ABSTRACT
The pks gene cluster encodes colibactin, which can cause DNA damage and enhance the virulence in Escherichia coli. However, the role of the pks gene in Klebsiella pneumoniae has not been fully discussed. The aim of this study was to analyze the relationship between the pks gene cluster and virulence factors, as well as to assess antibiotic resistance and biofilm formation capacity in clinical isolates of Klebsiella pneumoniae. Thirty-eight of 95 clinical K. pneumoniae strains were pks positive. pks-positive strains usually infected emergency department patients, and pks-negative strains often infected hospitalized patients. The positive rates of K1 capsular serotype and hypervirulence genes (peg-344, rmpA, rmpA2, iucA, and iroB) were significantly higher in the pks-positive isolates than the pks-negative isolates (P < 0.05). The biofilm formation ability of pks-positive isolates was stronger than that of pks-negative isolates. Antibacterial drug susceptibility test showed the resistance of pks-positive isolates was weaker than that of pks-negative isolates. In conclusion, patients with pks-positive K. pneumoniae infection might have worse treatment outcomes and prognosis. pks-positive K. pneumoniae might have stronger virulence and pathogenicity. Clinical infection with pks-positive K. pneumoniae needs further attention.
IMPORTANCE The infection rate with pks-positive K. pneumoniae has been increasing in recent years. Two previous surveys in Taiwan reported 25.6% pks gene islands and 16.7% pks-positive K. pneumoniae strains in bloodstream infections, and Chinese scholars also did a survey of K. pneumoniae bloodstream infections in Changsha, China, and found 26.8% pks-positive K. pneumoniae. In addition, it was found that the pks gene cluster might encode colibactin, which could be related to the virulence of K. pneumoniae. Studies confirmed that the prevalence of colibactin-producing K. pneumoniae was increasing. It is necessary to consider the clear relationship between the pks gene cluster and high pathogenicity in K. pneumoniae.
KEYWORDS: pks island, genotoxins, colibactin, Klebsiella pneumonia, virulence
INTRODUCTION
Klebsiella pneumoniae is an opportunistic pathogen with an increasing incidence in infectious diseases. Currently, highly virulent and highly resistant K. pneumoniae strains are prevalent worldwide. Compared to classic K. pneumoniae (cKP), hypervirulent K. pneumoniae (hvKP) is more likely to cause community-acquired infection, leading to liver abscess, pneumonia, and other diseases (1). In recent years, the proportion of carbapenem-resistant hypervirulent K. pneumoniae (CR-hvKP) has also increased, which could result in the failure of clinical anti-infective treatment or prolongation of the infectious disease course (2, 3). These changes pose significant challenges to clinical treatment. Therefore, the characteristics of their pathogenicity and the expression of virulence genes are increasingly attracting attention.
It has been shown that the five virulence genes iucA (aerobactin siderophore), rmpA (hypermucositity), rmpA2 (yersiniabactin), iroB (salmochelin siderophore), and peg-344 (putative transporter) can be used to distinguish between hvKP and cKP with a high degree of accuracy (≥95%) (4). Certain serotypes, such as K1, K2, K5, K20, K54, and K57, are strongly linked with invasive infections in the host. The K1 and K2 serotypes of K. pneumoniae, in particular, can develop drug-resistant phenotypes by mediating various drug-resistant genes via mobile genetic elements, posing a major challenge for clinical treatment (5, 6).
The polyketide synthase (pks) gene cluster, which encodes the synthetic genotoxin colibactin, has been primarily found in Enterobacteriaceae, such as Escherichia coli, K. pneumoniae, and Citrobacter (7, 8). The pks gene cluster encodes a synthetic genotoxin of colibactin that induces DNA damage in eukaryotic cells, which is associated with other bacterial virulence factors (adhesins, toxins, and siderophores) (7, 9). Studies have found that pks-positive K. pneumoniae infection exacerbated lymphopenia in septic mouse models (10), promotes the development of meningitis (11), and significantly increases mortality in patients (12). Therefore, there might be a potential correlation between pks gene clusters and virulence.
In this study, we collected a total of 98 clinical isolates of K. pneumoniae from our hospital and analyzed the prevalence of the pks gene cluster and virulence genes, antimicrobial susceptibility, and biofilm formation. This study aimed to evaluate the effect of pks gene cluster on pathogenicity and virulence in order to provide new insights for the clinical treatment of K. pneumoniae infection.
RESULTS
Clinical characteristics of pks-positive and pks-negative K.pneumoniae isolates.
A total of 95 strains of K. pneumoniae were collected and divided into two groups based on the pks gene identification results: the pks-positive group and the pks-negative group. The determination of pks gene-positive results was based on the positivity of clbA, clbB, clbN, and clbQ (Fig. 1). pks-positive K. pneumoniae strains were more likely to infect patients from the emergency department than pks-negative K. pneumoniae strains. pks-positive K. pneumoniae strains were more often isolated from blood samples (P < 0.05). Besides, we found that patients with pks-positive K. pneumoniae infection had fewer concomitant underlying diseases than patients with pks-negative K. pneumoniae infection (Table 1).
FIG 1.
Results of agarose gel electrophoresis of clbA, clbB, clbN, and clbQ. Lanes: M, DNA molecular weight standard; 1, clbA, 1,311 bp; 2, clbB, 579 bp; 3, clbN, 733 bp; 4, clbQ, 821 bp.
TABLE 1.
Demographic and clinical data of patients according to the isolation of pks-positive and pks-negative K. pneumoniae
| Characteristic | Result for isolates |
P valuea | |
|---|---|---|---|
| pks positive (n = 38) | pks negative (n = 57) | ||
| Male, no. (%) | 29 (76.3) | 41 (71.9) | 0.634 |
| Age, yr (mean ± SD) | 58 ± 2.7217 | 63 ± 2.4765 | 0.174 |
| Specimen source, no. (%) | |||
| Sputum | 13 (34.2) | 40 (70.2) | 0.001* |
| Blood | 9 (23.7) | 2 (3.5) | 0.007* |
| Pus | 7 (18.4) | 4 (7.0) | 0.169 |
| Bile/abdominal fluid | 7 (18.4) | 4 (7.0) | 0.169 |
| Other | 2 (5.3) | 7 (12.3) | 0.431 |
| Hospital section source, no. (%) | |||
| ICU | 6 (15.8) | 21 (36.8) | 0.026* |
| Neurology | 3 (7.9) | 10 (17.5) | 0.180 |
| Gastroenterology | 11 (28.9) | 7 (12.3) | 0.075 |
| Emergency | 9 (23.7) | 3 (5.3) | 0.020* |
| Other | 9 (23.7) | 16 (28.1) | 0.634 |
A P value of <0.05 was considered to be statistically significant (*).
Prevalence of pks gene cluster, capsular serotypes, and virulence genes.
In this study, all five virulence genes (peg-344, rmpA, rmpA2, iucA, and iroB) were mainly present in pks-positive K. pneumoniae isolates, with higher detection rates than the pks-negative K. pneumoniae isolates (P < 0.001). The detection rate of serotypes among pks-positive K. pneumoniae isolates was 81.6%; the predominant serotypes were K1 (47.4% [18/38]) and K2 (18.4% [7/38]). Six isolates fell into other K serotypes (K5, K20, and K57, with 1, 2, and 3 isolates, respectively), and seven were serologically untypeable (Table 2).
TABLE 2.
Virulence genes and capsular serotypes of pks-positive K. pneumoniae
| Virulence factors | No. (%) of isolates |
P valuea | |
|---|---|---|---|
| pks positive (n = 38) | pks negative (n = 57) | ||
| Virulence genes | |||
| peg-344 | 34 (89.4) | 21 (36.8) | <0.001* |
| rmpA | 34 (89.4) | 21 (36.8) | <0.001* |
| rmpA2 | 32 (84.2) | 20 (35.0) | <0.001* |
| iucA | 35 (92.1) | 23 (40.3) | <0.001* |
| iroB | 34 (89.4) | 21 (36.8) | <0.001* |
| Capsular serotypes | |||
| K1 | 18 (47.4) | 1 (1.5) | <0.001* |
| K2 | 7 (18.4) | 4 (7.0) | 0.169 |
| K5 | 1 (2.6) | 4 (7.0) | 0.639 |
| K20 | 2 (5.3) | 1 (1.7) | 0.719 |
| K54 | 0 (0.0) | 1 (1.7) | 1.000 |
| K57 | 3 (7.9) | 4 (7.0) | 1.000 |
| NAb | 7 (18.4) | 42 (73.6) | <0.001* |
A P value of <0.05 was considered to be statistically significant (*).
NA, not applicable.
Antimicrobial susceptibility.
Compared with pks-negative K. pneumoniae, pks-positive K. pneumoniae strains were significantly more susceptible to 10 antimicrobial agents, including ceftazidime, cefepime, aztreonam, imipenem, meropenem, amikacin, tobramycin, levofloxacin, and trimethoprim-sulfamethoxazole (Table 3).
TABLE 3.
Susceptibility of pks-positive and pks-negative K. pneumoniae isolates to antimicrobials
| Antibiotic | No. (%) of isolates |
P value | |
|---|---|---|---|
| pks positive (n = 38) | pks negative (n = 57) | ||
| CAZ | 5 (13.1) | 38 (66.6) | <0.001 |
| FEP | 5 (13.1) | 36 (63.1) | <0.001 |
| ATM | 5 (13.1) | 38 (66.6) | <0.001 |
| IPM | 4 (10.5) | 36 (63.1) | <0.001 |
| MEM | 4 (10.5) | 38 (66.6) | <0.001 |
| AK | 4 (10.5) | 35 (61.4) | <0.001 |
| TOB | 4 (10.5) | 32 (56.1) | <0.001 |
| CIP | 5 (13.1) | 35 (61.4) | <0.001 |
| LVX | 5 (13.1) | 36 (63.1) | <0.001 |
| SXT | 5 (13.1) | 28 (49.1) | <0.001 |
CAZ, ceftazidime; FEP, cefepime; ATM, aztreonam; IPM, imipenem; MEM, meropenem; AK, amikacin; TOB, tobramycin; CIP, ciprofloxacin; LVX, levofloxacin; SXT, trimethoprim-sulfamethoxazole.
Biofilm formation.
Our data revealed that 98% of K. pneumoniae isolates were biofilm producers. In this study, 38% and 60% of isolates were weakly and moderately biofilm-producing strains, respectively. The prevalence of moderate biofilm formation in pks-positive K. pneumoniae was significantly higher than in pks-negative K. pneumoniae (84.2% compared to 43.8%; P < 0.05) (Table 4).
TABLE 4.
Biofilm formation of pks-positive and pks-negative K. pneumoniae isolates
| Clinical isolate type | No. (%) of isolates with biofilm formation model |
||
|---|---|---|---|
| None (0) | Weak (+) | Moderate (++) | |
| pks positive | 0 (0.0) | 6 (15.8) | 32 (84.2) |
| pks negative | 1 (1.8) | 31 (54.4) | 25 (43.8) |
DISCUSSION
Klebsiella pneumoniae is a potential hospital superbug that has attracted clinical attention (13). hvKP frequently exhibits hypermucoviscous phenotypes and carries a variety of hypervirulence genes (14, 15). Worryingly, hvKP has been spreading worldwide and causing severe metastatic infections, particularly in immunologically active populations (16). Furthermore, the emergence of multidrug-resistant (MDR) highly pathogenic strains has created significant challenges in the clinical field (17, 18). Therefore, the research on K. pneumoniae could help the clinical treatment of K. pneumoniae-related infection and avoid unnecessary treatment and improper use of medicine.
Two previous surveys pointed out that the proportion of pks genes in 207 strains of K. pneumoniae was 25.6% (19) and the proportion of pks-positive K. pneumoniae isolates in bloodstream infections was 16.7% (20) in Taiwan. A survey of pks-positive K. pneumoniae bloodstream infections in Changsha indicated a prevalence of 26.8% in China (21). Furthermore, the analysis of clinical characteristics showed that pks-positive isolates were more frequently encountered in community-acquired infection (21). In this study, the analysis of clinical characteristics showed that pks-positive isolates more frequently infected emergency department patients. Compared to pks-negative strains, more pks-positive strains were collected from blood specimens. These results suggested that the infection of pks-positive strains might reflect severe clinical infection.
In this study, we found that the virulence genes were mainly present in pks-positive K. pneumoniae isolates, and the positivity rate of the virulence genes (peg-344, rmpA, rmpA2, iucA, and iroB) was higher than that in the pks-negative K. pneumoniae isolates. peg-344, rmpA, rmpA2, iucA, and iroB were considered to be the biomarkers of highly virulent strains (4). The peg-344 gene encodes an endometrial transporter and is one of the markers of K. pneumoniae virulence screening (22). rmpA and rmpA2 are regulatory genes for polysaccharide expression in the capsule of K. pneumoniae, which reduce the yield and virulence of the capsule of the strain if missing (23). Iron absorption enhances bacterial virulence. iucA and iroB are important genes for the expression of K. pneumoniae siderophores, which are major virulence determinants of systemic infection (24). The above findings supported that the pks gene cluster might be associated with highly virulent strains.
In this study, the detection rate of highly virulent capsular serotypes in the pks-positive K. pneumoniae was 69.5%, with 14 strains not detected. This showed that the positive serotype of the K1 type was significantly higher in pks-positive K. pneumoniae strains than in pks-negative ones (P < 0.05). The presence of capsular serotypes is one of the main virulence factors of hvKP, which can protect the organism against phagocytosis by host phagocytes and damage by lysosomes via their complement (25). Currently, K1 and K2 serotypes of K. pneumoniae can acquire drug-resistant phenotypes by mediating various drug-resistant genes through mobile genetic elements, posing a great challenge for clinical treatment (26). This suggested that the strains carrying a pks gene cluster might be more closely associated with virulent capsular serotype K1, and this group of strains might be highly virulent or more likely to acquire a drug-resistant phenotype.
The pks-positive isolates were found to be associated with low antimicrobial drug resistance. In this study, statistical analysis showed that pks-positive isolates were significantly less resistant to the 10 tested antimicrobial drugs than the pks-negative group. This situation might be due to the fact that pks-positive isolates have a high proportion of highly pathogenic serotypes and virulence genes, as the acquisition of virulence is usually accompanied by a decrease in resistance. However, we also observed highly resistant strains within the pks-positive group, which presents a concerning scenario for the future as it combines genotoxicity and drug resistance. Additionally, our analysis of the data revealed that most pks-positive K. pneumoniae isolates exhibited a high capacity for biofilm formation. This biofilm formation might protect bacteria from host immune attack and antibiotics.
Therefore, it is possible that pks-positive K. pneumoniae isolates have stronger virulence and pathogenicity, which could result in worse treatment outcomes and prognosis for individuals infected with these strains. To prevent K. pneumoniae infections, there is a need for epidemiological surveillance that targets virulence factors, as well as effective infection control measures and the development of new therapeutic approaches.
MATERIALS AND METHODS
Bacterial isolates.
A total of 95 nonrepetitive K. pneumoniae isolates were collected for this study. Relevant clinical data were also retrieved. These isolates were identified, handled, and preserved using standard microbiological laboratory procedures (27).
Detection of pks gene cluster, virulence genes, and capsular serotypes.
The presence of the pks gene cluster and virulence genes was detected by PCR as previously described. The clinical isolates were screened for the presence of pks gene cluster using primers for the four representative genes (clbA, clbB, clbN, and clbQ) of the genomic cluster in order to document the presence of a complete cluster (28). After overnight culture, K. pneumoniae was suspended in 300 μL of sterile distilled water, heated at 95°C for 10 min, and then centrifuged at 12,000 × g for 5 min to remove cellular debris. The supernatant was stored at 4°C and used as the template for amplification. The PCR amplification procedure included predenaturation at 94°C for 5 min, denaturation at 95°C for 30 s, annealing at 53°C for 30 s, and 72°C extension for 1 min for 30 cycles, and finally 72°C extension for 10 min. The PCR products were visualized by 2% agarose gel electrophoresis.
To investigate the association of pks and hypervirulence, the presence of five hypervirulence genes (peg-344, rmpA, rmpA2, iucA, and iroB) and capsular serotypes was determined by PCR following previously published protocols (4, 29). The primers used in this study are listed in Table 5.
TABLE 5.
Primers used in this study
| Primer name | DNA sequence (5′→3′)a | Amplicon size (bp) |
|---|---|---|
| clbA | CTAGATTATCCGTGGCGATTC | 1,311 |
| CAGATACACAGATACCATTCA | ||
| clbB | GATTTGGATACTGGCGATAACCG | 579 |
| CCATTTCCCGTTTGAGCACAC | ||
| clbN | GTTTTGCTCGCCAGATAGTCATTC | 733 |
| CAGTTCGGGTATGTGTGGAAGG | ||
| clbQ | CTTGTATAGTTACACAACTATTTC | 821 |
| TTATCCTGTTAGCTTTCGTTC | ||
| Virulence genes | ||
| peg-344 | CTTGAAACTATCCCTCCAGTC | 508 |
| CCAGCGAAAGAATAACCCC | ||
| rmpA | TTAACTGGACTACCTCTGTTTCAT | 535 |
| AATCCTGCTGTCAACCAATACT | ||
| rmpA2 | ATCCTCAAGGGTGTGATTATGAC | 447 |
| CCTGGAGAGTAAGCATTGTAGAAT | ||
| iucA | CTCTTCCCGCTCGCTATACT | 116 |
| GCATTCCACGCT TCACTTCT | ||
| iroB | GTGAAGTCGATGCCGAGATTATC | 199 |
| CCGAAGACGATCTGTGGAATAC | ||
| Capsular serotypes | ||
| K1 | GTAGGTATTGCAAGCCATGC | 1,046 |
| GCCCAGGTTAATGAATCCGT | ||
| K2 | GGAGCCATTTGAATTCGGTG | 1,121 |
| TCCCTAGCACTGGCTTAAGT | ||
| K5 | GCCACCTCTAAGCATATAGC | 999 |
| CGCACCAGTAATTCCAACAG | ||
| K20 | CCGATTCGGTCAACTAGCTT | 1,116 |
| GCACCTCTATGAACTTTCAG | ||
| K54 | CATTAGCTCAGTGGTTGGCT | 881 |
| GCTTGACAAACACCATAGCAG | ||
| K57 | CGACAAATCTCTCCTGACGA | 1,182 |
| CGCGACAAACATAACACTCG |
For each primer, the top sequence represents the forward primer and the bottom sequence represents the reverse primer.
Antibiotic susceptibility.
Antimicrobial susceptibility testing was carried out with bioMérieux Vitek-2 (bioMérieux). The MICs of antimicrobial agents were interpreted according to the guideline established by the Clinical and Laboratory Standards Institute (CLSI) (30). A panel of 10 antimicrobial agents was tested, including amikacin, aztreonam, ceftazidime, ciprofloxacin, cefepime, imipenem, levofloxacin, meropenem, tobramycin, and trimethoprim-sulfamethoxazole.
Detection of biofilm formation.
Biofilm-forming ability was detected by crystal violet staining. The strains were incubated in LB broth medium, shaken overnight at 37°C, prepared in 0.5 MacConkey's turbidity solution, and diluted 1:100 with LB broth. The diluted broth was added to a 96-well microtiter plate at 200 μL/well, and 3 wells were inoculated with 200 μL sterile LB broth as a negative control. The plate was washed three times with phosphate-buffered saline (PBS [pH 7.0]), dried at room temperature, fixed with methanol solution for 20 min, the methanol was discarded, and then the plate was stained using 1% crystal violet solution. After 15 min, the plate was washed with PBS until colorless. After drying, 200 μL of anhydrous ethanol was used to fully dissolve the crystal violet, the mixture was transferred to a new microplate, and absorbance was measured at 570 nm. Each assay was performed in triplicate and repeated four times.
The optical density cutoff (ODc) was defined as 3 standard deviations (SDs) above the mean optical density (OD) of the negative control. All of the strains were classified based on the adherence capabilities into the following categories: non-biofilm producers (OD ≤ ODc), weak biofilm producers (ODc < OD ≤ 2 × ODc), moderate biofilm producers (2 × ODc < OD ≤ 4 × ODc), and strong biofilm producers (4 × ODc < OD) (31).
Statistical analysis.
Categorical variables were analyzed by using the chi-square test or Fisher's exact test. For continuous variables, Student's t test or the Mann-Whitney U test was used to analyze the data, as appropriate. All data analysis was performed with SPSS software (version 25.0). A P value of <0.05 was considered statistically significant.
ACKNOWLEDGMENTS
This study was financially supported by the National Natural Science Foundation of China (grant 82172327), the Fujian Provincial Health Technology Project (no. 2020CXA031), Scientific Research of Fujian Medical University (no. 2020QH1033 and no. 2019QH1074), and the Foundation Youth Innovation Project of Fujian Province (2021J05149).
Y.C. and C.L. conceived and designed the experiments. Y.C., X.H., and X.L. performed the experiments. S.C. analyzed the data. Y.L., B.Y. contributed reagents/materials/analysis tools. Y.C. wrote the manuscript. Y.C. and C.L. edited the manuscript. All authors contributed to the article and approved the submitted version.
Contributor Information
Bin Yang, Email: yangbin2864@163.com.
Salina Parveen, University of Maryland Eastern Shore.
REFERENCES
- 1.Shon AS, Bajwa RP, Russo TA. 2013. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: a new and dangerous breed. Virulence 4:107–118. doi: 10.4161/viru.22718. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bialek-Davenet S, Criscuolo A, Ailloud F, Passet V, Jones L, Delannoy-Vieillard AS, Garin B, Le Hello S, Arlet G, Nicolas-Chanoine MH, Decré D, Brisse S. 2014. Genomic definition of hypervirulent and multidrug-resistant Klebsiella pneumoniae clonal groups. Emerg Infect Dis 20:1812–1820. doi: 10.3201/eid2011.140206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Yang X, Dong N, Chan EW, Zhang R, Chen S. 2021. Carbapenem resistance-encoding and virulence-encoding conjugative plasmids in Klebsiella pneumoniae. Trends Microbiol 29:65–83. doi: 10.1016/j.tim.2020.04.012. [DOI] [PubMed] [Google Scholar]
- 4.Russo TA, Olson R, Fang CT. 2018. Identification of biomarkers for differentiation of hypervirulent Klebsiella pneumoniae from classical K. pneumoniae. J Clin Microbiol 56:e00776-18. doi: 10.1128/JCM.00776-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wyres KL, Wick RR, Gorrie C, Jenney A, Follador R, Thomson NR, Holt KE. 2016. Identification of Klebsiella capsule synthesis loci from whole genome data. Microb Genom 2:e000102. doi: 10.1099/mgen.0.000102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Guo Y, Wang S, Zhan L, Jin Y, Duan J, Hao Z, Lv J, Qi X, Chen L, Kreiswirth BN, Wang L, Yu F. 2017. Microbiological and clinical characteristics of hypermucoviscous Klebsiella pneumoniae isolates associated with invasive infections in China. Front Cell Infect Microbiol 7:24. doi: 10.3389/fcimb.2017.00024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Nougayrède JP, Homburg S, Taieb F, Boury M, Brzuszkiewicz E, Gottschalk G, Buchrieser C, Hacker J, Dobrindt U, Oswald E. 2006. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science 313:848–851. doi: 10.1126/science.1127059. [DOI] [PubMed] [Google Scholar]
- 8.Putze J, Hennequin C, Nougayrède JP, Zhang W, Homburg S, Karch H, Bringer MA, Fayolle C, Carniel E, Rabsch W, Oelschlaeger TA, Oswald E, Forestier C, Hacker J, Dobrindt U. 2009. Genetic structure and distribution of the colibactin genomic island among members of the family Enterobacteriaceae. Infect Immun 77:4696–4703. doi: 10.1128/IAI.00522-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wang P, Zhang J, Chen Y, Zhong H, Wang H, Li J, Zhu G, Xia P, Cui L, Li J, Dong J, Gao Q, Meng X. 2021. Colibactin in avian pathogenic Escherichia coli contributes to the development of meningitis in a mouse model. Virulence 12:2382–2399. doi: 10.1080/21505594.2021.1972538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Marcq I, Martin P, Payros D, Cuevas-Ramos G, Boury M, Watrin C, Nougayrède JP, Olier M, Oswald E. 2014. The genotoxin colibactin exacerbates lymphopenia and decreases survival rate in mice infected with septicemic Escherichia coli. J Infect Dis 210:285–294. doi: 10.1093/infdis/jiu071. [DOI] [PubMed] [Google Scholar]
- 11.Lu MC, Chen YT, Chiang MK, Wang YC, Hsiao PY, Huang YJ, Lin CT, Cheng CC, Liang CL, Lai YC. 2017. Colibactin contributes to the hypervirulence of pks(+) K1 CC23 Klebsiella pneumoniae in mouse meningitis infections. Front Cell Infect Microbiol 7:103. doi: 10.3389/fcimb.2017.00103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kim D, Park BY, Choi MH, Yoon EJ, Lee H, Lee KJ, Park YS, Shin JH, Uh Y, Shin KS, Shin JH, Kim YA, Jeong SH. 2019. Antimicrobial resistance and virulence factors of Klebsiella pneumoniae affecting 30 day mortality in patients with bloodstream infection. J Antimicrob Chemother 74:190–199. doi: 10.1093/jac/dky397. [DOI] [PubMed] [Google Scholar]
- 13.Effah CY, Sun T, Liu S, Wu Y. 2020. Klebsiella pneumoniae: an increasing threat to public health. Ann Clin Microbiol Antimicrob 19:1. doi: 10.1186/s12941-019-0343-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhu J, Wang T, Chen L, Du H. 2021. Virulence factors in hypervirulent Klebsiella pneumoniae. Front Microbiol 12:642484. doi: 10.3389/fmicb.2021.642484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hua Y, Wang J, Huang M, Huang Y, Zhang R, Bu F, Yang B, Chen J, Lin X, Hu X, Zheng L, Wang Q. 2022. Outer membrane vesicles-transmitted virulence genes mediate the emergence of new antimicrobial-resistant hypervirulent Klebsiella pneumoniae. Emerg Microbes Infect 11:1281–1292. doi: 10.1080/22221751.2022.2065935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Dong N, Yang X, Chan EW, Zhang R, Chen S. 2022. Klebsiella species: taxonomy, hypervirulence and multidrug resistance. EBioMedicine 79:103998. doi: 10.1016/j.ebiom.2022.103998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zhang Y, Zhao C, Wang Q, Wang X, Chen H, Li H, Zhang F, Li S, Wang R, Wang H. 2016. High prevalence of hypervirulent Klebsiella pneumoniae infection in China: geographic distribution, clinical characteristics, and antimicrobial resistance. Antimicrob Agents Chemother 60:6115–6120. doi: 10.1128/AAC.01127-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yang X, Ye L, Chan EW, Zhang R, Chen S. 2020. Tracking recombination events that occur in conjugative virulence plasmid p15WZ-82_Vir during the transmission process. mSystems 5:e00140-20. doi: 10.1128/mSystems.00140-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lai YC, Lin AC, Chiang MK, Dai YH, Hsu CC, Lu MC, Liau CY, Chen YT. 2014. Genotoxic Klebsiella pneumoniae in Taiwan. PLoS One 9:e96292. doi: 10.1371/journal.pone.0096292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chen YT, Lai YC, Tan MC, Hsieh LY, Wang JT, Shiau YR, Wang HY, Lin AC, Lai JF, Huang IW, Lauderdale TL. 2017. Prevalence and characteristics of pks genotoxin gene cluster-positive clinical Klebsiella pneumoniae isolates in Taiwan. Sci Rep 7:43120. doi: 10.1038/srep43120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lan Y, Zhou M, Jian Z, Yan Q, Wang S, Liu W. 2019. Prevalence of pks gene cluster and characteristics of Klebsiella pneumoniae-induced bloodstream infections. J Clin Lab Anal 33:e22838. doi: 10.1002/jcla.22838. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Li J, Li Y, Tang M, Xia F, Min C, Hu Y, Wang H, Zhang J, Zou M. 2022. Distribution, characterization, and antibiotic resistance of hypervirulent Klebsiella pneumoniae isolates in a Chinese population with asymptomatic bacteriuria. BMC Microbiol 22:29. doi: 10.1186/s12866-021-02413-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Matono T, Morita M, Nakao N, Teshima Y, Ohnishi M. 2022. Genomic insights into virulence factors affecting tissue-invasive Klebsiella pneumoniae infection. Ann Clin Microbiol Antimicrob 21:2. doi: 10.1186/s12941-022-00494-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hu D, Li Y, Ren P, Tian D, Chen W, Fu P, Wang W, Li X, Jiang X. 2021. Molecular epidemiology of hypervirulent carbapenemase-producing Klebsiella pneumoniae. Front Cell Infect Microbiol 11:661218. doi: 10.3389/fcimb.2021.661218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bellich B, Lagatolla C, Rizzo R, D'Andrea MM, Rossolini GM, Cescutti P. 2020. Determination of the capsular polysaccharide structure of the Klebsiella pneumoniae ST512 representative strain KPB-1 and assignments of the glycosyltransferases functions. Int J Biol Macromol 155:315–323. doi: 10.1016/j.ijbiomac.2020.03.196. [DOI] [PubMed] [Google Scholar]
- 26.Zhang R, Lin D, Chan EW, Gu D, Chen GX, Chen S. 2016. Emergence of carbapenem-resistant serotype K1 hypervirulent Klebsiella pneumoniae strains in China. Antimicrob Agents Chemother 60:709–711. doi: 10.1128/AAC.02173-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.El-Ashry AH, Hendawy SR, Mahmoud NM. 2022. Prevalence of pks genotoxin among hospital-acquired Klebsiella pneumoniae. AIMS Microbiol 8:73–82. doi: 10.3934/microbiol.2022007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Shi Q, Quan J, Lan P, Huang D, Zhou J, Jiang Y, Yu Y. 2020. Prevalence and characteristics of pks gene cluster harbouring Klebsiella pneumoniae from bloodstream infection in China. Epidemiol Infect 148:e69. doi: 10.1017/S0950268820000655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.El-Mahdy R, El-Kannishy G, Salama H. 2018. Hypervirulent Klebsiella pneumoniae as a hospital-acquired pathogen in the intensive care unit in Mansoura, Egypt. Germs 8:140–146. doi: 10.18683/germs.2018.1141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Clinical and Laboratory Standards Institute. 2017. Performance standards for antimicrobial susceptibility testing. M100-S27. Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
- 31.Vuotto C, Longo F, Pascolini C, Donelli G, Balice MP, Libori MF, Tiracchia V, Salvia A, Varaldo PE. 2017. Biofilm formation and antibiotic resistance in Klebsiella pneumoniae urinary strains. J Appl Microbiol 123:1003–1018. doi: 10.1111/jam.13533. [DOI] [PubMed] [Google Scholar]