Nicotinamide mononucleotide supplementation mitigates osteopenia induced by modeled microgravity in rats

Abstract

Exposure to weightlessness causes severe osteopenia, resulting in raised fracture risk. The current study aimed to investigate whether nicotinamide mononucleotide (NMN) supplementation protected against the osteopenia in hindlimb unloading (HLU) rats in vivo and modeled microgravity-induced osteoblastic dysfunction in vitro. The 3-mo-old rats were exposed to HLU and intragastrically administered NMN every 3 days (500 mg/kg body weight) for 4 weeks. NMN supplementation mitigated HLU-induced bone loss, evidenced by greater bone mass and biomechanical properties and better trabecular bone structure. NMN supplementation mitigated HLU-induced oxidative stress, evidenced by greater levels of nicotinamide adenine dinucleotide and activities of superoxide dismutase 2 and lesser malondialdehyde levels. Modeled microgravity stimulation using rotary wall vessel bioreactor in MC3T3-E1 cells inhibited osteoblast differentiation, which was reversed by NMN treatment. Furthermore, NMN treatment mitigated microgravity-induced mitochondrial impairments, evidenced by lesser reactive oxygen species generation and greater adenosine triphosphate production, mtDNA copy number, and activities of superoxide dismutase 2 and Complex I and II. Additionally, NMN promoted activation of AMP-activated protein kinase (AMPK), evidenced by greater AMPKα phosphorylation. Our research suggested that NMN supplementation attenuated osteoblastic mitochondrial impairment and mitigated osteopenia induced by modeled microgravity.

Introduction

Osteopenia is one of the well documented phenomena for crew members during a long spaceflight or patients subjected to long-term bed rest, which results in increased fracture risk (Coulombe et al. 2020; Frings-Meuthen et al. 2019). Numerous investigations have demonstrated that impaired osteoblastic function played an important role in weightlessness or microgravity‐induced osteopenia (Morey and Baylink 1978; Cao et al. 2021). Countermeasures including exercise regimes and supplementation of vitamin D, calcium and bisphosphonates developed to date are ineffective for prevention of bone loss following microgravity (Smith et al. 1999). Development of novel anti-osteoporotic drugs is required for space travelers and geriatric population.

As a crucial intermediate during biosynthesis of nicotinamide adenine dinucleotide (NAD⁺), accumulating evidence revealed that nicotinamide mononucleotide (NMN) was able to reverse defects in mitochondrial homeostasis, redox state, cell survival, as well as DNA repair caused by deficiency of NAD⁺ (Croteau et al. 2017). Recent preclinical studies have demonstrated NMN administration as a promising therapeutic compound to extend the lifespan and exert diverse pharmacological actions in various diseases (Covarrubias et al. 2021; Hong et al. 2020). Long-term NMN supplementation mitigated age-associated and aluminum-induced osteoporosis in animal experiments (Mills et al. 2016; Liang et al. 2019). In vitro, NMN treatment promoted osteogenesis and self-renewal of mesenchymal stromal cells (Song et al. 2019), and attenuated dexamethasone-induced osteogenic inhibition in bone mesenchymal stem cells (Huang and Tao 2020).

Our work aimed to test the therapeutic role of NMN supplementation on the osteopenia in hindlimb unloading (HLU) rats in vivo and osteogenic inhibition induced by stimulated microgravity in vitro and elucidate the possible mechanisms.

Material and methods

HLU model and NMN treatment

Three-month-old Wistar rats, obtained from Vital-River Animal Ltd (SCXK 2015–0002, Beijing, China), were fed with standard rodent chow and distilled tap water at an appropriate temperature (about 22 °C) with 12 h light/dark cycle. All experiments involving rats had been approved by the Institutional Animal Care and the Animal Ethics Committee of Xi'an Jiaotong University (No. 202104017).

Briefly, orthopedic adhesive tapes were applied along the proximal 1/3 of tails of animals and placed by using a metal ring, attaching with a metal bar on the top of the cage as previously described (Xin et al. 2015). Control animals were individually housed in same cage as HLU rats. NMN (every 3 days, 500 mg/kg) (Wan et al. 2021; Lee et al. 2016) or vehicle was intragastrically administered in both groups for 4 weeks. Animals were sacrificed with an intraperitoneal injection of 30 μg/g xylazine and 300 μg/g ketamine at the end of study. Then, blood and samples of femurs and tibiae were harvested for further measurements. The detail of methods was shown in the supplementary data.

Cell culture and study design

The murine MC3T3-E1 cell (an osteoblastic cell line, Chinese Academy of Sciences Cell Bank, Shanghai, China) was cultured using α-MEM (gentamicin, 100 μg/ml; fetal bovine serum, 10%). Microgravity of 10⁻²G in vitro was modeled in cultured cells using the rotary wall vessel bioreactor (RWVB, Synthecon, Houston) as previously described (Zayzafoon et al. 2004).

Cells were cultured in osteogenic medium with 10 mM β-glycerophosphate under modeled microgravity or normal gravity and treated with NMN (0.1 or 1 mM) (Liang et al. 2019; Ryu et al. 2018) for 7 days. Activities of alkaline phosphatase (ALP) were determined using a kit (KA1642, Novus Biologicals, Littleton, CO, USA).

Cells were cultured under modeled microgravity with NMN or not for 96 h. The levels of osteopontin (OPN) and runt-related transcription factor 2 (Runx2) mRNA were determined using real-time polymerase chain reaction (RT-PCR).

Assessment of bone loss

The right femurs and tibiae were subjected to the dual energy X-ray test (Hologic, USA) to determine the bone mineral density (BMD) of the whole femurs and tibiae. Trabecular bone morphometry analysis in proximal tibiae (volume of interest: starting from the lowest point of the growth plate and extending toward the diaphysis for 1500 μm) was conducted by using μCT (Yang et al. 2015) with a 10.5-μm voxel size. The mechanical characteristics of midshaft of femurs were determined using a Bose Electro Force Testing System (ELF3510, Eden Prairie, USA).

Biochemical analysis

Urinary deoxypyridinoline (DPD) levels were determined with a kit (QUIDEL Corporation, CA, USA) to assess bone resorption and the final result of each sample was corrected for its creatinine concentration. Creatine levels in urine were assayed with a Creatinine Assay Kit (Colorimetric/Fluorometric, ab65339, Abcam, Cambridge, MA, USA). Serum levels of Ca²⁺ were assayed using the Hitachi 7170 autoanalyzer (Hitachi, Tokyo, Japan). Content of C-terminal cross-linked telopeptides of type I collagen (CTX, NBP2-82,444) and osteocalcin (NBP2-68,153) and activities of ALP (KA1642, Novus Biologicals) in serum and levels of malondialdehyde (MDA, KA1381) and activity of superoxide dismutase 2 (SOD2, DYC3419-2) in femurs were determined using kits obtained from Novus Biologicals (Littleton, CO, USA). The levels of NAD⁺ were assayed using an assay kit (K958, BioVision, USA).

Quantitative RT-PCR measurement

Femurs and cultured cells were harvested and total RNAs were then extracted using TRIzol reagent (R0016, Beyotime Biotechnology). The total RNAs concentrations were measured through the Spectrophotometer (NanoDrop 2000, Thermo Fisher, MA, USA). RT-PCR measurement was done using a RT-PCR Kit (Beyotime Biotechnology, D7268M). Transcription levels of genes of interest were quantified by 2^−ΔΔCt method. The information of primers was shown in Table 1.

Table 1.

Primers sequences used in current study

Genes		Sequence (5’-3’)
OPN (mouse)	Sense	GACCACAGGACGACGATG
	Antisense	TGGAACTTGCTTGACTATCGA
Runx2 (mouse)	Sense	GACTGTGGTTACCGTCATGGC
	Antisense	ACTTGGTTTTTCATAACAGCGGA
Osterix (mouse)	Sense	CTGCGGAAAGGAGGCACAAAGAAG
	Antisense	GGGTTAAGGGGAGCAAAGTCAGAT
Osteocalcin (mouse)	Sense	ACGGTATCACTATTTAGGACCTGTG
	Antisense	ACTTTATTTTGGAGCTGCTGTGAC
Col1a1 (mouse)	Sense	ATGTTCAGCTTTGTGGACCTC
	Antisense	CAGAAAGCACAGCACTCGC
COX-1 (mouse)	Sense	ATTGCCCTCCCCTCTCTACGCA
	Antisense	CGTAGCTTCAGTATCATTGGTGCCC
β-actin (mouse)	Sense	CCATGTTCCAAAACCATTCC
	Antisense	GGGCAACCTTCCCAATAAAT
GAPDH	Sense	TATGTCGTGGAGTCTACTGGT
(mouse)	Antisense	GAGTTGTCATATTTCTCGTGG
ALP (rat)	Sense	GGGTCAAGGCCAACTACAAGA
	Antisense	CACTGGTCTAATCGAGCAGC
Osteocalcin (rat)	Sense	TCTCTGCTCACTCTGCTGG
	Antisense	GTGGTGCCATAGATGCGCT
TRAP (rat)	Sense	AATTGCCTACTCCAAGATCTCCAA
	Antisense	GCGGAACTTTGAAACGCAAA
GAPDH (rat)	Sense	TATCACTCTACCCACGGCAAG
	Antisense	ATACTCAGCACCAGCATCACC

Measurement of mitochondrial function

Lucigenin-enhanced chemiluminescence was applied for detection of mitochondrial reactive oxygen species (ROS). Mitochondrial adenosine triphosphate (ATP) was quantified using a kit (BioVision). The complex I and II activities were assayed as described previously (Maher et al. 2007). The intracellular NAD⁺ content was determined using the kit described above. The mitochondrial copy number was detected using PCR method as described previously (Zhai et al. 2019) using cyclooxygenase-1 (COX-1) and β-actin as marker of mitochondrial DNA and nuclear DNA, respectively. The primer pairs of COX-1 and β-actin were shown in Table 1.

Western blot

The concentration of protein preparation was detected using a Beyotime bradford protein assay kit (Beyotime). Protein preparations of 25 μg were separated on SDS–polyacrylamide gels, and transferred to PVDF membranes (0.2 μm), and incubated with antibodies. Antibodies used in our work included anti-p-AMPKα (Thr172) (1:800; #50,081, CST, USA), anti-AMPKα (1:800; #5831, CST), and anti-GAPDH (1:5000; ab8245, Abcam).

Statistics

Two-way ANOVA followed by Tukey–Kramer test was applied for our statistical work using software of GraphPad Prism 9.0 (San Diego, CA). Differences were considered significant statistically at P-values < 0.05. All data of current investigation were expressed as mean ± SD.

Results

Benefits of NMN supplementation on bone loss in HLU rats

Adult rats were challenged with HLU exposure and intragastrically administered NMN or vehicle for 4 weeks. As compared to control rats, HLU rats displayed lower femoral and tibial BMD (Fig. 1a, b). NMN supplementation mitigated HLU-induced bone loss, evidenced by greater femoral and tibial BMD.

Fig. 1.

Benefits of NMN on the osteoporosis-like phenotype in HLU rats. Femoral (a) and tibial (b) BMD, trabecular bone morphometry including BV/TV, Tb.Th, Tb.N, Tb.Sp, and BMD (c-g) of proximal tibiae, and biomechanical properties including ultimate load (h), stiffness (i), and energy to max force (j) of femur midshaft were presented. * P < 0.05 vs. Control animals treated with vehicle; # P < 0.05 vs. HLU animals treated with vehicle. n = 8 or 5/group

As compared to control rats, HLU rats displayed impaired bone morphometry of proximal tibiae, evidenced by lesser bone volume/total volume (BV/TV, Fig. 1c), trabecular thickness (Tb.Th, Fig. 1d), trabecular number (Tb.N, Fig. 1e), and trabecular BMD (Fig. 1g), and greater trabecular separation (Tb.Sp, Fig. 1f), which was reversed by NMN supplementation, at least in part.

As compared to control rats, HLU rats displayed impaired biomechanical properties of femur midshaft, evidenced by lesser ultimate load (Fig. 1h), stiffness (Fig. 1i), and energy to max force (Fig. 1j), which was also mitigated by NMN supplementation.

Effects of NMN supplementation on the biomarkers of bone metabolism

When compared to control animals, HLU animals displayed lesser body weight (Fig. 2a) and levels of Ca²⁺ (Fig. 2b), activities of ALP (Fig. 2c), and levels of osteocalcin (Fig. 2d) in serum and greater urinary DPD levels (Fig. 2e) and serum CTX levels (Fig. 2f). Body weight, serum levels of Ca²⁺ or CTX, and urinary levels of DPD in HLU + NMN animals were similar with that in HLU animals. Serum levels of ALP activities and osteocalcin in HLU + NMN animals were greater than that in HLU animals.

Fig. 2.

Benefits of NMN on the biomarkers of bone metabolism in vivo. Graphs showed the body mass (a), serum levels of Ca²⁺ (b), ALP activity (c), osteocalcin (d) and CTX (f), and urinary levels of DPD (e). * P < 0.05 vs. Control animals treated with vehicle; # P < 0.05 vs. HLU animals treated with vehicle. n = 8/group

As compared to control rats, ALP (Fig. 3a) and osteocalcin (Fig. 3b) mRNA levels were lesser and tartrate-resistant acid phosphatase (TRAP) mRNA level was greater (Fig. 3c) in femurs of HLU rats. The femoral mRNA levels of ALP and osteocalcin in HLU + NMN animals were greater than that in HLU animals. The mRNA levels of TRAP in femurs were similar between HLU + NMN animals and HLU animals.

Fig. 3.

Modulation of NMN on the biomarkers involved in osteoclastogenesis and osteoblastogenesis. Graphs showed femoral mRNA levels of ALP (a), osteocalcin (b) and TARP (c). * P < 0.05 vs. Control animals treated with vehicle; # P < 0.05 vs. HLU animals treated with vehicle. n = 8/group

Antioxidant effects of NMN supplementation in HLU rats

As compared to control rats, levels of NAD⁺ (Fig. 4a) in femurs of HLU rats were lower. Femoral levels of NAD⁺ were greater in both control and HLU animals after NMN supplementation.

Fig. 4.

Modulation of NMN on oxidative stress and NAD⁺ levels. Graphs presented femoral NAD⁺ content (a) and MDA content (b) and SOD2 activity (c). * P < 0.05 vs. Control animals treated with vehicle; # P < 0.05 vs. HLU animals treated with vehicle. n = 8/group

As compared to control rats, MDA production (Fig. 4b) in femurs of HLU rats were higher, which was reversed by NMN partly.

Activities of SOD2 (Fig. 4c) in femurs of HLU group were higher when compared to that of control group. Femoral SOD2 activities were greater in both control and HLU animals after NMN supplementation.

Benefits of NMN on osteoblastic differentiation

When compared to MC3T3-E1 cells cultured under normal gravity, mRNA levels of OPN (Fig. 5a), Runx2 (Fig. 5b), Osterix (Fig. 5c), and osteocalcin (Fig. 5d) and activities of ALP (Fig. 5f) were lesser under modeled microgravity, which was reversed by NMN treatment dose-dependently.

Fig. 5.

Benefit of NMN on osteoblastic differentiation. The mRNA levels of genes of OPN (a), Runx2 (b), Osterix (c), osteocalcin (OCN, d), and Col1a1 (e) and activities of ALP (f) were shown. * P < 0.05 vs. group cultured under normal gravity (NG) and treated with vehicle; # P < 0.05 vs. group cultured under microgravity (MG) and treated with vehicle

Modeled microgravity stimulation had no significant effect on Col1a1 mRNA expression (Fig. 5e). The mRNA expression of Col1a1 were higher in NMN-treated group than that in vehicle-treated group, under both modeled microgravity and normal gravity.

Benefits of NMN treatment on mitochondrial impairment

When compared to MC3T3-E1 cells cultured under normal gravity, intracellular NAD⁺ levels (Fig. 6a) were lesser under modeled microgravity. NAD⁺ levels were greater in NMN-treated group than that in vehicle-treated group, under both modeled microgravity and normal gravity.

Fig. 6.

Benefit of NMN on mitochondrial impairments. Graphs presented the intracellular levels of NAD⁺ (a), mitochondrial ROS production (b), ATP content (c), activities of SOD2 (d) and Complex I and II (e, f), and mtDNA copy number (g). Western blot of AMPKα phosphorylation and responding quantification results (h) were shown. * P < 0.05 vs. group cultured under normal gravity (NG) and treated with vehicle; # P < 0.05 vs. group cultured under microgravity (MG) and treated with vehicle

When compared to cells cultured under normal gravity, modeled microgravity stimulation led to a severe mitochondrial impairment, evidenced by greater mitochondrial ROS generation (Fig. 6b) and lesser ATP content (Fig. 6c) and Complex I and II activities (Fig. 6e, f), which was reversed by NMN treatment.

When compared to cells cultured under normal gravity, SOD2 activity (Fig. 6d), mtDNA copy number (Fig. 6g), and AMPKα phosphorylation (Fig. 6h) were greater under modeled microgravity. SOD2 activity, mtDNA copy number, and AMPKα phosphorylation were greater in NMN-treated group than that in vehicle-treated group, under both normal gravity and modeled microgravity.

Discussion

Our work demonstrated that NMN supplementation mitigated osteopenia in HLU rats. The 19.5-day space flight in rats strikingly inhibited bone formation (Morey and Baylink 1978). It was also observed that simulated microgravity in vitro inhibited differentiation phenotypes of osteoblastic cells (Cao et al. 2021; Xin et al. 2015). Therefore, impairment of bone formation contributed to the osteopenia induced by microgravity. NMN treatment attenuated aluminum or dexamethasone-induced osteogenic inhibition in vitro (Liang et al. 2019; Huang and Tao 2020). In our investigation, serum levels of ALP activities and osteocalcin in HLU + NMN animals were greater than that in HLU animals. Furthermore, NMN treatment reversed the modeled microgravity-induced reduction of differentiation phenotypes in MC3T3-E1 cells. We demonstrated that NMN supplementation promoted osteoblastogenesis, which might explain its anti-osteoporotic action under modeled microgravity.

Oxidative stress is one of the most investigated events involved in bone tissues in response to the microgravity (Tian et al. 2017). Accumulating evidence reported that excessive ROS produced in bone intervened osteoblast differentiation and prevented osteoblast activity (Tao et al. 2020). NMN abated oxidative stress in various diseases involved in heart, aorta, tendon and brain (Yamaura et al. 2022; Wu et al. 2021; Tarantini et al. 2019; de Picciotto et al. 2016). The antioxidant property of NMN was linked to enhanced activities of antioxidant enzymes such as SOD (Wan et al. 2021). SOD was crucial for osteoblast differentiation and trabecular bone loss was reported in the mice of osteoblast lineage Sod2 deficiency (Schoppa et al. 2022). In current work, SOD2 activities were greater and MDA levels were lesser in femurs of HLU + NMN animals than that of HLU animals. Thus, the antioxidant function of NMN might contributed to its protective effects against bone loss induced by microgravity.

Recently, a comprehensive multi-omics analysis demonstrated that mitochondrial dysfunction including impaired respiratory chain and increased mitochondrial ROS formation was a consistent phenotype for spaceflight biology (da Silveira et al. 2020). In mesenchymal stem cells, simulated microgravity increased mtDNA copy number, but inhibited mitochondrial oxidative phosphorylation (Liu et al. 2020). In current study, Complex I and II activities were lesser in cells when stimulated with modeled microgravity. Active mitochondria were required for osteoblastic differentiation (Shares et al. 2018). NAD⁺ was required in glycolysis in mitochondria and NAD depletion resulted in mitochondrial dysfunction (Sims et al. 2018; Alano et al. 2010). In our work, NAD⁺ levels were lesser in bone tissues and cells when exposed to modeled microgravity. NMN treatment improved osteoblastic mitochondrial function, which contributed to its benefit against microgravity-induced osteopenia.

AMPK played a key role in bone formation and AMPKα deficiency inhibited osteoblastic differentiation (Kanazawa et al. 2018). The crosstalk between mitochondria and AMPK, such as mitochondrial impairment causing abnormal activation of AMPK and AMPK activation preserving mitochondrial homeostasis (Wu and Zou 2020; Jornayvaz and Shulman 2010), have been demonstrated. In our work, AMPKα phosphorylation were greater in NMN-treated group than that in vehicle-treated group, under both normal gravity and modeled microgravity. It might also contribute to its protection against microgravity-induced mitochondrial dysfunction and bone loss.

It should be noted that NMN supplementation had good safety. No increased mortality rate or obvious side effects was reported in mice after NMN administration (300 mg/kg/day) for one year (Mills et al. 2016). In rats, oral NMN supplementation for 90 days at doses up to 1500 mg/kg/d did not generate serious toxicity as seen from biochemical parameters in blood as well as histological analysis of liver and kidney (Cros et al. 2021). These reports provided hope for translating the findings of our work to human beings.

As a ground-based analog for microgravity in animals, HLU model had several weaknesses including inconsistencies of stress reaction in HLU animals and continued loading of forelimbs and upper spine (Globus and Morey-Holton 2016). Therefore, further investigations are needed to confirm the efficacy of NMN in animals in spaceflight and humans in bed rest and spaceflight.

In summary, NMN supplementation attenuated osteoblastic mitochondrial impairment and mitigated osteopenia induced by modeled microgravity in rats. NMN supplementation may be a promising nutritional strategy for anti-osteoporotic therapy of astronauts and geriatric population.

Author contributions

Conceptualization: Yunfei Huang, Yusheng Dou, Xiaobin Yang; Methodology: Yusheng Dou; Formal analysis and investigation: Yunfei Huang, Yusheng Dou, Bo Yang, Baorong He, Xuefang Zhang, Ke Zhang, Xiaobin Yang; Writing—original draft preparation: Yunfei Huang and Xiaobin Yang; Writing—review and editing: Yunfei Huang and Xiaobin Yang; Funding acquisition: Xiaobin Yang; Supervision: Xiaobin Yang.

Funding

The current study was funded by the Natural Science Foundation of Shaanxi Province (2021JM-575).

Data availability

The datasets analyzed or used in our investigation are available from the corresponding author without undue reservation.

Declarations

Ethics approval

All experiments involving animals were approved by the Institutional Animal Care and the Animal Ethics Committee of Xi'an Jiaotong University and were conducted with strict adherence to the American Association for the Accreditation of Laboratory Animal Care International and National Institutes of Health Guidelines embodied in the Guide for the Care and Use of Laboratory Animals.

Competing Interests

The authors declare that there are no competing interests.