC. Complete genome sequence of Lactobacillus plantarum 10CH, a potential probiotic lactic acid bacterium with potent antimicrobial activity. Genome. Announc. 2017;5:e01398–17. doi: 10.1128/genomeA.01398-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wan KH, Yu C, Park S, Hammonds AS, Booth BW, Celniker SE. Complete genome sequence of Lactobacillus plantarum oregon-R-modENCODE strain BDGP2 isolated from Drosophila melanogaster gut. Genome Announc. 2017;5:e01155–17. doi: 10.1128/genomeA.01155-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.De Jesus LCL, De Jesus Sousa T, Coelho-Rocha ND, Profeta R, Barroso FAL, Drumond MM, et al. Safety evaluation of Lactobacillus delbrueckii subsp. lactis CIDCA 133: a health-promoting bacteria. Probiotics Antimicrob. Proteins. 2021;13:1–14. doi: 10.1007/s12602-021-09826-z. [DOI] [PubMed] [Google Scholar]
  • 41.European Food Safety Authority (EFSA), author Introduction of a Qualified Presumption of Safety (QPS) approach for assessment of selected microorganisms referred to EFSA‐Opinion of the Scientific Committee. EFSA. Jol. 2007;5:587. doi: 10.2903/j.efsa.2007.587. [DOI] [Google Scholar]
  • 42.Li B, Zhan M, Evivie SE, Jin D, Zhao L, Chowdhury S, et al. Evaluating the safety of potential probiotic Enterococcus durans KLDS6.0930 using whole genome sequencing and oral toxicity study. Front. Microbiol. 2018;9:1943. doi: 10.3389/fmicb.2018.01943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Papadimitriou K, Alegría Á, Bron PA, de Angelis M, Gobbetti M, Kleerebezem M, et al. Stress physiology of lactic acid bacteria. Microbiol. Mol. Biol. Rev. 2016;80:837–890. doi: 10.1128/MMBR.00076-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tran TD, Ali MA, Lee D, Félix MA, Luallen RJ. Bacterial filamentation as a mechanism for cell-to-cell spread within an animal host. Nat. Commun. 2022;13:693. doi: 10.1038/s41467-022-28297-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yang Z, Xu M, Li Q, Wang T, Zhang B, Zhao H, et al. The beneficial effects of polysaccharide obtained from persimmon (Diospyros kaki L.) on the proliferation of Lactobacillus and gut microbiota. Int. J. Biol. Macromol. 2021;182:1874–1882. doi: 10.1016/j.ijbiomac.2021.05.178. [DOI] [PubMed] [Google Scholar]
  • 46.Zhang C, Ma K, Nie K, Deng M, Luo W, Wu X, et al. Assessment of the safety and probiotic properties of Roseburia intestinalis: a potential "next generation probiotic". Front. Microbiol. 2022;13:973046. doi: 10.3389/fmicb.2022.973046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Liu Y, Tang H, Lin Z, Xu P. Mechanisms of acid tolerance in bacteria and prospects in biotechnology and bioremediation. Biotechnol. Adv. 2015;33:1484–1492. doi: 10.1016/j.biotechadv.2015.06.001. [DOI] [PubMed] [Google Scholar]
  • 48.Desriac N, Broussolle V, Postollec F, Mathot AG, Sohier D, Coroller L, et al. Bacillus cereus cell response upon exposure to acid environment: toward the identification of potential biomarkers. Front. Microbiol. 2013;4:284. doi: 10.3389/fmicb.2013.00284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Padan E, Venturi M, Gerchman Y, Dover N. Na(+)/H(+) antiporters. Biochim. Biophys. Acta. 2001;1505:144–157. doi: 10.1016/S0005-2728(00)00284-X. [DOI] [PubMed] [Google Scholar]
  • 50.Oliveira LC, Saraiva TD, Silva WM, Pereira UP, Campos BC, Benevides LJ, et al. Analyses of the probiotic property and stress resistance-related genes of Lactococcus lactis subsp. lactis NCDO 2118 through comparative genomics and in vitro assays. PLoS One. 2017;12:e0175116. doi: 10.1371/journal.pone.0175116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lim SM. Antimutagenicity activity of the putative probiotic strain Lactobacillus paracasei subsp. tolerans JG22 isolated from pepper leaves Jangajji. Food. Sci. Biotechnol. 2014;23:141–150. doi: 10.1007/s10068-014-0019-2. [DOI] [Google Scholar]
  • 52.Wu Q, Tun HM, Leung FCC, Shah NP. Genomic insights into high exopolysaccharide-producing dairy starter bacterium Streptococcus thermophilus ASCC 1275. Sci. Rep. 2014;4:4974. doi: 10.1038/srep04974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Zeng Z, Zuo F, Marcotte H. Putative adhesion factors in vaginal Lactobacillus gasseri DSM 14869: functional characterization. Appl. Environ. Microbiol. 2019;85:e00800–19. doi: 10.1128/AEM.00800-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Henderson B, Nair S, Pallas J, Williams MA. Fibronectin: a multidomain host adhesin targeted by bacterial fibronectin-binding proteins. FEMS. Microbiol. Rev. 2011;35:147–200. doi: 10.1111/j.1574-6976.2010.00243.x. [DOI] [PubMed] [Google Scholar]
  • 55.Gänzle MG. Lactic metabolism revisited: metabolism of lactic acid bacteria in food fermentations and food spoilage. Curr. Opin. Food Sci. 2015;2:106–117. doi: 10.1016/j.cofs.2015.03.001. [DOI] [Google Scholar]
  • 56.Di Salvo ML, Contestabile R, Safo MK. Vitamin B6 salvage enzymes: mechanism, structure and regulation. Biochim. Biophys. Acta. 2011;1814:1597–1608. doi: 10.1016/j.bbapap.2010.12.006. [DOI] [PubMed] [Google Scholar]
  • 57.Booth AA, Khalifah RG, Todd P, Hudson BG. In vitro kinetic studies of formation of antigenic advanced glycation end products (AGEs): novel inhibition of post-Amadori glycation pathways. J. Biol. Chem. 1997;272:5430–5437. doi: 10.1074/jbc.272.9.5430. [DOI] [PubMed] [Google Scholar]
  • 58.Kim HH, Kang YR, Lee JY, Chang HB, Lee KW, Apostolidis E, et al. The postprandial anti-hyperglycemic effect of pyridoxine and its derivatives using in vitro and in vivo animal models. Nutrients. 2018;10:285. doi: 10.3390/nu10030285. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

jmb-33-5-644-supple.pdf (207.5KB, pdf)

Supplementary data for this paper are available on-line only at http://jmb.or.kr.

Articles from Journal of Microbiology and Biotechnology are provided here courtesy of Korean Society for Microbiology and Biotechnology

RESOURCES