Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Jul 24.
Published in final edited form as: Curr Biol. 2023 Jul 14;33(14):3056–3064.e5. doi: 10.1016/j.cub.2023.06.051

The EGF-motif containing protein SPE-36 is a secreted sperm protein required for fertilization in C. elegans

Amber R Krauchunas 1,3,4,*, Matthew R Marcello 2, A’Maya Looper 3, Xue Mei 1, Emily Putiri 1, Gunasekaran Singaravelu 1, Iqra I Ahmed 2, Andrew Singson 1
PMCID: PMC10529607  NIHMSID: NIHMS1914667  PMID: 37453426

SUMMARY

Identified through forward genetics, spe-9 was the first gene to be identified in C. elegans as necessary for fertilization 1. Since then, genetic screens in C. elegans have led to the identification of nine additional sperm genes necessary for fertilization [including spe-51 reported by Mei et al. and the spe-36 gene reported here]2–8. This includes spe-45, which encodes an immunoglobulin containing protein similar to the mammalian protein IZUMO1 and spe-42 and spe-49, which are homologous to vertebrate DCST2 and DCST1 respectively 3,6,7,9–12. Mutations in any one of these genes results in healthy adult animals that are sterile. Sperm from these mutants have normal morphology, migrate to and maintain their position at the site of fertilization in the reproductive tract, and make contact with eggs but fail to fertilize the eggs. This same phenotype is observed in mammals lacking Izumo1, Spaca6, Tmem95, Sof1, FIMP, or Dcst1 and Dcst2 9,9,13–18. Here we report the discovery of SPE-36 as a sperm-derived secreted protein that is necessary for fertilization. Mutations in the Caenorhabditis elegans spe-36 gene result in a sperm-specific fertilization defect. Sperm from spe-36 mutants look phenotypically normal, are motile, and can migrate to the site of fertilization. However, sperm that do not produce SPE-36 protein cannot fertilize. Surprisingly, spe-36 encodes a secreted EGF-motif containing protein that functions cell autonomously. The genetic requirement for secreted sperm-derived proteins for fertilization sheds new light on the complex nature of fertilization and represents a paradigm-shifting discovery in the molecular understanding of fertilization.

Keywords: Fertilization, Sperm, Oocyte, C. elegans, Secreted Protein, spe-36, Fertilization Synapse

eTOC blurb:

Krauchunas et al. show that spe-36 is required for fertilization in C. elegans and encodes a secreted protein with a single EGF-motif. This work establishes a role for sperm secreted proteins in the process of fertilization. Despite being secreted, SPE-36 localizes to mature sperm and functions in a cell autonomous manner.

RESULTS

spe-36 mutants are sterile due to a sperm-specific defect

Unmated spe-36 hermaphrodites produce few to no progeny despite having a high number of ovulations (Figure 1A and S1). However, spe-36 hermaphrodites produce viable progeny when crossed to wild-type (N2) males, indicating that spe-36 oocytes and the somatic gonad are functional. To assess male fertility, we compared the ability of spe-36 and wild-type males to sire outcross progeny from feminized (fem-1) hermaphrodites that do not produce any self-sperm. In sharp contrast to wild-type controls, spe-36 males sired a greatly reduced number of outcross progeny (average outcross progeny = 3.5, SEM 0.9 for spe-36 vs 198.4, SEM 21.9 for control) (Figure 1A). Because spe-36 mutants display no additional mutant phenotypes, we conclude that spe-36 mutations result in sterility due to a sperm-specific defect and that spe-36 is required for both male-derived and hermaphrodite-derived sperm to function.

Figure 1. spe-36 mutants are sterile due to a sperm defect where sperm are present but do not fertilize the eggs.

Figure 1.

Open in a new tab

(A) Hermaphrodite and male fertility was determined for spe-36(as6) mutants. Majority of unmated spe-36(as6) hermaphrodites produce no self-progeny (avg = 0.6 progeny, n = 19) and an extrachromosomal array containing a PCR product of F40F11.4 (asEx96) restores fertility to spe-36(as6) hermaphrodites. spe-36(as6) hermaphrodites also produce progeny when mated to wild-type males, showing that the sterility is caused by a defect in spe-36(as6) sperm. When spe-36(as6) males are mated to feminized hermaphrodites they fail to produce progeny, indicating that spe-36 is also necessary for male fertility. Error bars indicate standard error. (B) Schematic of the spe-36 gene structure including the locations of the it 114, as1, and as6 mutations and the region that encodes the EGF motif (amino acids 282 – 329). The it114 and as1 alleles have the same nucleotide change at position chrIV: 11,591,836 resulting in a C -> Y change at amino acid 104. as6 has a nucleotide change at position chrIV: 11,592,109 that alters the splice donor site of the first intron (C. elegans Feb. 2013 (WBcel235/ce11) Assembly). Scale bar represents 100 bp. (C) DIC imaging of spe-36(as6) hermaphrodites shows that oocytes are present in the oviduct and sperm are present in the spermatheca. However unfertilized eggs (arrows) are present in the uterus instead of developing embryos, despite the fact that the sperm must have contacted the eggs when the eggs moved through the spermatheca (brackets) to enter the uterus. (D) DAPI staining confirms the presence of sperm in the spermatheca (small bright spots within brackets) of 1 day adult hermaphrodites. Single DNA masses in the eggs in the uterus (arrowheads) are consistent with a lack of sperm entry into the egg. (E-F) DAPI staining of 4 day adult hermaphrodites. By day 4 of adulthood wild-type hermaphrodites (E) have depleted their self-sperm through fertilization of their eggs. In contrast, spe-36 hermaphrodites of the same age (F) still have abundant sperm in their spermatheca. This indicates that the mutant sperm do not fertilize and are capable of maintaining their position in the spermatheca. (G-J) To confirm that spe-36 males exhibit normal mating, sperm transfer and sperm migratory behavior cylc-2 (mon-2[c41g7.6::mNĜ3xFlag]) was crossed into him-5 and spe-36(as6); him-5. The him-5 mutation was used to generate males within the strain. Males with mNeonGreen (mNG) marked sperm were crossed with N2 L4 hermaphrodites and hermaphrodites were imaged ~24 hours later. Both wild-type and mutant sperm were transferred to hermaphrodites and successfully migrated to the region of the spermatheca. (G-H) N2 hermaphrodite mated to him-5; cylc-2::mNG males (I-J) N2 hermaphrodite mated to spe-36(as6); him-5; cylc-2::mNG males. Scale bars = 50 μm, See also Figure S1 and S4.

Direct observation of spe-36 hermaphrodite reproductive tracts confirmed the presence of oocytes and sperm. However, instead of developing embryos in the uterus we observed unshelled eggs that appear similar to the unfertilized oocytes in the oviduct (Figure 1C). DAPI staining to observe the DNA content in these cells showed a single DNA mass in each egg (Figure 1D). Since the centrioles are supplied to the egg by the sperm, a single DNA mass in each egg in the uterus indicates that no sperm entered these eggs 19,20. Yet we know that the sperm must have contacted the eggs when the eggs moved through the spermatheca to enter the uterus, as sperm are clearly present in the spermatheca. Finally, we find that sperm are still present in the spermathecae of older spe-36 adult hermaphrodites (Figure 1F). This is in contrast to wild-type hermaphrodites where successful fertilization depletes all self-sperm in the spermathecae by day 4 of adulthood (Figure 1E). From these data we conclude that spe-36 mutant sperm are incapable of fertilizing either spe-36 or wild-type oocytes.

spe-36 males mate, transfer sperm, and their sperm migrate to the spermathecae

Sperm are present in the spermatheca of spe-36 hermaphrodites and these sperm make contact with the oocyte but fail to fertilize, as indicated by the rows of unfertilized oocytes within the uteri of unmated spe-36 hermaphrodites (Figure 1C–D). To confirm that spe-36 male sterility is also attributable to the sperm fertilization defect, we assayed the ability of males to transfer sperm to hermaphrodites and the ability of those sperm to migrate to the spermathecae. We expressed CYLC-2 tagged with mNeonGreen to mark the sperm of both spe-36 mutant males and control males 21 and mated them with wildtype hermaphrodites. When the hermaphrodites were examined the following day, they all had male-derived sperm in and near the spermathecae (Figure 1G–J). From these data we infer that spe-36 males mate and transfer sperm and those sperm are able to migrate to the correct location in the hermaphrodite reproductive tract. Once at the spermatheca, C. elegans male-derived sperm outcompete hermaphrodite sperm for fertilization of the egg 20,22,23. We tested whether spe-36 male-derived sperm can still outcompete hermaphrodite sperm despite their inability to fertilize the egg. When mated to spe-36 mutant males, hermaphrodites had a significant decrease in the production of self-progeny as compared to unmated hermaphrodites (Figure S1). This suppression of hermaphrodite self-fertility indicates that spe-36 sperm can still outcompete hermaphrodite sperm. Altogether, we conclude that sperm made by either sex specifically require spe-36 for fertilization.

Sperm from spe-36 mutants are indistinguishable from wild-type sperm

To determine whether the fertility defects exhibited by spe-36 worms are due to abnormal sperm morphology, we closely compared spe-36 sperm to wild-type sperm. When examined using DIC optics, spermatids from spe-36 mutant males were indistinguishable from wild-type spermatids (Figure 2A–B). Notably, spermiogenesis, the maturation of spherical, sessile spermatids into polar, motile spermatozoa 24,25, was unaffected; spe-36 sperm activated normally in vitro (Figure 2D). When examined using transmission electron microscopy (TEM), spermatozoa within the reproductive tract of adult spe-36 hermaphrodites also exhibited wild-type morphology (Figure 2E–F).

Figure 2. The morphology of spe-36 mutant sperm is indistinguishable from that of wild-type sperm.

Figure 2.

Open in a new tab

(A) him-5 spermatids (B) spe-36(as6); him-5 spermatids (C) Pronase activated him-5 spermatozoa (D) Pronase activated spe-36(as6); him-5 spermatozoa (E-F) Transmission electron micrographs of spe-36(it114) unc-22 spermatozoa. The ultrastructural details of spe-36 sperm are indistinguishable from those of wild type, including the sperm chromatin mass (N), the pseudopod (P), and the fused membranous organelles (arrowheads).

Scale bars = 5 μm

The spe-36 gene encodes a protein with a single EGF-motif

We took a mapping-by-sequencing approach to determine the genomic locus of spe-36 26. This strategy identified an approximately 3 Mbp region on chromosome IV (10,000,000 – 13,000,000 bp) that showed a strong reduction in Hawaiian SNP frequency. This region matched the predicted location of spe-36(it114) based on traditional mapping data (data not shown) making it the target region for further analysis of the whole genome sequencing data. We sequenced both spe-36(it114) and spe-36(as6) strains which allowed us to filter for common genes between the two data sets that had unique homozygous single nucleotide polymorphisms (SNPs). This analysis produced F40F11.4 as the only likely candidate for spe-36. We identified a missense mutation (C104Y) in F40F11.4 in spe-36(it114) and a splice donor variant (G ->A) in the first intron in F40F11.4 in spe-36(as6) (Figure 1B). Sanger sequencing confirmed that neither of these SNPs are present in our lab N2 strain and revealed that spe-36(as1) contains the same missense mutation as spe-36(it114).

We created transgenic animals carrying extrachromosomal arrays containing a PCR product of the full F40F11.4 genomic sequence (plus upstream and downstream sequence to the boundaries of neighboring genes) and tested for the ability to rescue spe-36 sterility. We measured spe-36(as6); asEx96 self-broods and found that the transgene was able to restore hermaphrodite fertility (Figure 1A). The brood size from spe-36(as6) animals carrying a second independent array was statistically indistinguishable from spe-36(as6); asEx96 (data not shown). From the sequencing and rescue data, we assign the name spe-36 to F40F11.4.

The spe-36 gene produces a single transcript that encodes a protein of 350 amino acids (Figure 1B and S4). RT-PCR shows reduced expression in feminized hermaphrodites (fem-1(hc1)) relative to controls and no expression in hermaphrodites lacking a germline (glp-4(bn2)), indicating that spe-36 is expressed only in the germline (Figure S1). Analysis of the protein sequence predicts a single epidermal growth factor (EGF)-like domain near the C-terminus. We were surprised to find that spe-36 is not predicted to encode a transmembrane domain, but does contain a signal sequence. There is also no evidence that SPE-36 is a GPI-anchored protein (PredGPI 27). Until now, all identified sperm function proteins in C. elegans have at least one transmembrane domain 28,29. This is not surprising for proteins whose role is to mediate adhesion and fusion between the plasma membrane of the sperm and the plasma membrane of the egg. However, the SPE-36 protein sequence suggests that SPE-36 is secreted.

SPE-36 is secreted

To test our prediction that SPE-36 is a secreted protein we expressed SPE-36 tagged with GFP in body wall muscle cells and looked for uptake in the coelomocytes via endocytosis. C. elegans coelomocytes are scavenger cells that actively endocytose fluid and macromolecules from the body cavity 30. Thus, proteins secreted from the muscle will end up in the coelomocytes while non-secreted proteins expressed in the muscle will be restricted to the muscle and not appear in the coelomocytes. When expressed under the myo-3 promoter, SPE-36::GFP is visible in the coelomocytes in addition to the body wall muscle (Figure 3C–D and S2), consistent with SPE-36 being a secreted protein. In contrast, the single-pass transmembrane protein SPE-9 tagged with GFP and expressed under the myo-3 promoter is seen only in muscle cells (Figure 3E–F and S2).

Figure 3. SPE-36 is a secreted protein and acts cell autonomously.

Figure 3.

Open in a new tab

GFP-tagged proteins that are secreted from muscle cells can be taken up by the coelomocytes. GFP attached to a signal sequence (ssGFP)30, SPE-36 tagged with GFP, and SPE-9 tagged with GFP were each expressed in body wall muscle cells using the myo-3 promoter to drive expression. When expressed under the myo-3 promoter, SPE-36::GFP is present in coelomocytes (arrowheads) while the transmembrane protein SPE-9::GFP is not observed in these cells. (A-B) ssGFP (C-D) SPE-36::GFP (E-F) SPE-9::GFP. Scale bars = 10 μm (G) Hermaphrodites and males were crossed for 24 hours at 20°C. After 24 hours adults were removed from the plates. The number of progeny on each plate was counted 3 days later. For crosses with dpy-5 hermaphrodites the Dpy phenotype was used to distinguish between self-progeny (Dpy) and outcross progeny (non-Dpy). The average number of progeny for each cross is reported. n = number of crosses

See also Figure S2.

SPE-36 acts cell autonomously

Since SPE-36 is secreted we hypothesized that it may act non-cell autonomously. If secreted SPE-36 acts non-cell autonomously, we predicted that SPE-36 secreted by hermaphrodite self-sperm could render spe-36 male sperm functional and result in outcross progeny. However, when we crossed spe-36 mutant males with dpy-5 hermaphrodites the presence of wild-type hermaphrodite sperm did not increase the number of progeny sired by spe-36 males (Figure 3G). We used dpy-5 hermaphrodites for these crosses to distinguish between self-progeny (dpy-5 homozygous and have the Dpy phenotype) and outcross progeny (dpy-5 heterozygous and phenotypically WT). Next, we tested whether SPE-36 secreted by male sperm could be used by spe-36 mutant hermaphrodite sperm to allow them to fertilize eggs. We crossed spe-9(eb19); him-5 males, which are incapable of producing cross progeny due to the loss of SPE-91, with spe-36 mutant hermaphrodites to see if the hermaphrodites could now produce self-progeny. Again, we saw no increase in the number of progeny produced (Figure 3G). Thus, we found no evidence that spe-36 mutant sperm can fertilize eggs when in the presence of SPE-36 producing sperm. While we cannot rule out that the wildtype sperm failed to provide sufficient SPE-36 to the mutant sperm to observe rescue, our data strongly suggest that SPE-36 acts cell autonomously.

SPE-36 is present in the cell body and on the pseudopod of activated spermatozoa

Our observation that SPE-36 acts cell autonomously suggests that SPE-36 remains localized to the sperm after it is secreted. To test this hypothesis, we used CRISPR to add a GFP tag to the C-terminus of SPE-36 at the endogenous locus. Broodsizing confirms that the GFP tag does not interfere with SPE-36 function (Figure S3). In spermatids SPE-36 localizes to the membranous organelles (MOs) as confirmed by co-localization with wheat germ agglutinin31 (Figure 4 and S3). As SPE-36 functions during fertilization, we next observed its localization in activated spermatozoa. Sperm from C. elegans males go through spermiogenesis, i.e. sperm activation, when they are transferred to the hermaphrodite during copulation 20. In wild-type C. elegans, sperm become fertilization-competent when they are activated 32,33. To look at SPE-36::GFP in in vivo activated sperm spe-36::gfp; him-5 males were allowed to mate with spe-36::gfp; him-5 hermaphrodites for 24 hours and then the hermaphrodites were dissected to release a combination of male and hermaphrodite spermatozoa. In activated spermatozoa expressing SPE-36::GFP we observed a clear signal present in both the cell body and in patches along the pseudopod that is absent in sperm from him-5 controls (Figure 4 and Video S1). These data match what we see when we fix isolated sperm and immunostain with an anti-GFP antibody (Figure S3). The signal in the cell body often appears punctate and may represent SPE-36 that remains in the MOs after MO fusion. All together our data are consistent with a model in which SPE-36 is localized to the MOs during spermatogenesis and released when the MOs fuse with the plasma membrane during sperm activation. After it is released, SPE-36 remains associated with the sperm surface on both the cell body and pseudopod where it can participate in binding or fusion with the egg.

Figure 4. SPE-36 localization in live spermatids and activated sperm.

Figure 4.

Open in a new tab

SPE-36::GFP localizes to puncta in spermatids, consistent with SPE-36 being within MOs. (A) Spermatids from spe-36::gfp; him-5 males. (B) Spermatids from control him-5 males. In in vivo activated spermatozoa a signal is seen in both the cell body and along the edge of the pseudopod in sperm with SPE-36::GFP (C) that is absent in the him-5 controls (D).

Scale bars = 4 μm, See also Figure S3 and Video S1.

DISCUSSION

Our discovery of SPE-36 helps to establish a new class of proteins required for fertilization. All previously discovered sperm function genes, except SOF1, encode single- and multi-pass transmembrane proteins, which matches our expectations about the types of proteins that regulate membrane interactions. SPE-36 is a secreted protein that is produced by sperm and functions cell-autonomously to mediate fertilization. The spe-36 mutants phenocopy other known ‘sperm-function’ fertility mutants (reviewed in Mei and Singson, 2021). Mutant spe-36 sperm develop normally and ultimately mature into sperm that are morphologically indistinguishable from wild type at the level of both light and electron microscopy. Sperm from spe-36 mutants are motile and can both migrate to and maintain their position within the spermatheca. Yet, spe-36 mutant sperm are incapable of fertilizing wild-type oocytes regardless of whether the sperm are hermaphrodite or male derived and despite having frequent contact with mature oocytes in the spermatheca.

BLAST searches show no obvious SPE-36 homologs outside of nematodes (Figure S4). Even though there may not be direct conservation of protein sequence, we predict organisms may use a similar set of protein domains to mediate fertilization. For example, BLAST searches do not identify C. elegans SPE-45 and mammalian IZUMO1 as homologs. However, both proteins contain similar domain structures and loss-of-function mutations result in the same sterile phenotype in worms and mice, respectively 6,11. Likewise, the gamete fusogen HAP2/GCS1 is incredibly similar in protein structure to viral class II fusogens and the C. elegans somatic fusogens EFF-1 and AFF-1 despite a lack of similarity between their primary amino acid sequences 34–39.

We are beginning to find that there are multiple proteins with shared domains among the collection of sperm function proteins. In C. elegans, both SPE-45 and SPE-51, contain an Ig-like domain (Nishimura et al., 2015; Singaravelu et al., 2015; Mei et al., co-submission). Similarly, both IZUMO1 and SPACA6 are proteins with Ig-like domains that are required for mammalian fertilization 13,15,17,18. Fertilization in both worms and mammals also requires a pair of DC-STAMP domain-containing proteins: SPE-42 and SPE-49 in C. elegans, DCST1 and DCST2 in mammals 3,7,9,12. Mammalian ADAM3, Integrin Beta, SED1, and C. elegans SPE-9 and SPE-36, all contain one or more EGF domains 1,40–42. EGF motif containing proteins are commonly found on the cell surface and are known to mediate cell adhesion in other contexts 43–45. Thus, the presence of EGF motifs in these proteins suggests a potential role in cell adhesion and important protein-protein interactions during fertilization. There is also evidence that interactions can take place between these different types of domains that exist in sperm function genes. For example, during neuronal synapse development the interaction of an EGF domain containing protein, Caspr4, and an Ig domain containing protein, NB2, on the cell surface is necessary to stabilize the synapse 46.

The localization of SPE-36 and cell autonomous nature of SPE-36 function show that the protein remains associated with the sperm membrane after it is secreted. Thus, we predict that cis-interactions with other sperm function proteins keep SPE-36 tethered to the sperm. Whether SPE-36 is important for the assembly of a multi-protein complex on the sperm surface or directly interacts with one or more proteins on the egg surface remains to be determined. Genetic and biochemical experiments will be needed to identify the specific proteins that interact with SPE-36. Our studies suggest that gamete expressed genes that encode proteins with EGF motifs as well as secreted proteins should be investigated for roles in fertilization in other species. As we continue with candidate gene approaches 47–50 we need to realign our expectations of the types of proteins that represent viable candidates.

The fertilization synapse model proposes that specialized zones of interaction and multi-protein complexes composed of both trans and cis protein-protein interactions mediate gamete interaction and fusion28. This model accounts for the likely presence of molecules that mechanistically ensure adhesion, others that carry out fusion, as well as additional molecules that provide species-specific recognition between the gametes. The number of proteins necessary for fertilization that contain domains utilized for protein-protein interactions further argue for multi-protein complex(es) present on the gametes that mediate gamete interaction and fusion. As we work out the cis-interactions at the surface of each gamete, and the trans-interactions between the sperm and egg, we will continue to grow our model of a fertilization synapse that goes far beyond the recognition between a ligand and receptor pair.

STAR METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Amber R Krauchunas (arkrauch@udel.edu)

Materials availability

C. elegans strains and plasmids generated in this study will be provided by the lead contact upon request. ARK5 spe-36(as6); asEx96 [PCR product of genomic spe-36] is also available from the Caenorhabditis Genetics Center (CGC).

Data and code availability

  • All data reported in this paper will be shared by the lead contact upon request.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND CULTURE DETAILS

General maintenance and crosses of C. elegans were performed as described previously 51. Worms were cultured on MYOB (Modified Youngren’s, Only Bacto-peptone) plates seeded with OP50 E. coli, with the exception of spe-36(as1) fertility assays which were performed on NGM plates. The spe-36(it114) allele comes from an ethyl methanesulfonate (EMS) mutagenesis screen for genes with fertility defects performed by Dr. Diane Shakes while in the Kemphues laboratory at Cornell University. The spe-36(as1) and spe-36(as6) alleles were identified through a F1 non-complementation screen with spe-36(it114); unc-22 performed in the Singson laboratory.

METHOD DETAILS

Fertility Assays

The number of self-progeny for wild type (N2), spe-36 mutants, and the transgenic rescue stocks was determined by placing single hermaphrodites on separate culture plates and culturing at 20°C. Worms were transferred to fresh plates every 24 hours until each worm stopped producing progeny. After the worm was transferred off the plate the number of unfertilized oocytes on the plate was counted. The number of progeny on each plate was counted 3 days after the parent was removed. To determine male fertility, and fertility of spe-36 hermaphrodites mated to fertile males, crosses were set up in a ratio of 1 hermphrodite:4 males. Males were removed after 24 hours and hermaphrodites were transferred to fresh plates every day for 3 days. The number of progeny on each plate was counted 3 days after the parent was removed.

Fertility assays to determine cell autonomy of SPE-36

fem-1(hc17) animals were reared at 25°C until the L4 stage. All other strains were cultured at 20°C and all crosses were performed at 20°C. spe-36(as6); him-5 males were crossed with either fem-1(hc17) or dpy-5(e61) hermaphrodites in a ratio of 4:1. Alternatively, spe-36(as6) hermaphrodites were crossed with either spe-9(eb19); him-5 or spe-36(as6); him-5 males in a ratio of 1:3. For all crosses, parents were removed from the plate after 24 hours and the number of progeny produced in that 24 hour period was counted 3 days later.

Phenotypic analysis

Phenotypic analysis of spe-36 mutants was largely conducted as described previously 52. spe-36 animals lacking the rescuing transgene were identified as failing to express the myo-3p::GFP reporter in either their somatic tissue or progeny. Light microscopy, DAPI staining, sperm isolation and in vitro activation with Pronase were all performed as described in Krauchunas et al.53 and Singaravelu et al54.

Electron microscopy

Transmission Electron Microscopy (TEM) of sperm in the spermatheca were obtained as previously described 55. Worms were anesthetized with 0.5% propylene phenoxytol in M9 buffer and then fixed in a glass dish with 2.5% gluteraldehyde in 0.1 M HEPES buffer for 3–4 hours. The worms were then post-fixed in 1% osmium tetroxide for 1 hour, after which they were aligned on a thin layer of 1% agar. They were then covered with a drop of molten 1% agar and worm-containing blocks of agar cut out. These blocks were dehydrated in a graded series of acetone and infiltrated and imbedded in Epon–Spurr resin. Thin sections (90–100nm) were cut using a Reichert Ultracut E microtome with a diamond knife. The sections were lifted to copper grids and double-stained using ethanoic uranyl acetate (10 min) and lead citrate (2 min). Sections were examined and photographed at 80 kV with a JEOL 1200 electron microscope.

Assessing mating, sperm transfer, and migration

cylc-2(mon2[C41G7.6::mNĜ3xFLAG) 21 was crossed into spe-36(as6); him-5(e1490) to produce cylc-2(mon2[C41G7.6::mNĜ3xFLAG) I; spe-36(as6) IV; him-5(e1490) V. Wild-type and spe-36 males with mNG marked sperm were crossed with L4 N2 hermaphrodites in a ratio of 10 hermaphrodites to 30 males per plate (3 plates per group). Approximately 24 hours later the males were removed from the plates. 4–6 hours after the males were removed the hermaphrodites were mounted on 2% agarose pads in M9 with 10 mM levamisole and imaged.

Whole genome sequencing and analysis

spe-36(it114) hermaphrodites and spe-36(as6) hermaphrodites were crossed with males from the polymorphic wild-type Hawaiian strain CB4856. For each allele, individual F2 hermaphrodites were picked at the L4 stage to 20 24-well plates and scored the following day for sterility. Approximately 100 sterile (spe-36 homozygous) hermaphrodites for each allele were pooled separately for preparation of genomic DNA as described in Smith et al. 56. 10 ng of fragmented DNA was used for library preparation using KAPA Hyper Prep Kit (KAPA Biosystems) according to the manufacturer’s instruction. PCR was performed on library DNA for 12 cycles after which all libraries were pooled according to Illumina HiSeq specifications. Sequencing was performed at JHU Genetic Resources Core Facility using an Illumina HiSeq 2500 platform with a 50-nt single-end run and dedicated index sequencing. Demultiplexed data was analyzed using MiModD (https://mimodd.readthedocs.io/en/latest/nacreousmap.html).

Preparation of transgenic rescue lines

Young adult N2 hermaphrodites were microinjected with a PCR product of genomic F40F11.4 including 479 bp of DNA upstream and 303 bp downstream of the coding sequence along with myo-3p::gfp (100 μg/ml) as a transformation marker. Once transgenic lines were established the extrachromosomal array was crossed into spe-36(as6) to establish rescue of the sterile phenotype.

RT-PCR

RNA was isolated using the Zymo Direct-zol RNA MicroPrep kit per manufacturer’s instructions. N2 and fem-1 hermaphrodites were hand-picked at the L4 stage for RNA extraction. glp-4(bn2); him-5 and him-5 worms were bleach synchronized and collected as adults for RNA extraction. Temperature-sensitive strains were grown at 25°C to produce feminized or germline-less animals. cDNA was synthesized using the LunaScript RT SuperMix Kit (NEB) per manufacturer’s instructions and used at the template for PCR with primers to spe-36 or actin. See Table S1 for primer sequences.

Preparation of transgenic lines expressing spe-36::gfp or spe-9::gfp in muscle

spe-36 and spe-9 cDNAs were PCR amplified with primers designed for Gibson assembly and containing sequence overlap with the plasmid pJF2557 (myo-3p::ssGFP, gift from Barth Grant). Restriction digest was performed with AgeI and XbaI to linearize pJF25 and remove the signal peptide upstream of GFP. Gibson assembly was used to insert either spe-36 cDNA or spe-9 cDNA in frame between the myo-3 promoter and GFP protein sequence. Plasmids were microinjected into N2 worms along with myo-2p::mCherry as a transformation marker. Once transgenic lines were established worms were imaged using a Zeiss Universal microscope to confirm expression of GFP in the body wall muscles and determine if the GFP signal was also present in the coelomocytes.

CRISPR editing

CRISPR editing was carried out similar to the protocol described in 58. An sgRNA targeting spe-36 was ordered from Synthego with the sequence AUUCGCAUUGUCUGAAGAGA. A repair template containing homology arms to the endogenous spe-36 locus flanking a GFP coding sequence that was engineered to be resistant to piRNA silencing 59 was synthesized as a gene fragment by IDT. CRISPR-Cas9 ribonucleoprotein complexes and repair templates were injected into HCL67 hermaphrodites which express Cas9 in the germline 59. Edited worms were sequenced by Sanger sequencing to confirm the gfp insertion. Worms were then outcrossed to him-5(e1490) and genotyped by PCR to confirm they were homozygous for the gfp insertion and no longer carrying the Cas9 transgene. See Table S2 for guide RNA and repair template sequences.

Immunostaining

Worms were dissected and immunostained similar to previously described methods 60,61. To observe spermatids, males were transferred onto a new plate for approximately 24 hours and then dissected with a needle into 1X Sperm media on charged slides (VWR Histobond slides). To observe in vivo activated spermatozoa, approximately 20 L4 stage hermaphrodites and 25 L4 males were transferred onto the same plate and left for 24 hours. The following day, hermaphrodites were removed and dissected using a needle to release sperm onto charged adhesive slides. Samples were fixed with 4% paraformaldehyde in 1X sperm media + dextrose. Following fixation and permeabilization, slides were blocked with 20% Normal Goat Serum and 0.9% Bovine Serum Albumin in PBS. Polyclonal rabbit anti-GFP primary antibody was used at a 1:500 dilution in PBSTween + BSA (Novus Biologicals, Littleton, CO). Alexa Fluor 488-conjugated goat anti-Rabbit IgG secondary antibody was used at a 1:200 dilution in PBSTween + BSA (Thermo FisherScientific, Waltham, MA). For co-staining with Wheat Germ Agglutinin (WGA), rhodamine-conjugated WGA (Invitrogen) was used at a 1:100 dilution in PBS and was added at the last 10 minutes of secondary incubation. After the final wash, antifade mounting medium with DAPI (Vector-Laboratories, Burlingame, CA) was added to the slides and samples were covered with a coverslip. Slides were imaged using a ZEISS Axio Observer D1 inverted microscope using a 100X objective.

Live imaging of sperm

Approximately 10 L4 stage hermaphrodites and 30 L4 males were transferred onto the same plate and left for 24 hours at 20°C. The following day, hermaphrodites were removed and dissected using a needle to release spermatozoa onto a charged adhesive slide. To observe spermatids, males were isolated to a separate plate and dissected the following day. Samples were dissected in 1X sperm media then covered with a coverslip. Slides were imaged using an Andor Dragonfly Spinning Disk & Super Resolution Confocal Microscope using a 63x objective, Sona sCMOS camera, and Fusion Control Software (v. 2.4.0.6). Images were deconvolved in the software Fusion (v. 9.9.1). Image processing and 3D max projections were done using Imaris. Imaging parameters were kept constant for all samples and min and max intensity values are matched between spe-36::gfp; him-5 and him-5 control images.

QUANTIFICATION AND STATISTICAL ANALYSIS

Where p-values are specified, t-tests were performed using GraphPad Prism software. Values and definitions of n are provided in the text and/or figure legends.

Supplementary Material

1
2

Video S1. 3D max projection of SPE-36::GFP in spermatozoa, Related to Figure 4.

Download video file (7.6MB, mp4)

Key resources table.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Polyclonal rabbit anti-GFP primary antibody Novus Biologicals NB600-308
Alexa Fluor 488-conjugated goat anti-Rabbit IgG secondary antibody ThermoFisher A11034
Bacterial and virus strains
Escherichia coli OP50-1 CGC N/A
Chemicals, peptides, and recombinant proteins
Protease from Streptomyces griseus Sigma P-6911
Vectashield with DAPI Mounting Medium for Fluorescence Vector Laboratories H-1200
S. pyogenes Cas9 (10ug/uL) IDT 1081058
Nuclease-free Duplex buffer IDT 11- 01-03-01
Invitrogen™ Wheat Germ Agglutinin, Tetramethylrhodamine Conjugate Fisher Scientific W849
Critical commercial assays
Zymo Direct-zol RNA MicroPrep kit Zymo Research R2061
LunaScript RT SuperMix kit NEB E3010S
Phusion high fidelity DNA polymerase NEB M0530S
Expand Long Template PCR system Roche 11681834001
NEBuilder® HiFi DNA Assembly Master Mix NEB E2621S
Miniprep kit Qiagen 27104
PCR purification kit Qiagen 28104
MinElute PCR purification kit Qiagen 28004
Gel extraction kit Qiagen 28704
LongAmp Taq PCR kit NEB E5200S
Competent cells NEB C2987H
KAPA HiFi HS+dNTPs (100U) Roche KK2501
KAPA Hyper Prep PCR-free (8rxn) Roche KK8501
AMPure XP beads Beckman Coulter A63880
Experimental models: Organisms/strains
C. elegans: Strain N2 Caenorhabditis Genetics Center (CGC) N2
C. elegans: Strain BA829 spe-36(it114) unc-22 Ken Kemphues, Cornell University BA829
C. elegans: Strain AD99 spe-36(as1) This study AD99
C. elegans: Strain AD105 spe-36(as6) This study AD105
C. elegans: Strain CB4856 Hawaiian mapping strain CGC CB4856
C. elegans: Strain DR466 him-5(e1490) CGC DR466
C. elegans: Strain BA17 fem-1(hc17) CGC BA17
C. elegans: Strain CB61 dpy-5(e61) CGC CB61
C. elegans: Strain AD348 glp-4(bn2); him-5(e1490) Cross between SS104 and DR466 AD348
C. elegans: Strain MDX44 cylc-2(mon2[cylc-2::mNG^3xFLAG]) Krauchunas et al., 202021 MDX44
C. elegans: Strain SL438 spe-9(eb19) I; him-5(e1490) V; ebEx126 CGC SL438
C. elegans: Strain RT36 arIs37 [myo-3p::ssGFP] Barth Grant, Rutgers University RT36
C. elegans: Strain HCL67 unc-119(ed3) III; uocIsl [eft-3p::Cas9(dpiRNA)::tbb-2 3′ UTR + unc-119(+)] CGC59 HCL67
C. elegans: Strain ARK5 spe-36(as6); asEx96 [PCR product of genomic spe-36] This study ARK5
C. elegans: Strain ARK6 spe-36(as6); him-5(e1490); asEx96 This study ARK6
C. elegans: Strain ARK7 spe-36(nwk1[spe-36::gfp]); him-5(e1490) This study ARK7
C. elegans: Strain ARK17 cylc-2(mon2); spe-36(as6); him-5(e1490); asEx96 This study ARK17
C. elegans: Strain AD349 asEx112 [myo-3p::spe-36::gfp] This study AD349
C. elegans: Strain AD350 asEx113 [myo-3p::spe-9::gfp] This study AD350
Oligonucleotides
PCR Primer for TruSeq library amplification, SG – 915 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA Sam Gu, Rutgers University, designed by Illumina n/a
PCR Primer for TruSeq library amplification, SG – 916 CAAGCAGAAGACGGCATACGAGAT Sam Gu, Rutgers University designed by Illumina n/a
PCR Primer to amplify F40F11.4 plus 479 bp upstream and 303 bp downstream GGAAGAATGTAACGGCTGCTATC This study n/a
PCR Primer to amplify F40F11.4 plus 479 bp upstream and 303 bp downstream CCGGATTGAGGTTGGTGTTT This study n/a
PCR Primer to amplify spe-36 for Gibson assembly CCCACGACCACTAGATCCATCTAGAAAAAAATGAATTTCAAAATATGTATTCTGTTC This study n/a
PCR Primer to amplify spe-36 for Gibson assembly TCCTTTACTCATTTTTTCTACCGGTAACAATTCATCCATCTCTTCAG This study n/a
PCR Primer to amplify spe-9 for Gibson assembly CCCACGACCACTAGATCCATCTAGAAAAAAATGAATGTGATTCTGGTG This study n/a
PCR Primer to amplify spe-9 for Gibson assembly TCCTTTACTCATTTTTTCTACCGGTAAAAATGGATTCTCAGTTTTCAC This study n/a
PCR primers for RT-PCR can be found in Table S1
Oligos and RNAs for CRISPR can be found in Table S2
Recombinant DNA
PJF25 Barth Grant, Rutgers University57
myo-3p::spe-36::gfp (signal peptide replaced with spe-36 cDNA in PJF25) This study
myo-3p::spe-9::gfp (signal peptide replaced with spe-9 cDNA in PJF25) This study
Software and algorithms
MimodD https://mimodd.readthedocs.io/en/latest/
FUSION https://fusion.help.andor.com/display/fusionum/Introduction
Imaris https://imaris.oxinst.com/
Zeiss Zen https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html
GraphPad Prism https://www.graphpad.com/
Open in a new tab

Highlights:

  • Mutations in spe-36 result in a sperm-specific defect.

  • Sperm from spe-36 mutants make contact with eggs, but fail to fertilize them.

  • SPE-36 is secreted and acts cell autonomously.

  • SPE-36 is localized to MOs and the pseudopod of activated sperm.

Acknowledgments

We would like to thank Diane Shakes for the original discovery of spe-36(it114), Steve L’Hernault for confirming the phenotype, Pavan Kadandale for assistance mapping the allele, David Hall for assistance with electron microscopy, Jeremy Bird for careful reading of the manuscript, and reviewers for their helpful suggestions. We thank Timothy Chaya, Sylvain Le Marchand, and Jeffrey Caplan in the UD Bio-Imaging Center for assistance with SPE-36::GFP imaging. The Bio-Imaging Andor Dragonfly was acquired with a shared instrumentation grant (S10 OD030321) and microscopy access was supported by the NIH-NIGMS (P20 GM103446), the NIGMS (P20 GM139760) and the State of Delaware. This work was supported by National Institutes of Health R01HD054681 to AS. We thank the CGC (which is funded by NIH Office of Research Infrastructure Programs P40 OD010440) and WormBase.

Footnotes

Declaration of interests

The authors declare no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Singson A, Mercer KB, and L’Hernault SW (1998). The C. elegans spe-9 gene encodes a sperm transmembrane protein that contains EGF-like repeats and is required for fertilization. Cell 93, 71–79. [DOI] [PubMed] [Google Scholar]
  • 2.Chatterjee I, Richmond A, Putiri E, Shakes DC, and Singson A (2005). The Caenorhabditis elegans spe-38 gene encodes a novel four-pass integral membrane protein required for sperm function at fertilization. Dev. Camb. Engl. 132, 2795–2808. 10.1242/dev.01868. [DOI] [PubMed] [Google Scholar]
  • 3.Kroft TL, Gleason EJ, and L’Hernault SW (2005). The spe-42 gene is required for sperm-egg interactions during C. elegans fertilization and encodes a sperm-specific transmembrane protein. Dev. Biol. 286, 169–181. 10.1016/j.ydbio.2005.07.020. [DOI] [PubMed] [Google Scholar]
  • 4.L’Hernault SW, Shakes DC, and Ward S (1988). Developmental Genetics of Chromosome I Spermatogenesis-Defective Mutants in the Nematode Caenorhabditis Elegans. Genetics 120, 435–452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Roberts TM, and Ward S (1982). Centripetal flow of pseudopodial surface components could propel the amoeboid movement of Caenorhabditis elegans spermatozoa. J. Cell Biol. 92, 132–138. 10.1083/jcb.92.1.132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Singaravelu G, Rahimi S, Krauchunas A, Rizvi A, Dharia S, Shakes D, Smith H, Golden A, and Singson A (2015). Forward Genetics Identifies a Requirement for the Izumo-like Immunoglobulin Superfamily spe-45 Gene in Caenorhabditis elegans Fertilization. Curr. Biol. CB 25, 3220–3224. 10.1016/j.cub.2015.10.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wilson LD, Obakpolor OA, Jones AM, Richie AL, Mieczkowski BD, Fall GT, Hall RW, Rumbley JN, and Kroft TL (2018). The Caenorhabditis elegans spe-49 gene is required for fertilization and encodes a sperm-specific transmembrane protein homologous to SPE-42. Mol. Reprod. Dev. 85, 563–578. 10.1002/mrd.22992. [DOI] [PubMed] [Google Scholar]
  • 8.Xu X-ZS, and Sternberg PW (2003). A C. elegans sperm TRP protein required for sperm-egg interactions during fertilization. Cell 114, 285–297. 10.1016/s0092-8674(03)00565-8. [DOI] [PubMed] [Google Scholar]
  • 9.Inoue N, Hagihara Y, and Wada I (2021). Evolutionarily conserved sperm factors, DCST1 and DCST2, are required for gamete fusion. eLife 10. 10.7554/eLife.66313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Krauchunas AR, and Singson A (2016). Marriage shrines and worms impacting our understanding of mammalian fertilization. Worm 5, e1184389. 10.1080/21624054.2016.1184389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nishimura H, Tajima T, Comstra HS, Gleason EJ, and L’Hernault SW (2015). The Immunoglobulin-like Gene spe-45 Acts during Fertilization in Caenorhabditis elegans like the Mouse Izumo1 Gene. Curr. Biol. CB 25, 3225–3231. 10.1016/j.cub.2015.10.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Noda T, Blaha A, Fujihara Y, Gert KR, Emori C, Deneke VE, Oura S, Berent S, Kodani M, Panser K, et al. (2021). Sperm membrane proteins DCST1 and DCST2 are required for the sperm-egg fusion process in mice and fish. bioRxiv, 2021.04.18.440256. 10.1101/2021.04.18.440256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Barbaux S, Ialy-Radio C, Chalbi M, Dybal E, Homps-Legrand M, Do Cruzeiro M, Vaiman D, Wolf J-P, and Ziyyat A (2020). Sperm SPACA6 protein is required for mammalian Sperm-Egg Adhesion/Fusion. Sci. Rep. 10, 5335. 10.1038/s41598-020-62091-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Fujihara Y, Lu Y, Noda T, Oji A, Larasati T, Kojima-Kita K, Yu Z, Matzuk RM, Matzuk MM, and Ikawa M (2020). Spermatozoa lacking Fertilization Influencing Membrane Protein (FIMP) fail to fuse with oocytes in mice. Proc. Natl. Acad. Sci. 117, 9393–9400. 10.1073/pnas.1917060117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Inoue N, Ikawa M, Isotani A, and Okabe M (2005). The immunoglobulin superfamily protein Izumo is required for sperm to fuse with eggs. Nature 434, 234–238. 10.1038/nature03362. [DOI] [PubMed] [Google Scholar]
  • 16.Lamas-Toranzo I, Hamze JG, Bianchi E, Fernández-Fuertes B, Pérez-Cerezales S, Laguna-Barraza R, Fernández-González R, Lonergan P, Gutiérrez-Adán A, Wright GJ, et al. (2020). TMEM95 is a sperm membrane protein essential for mammalian fertilization. eLife 9. 10.7554/eLife.53913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lorenzetti D, Poirier C, Zhao M, Overbeek PA, Harrison W, and Bishop CE (2014). A transgenic insertion on mouse chromosome 17 inactivates a novel immunoglobulin superfamily gene potentially involved in sperm-egg fusion. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 25, 141–148. 10.1007/s00335-013-9491-x. [DOI] [PubMed] [Google Scholar]
  • 18.Noda T, Lu Y, Fujihara Y, Oura S, Koyano T, Kobayashi S, Matzuk MM, and Ikawa M (2020). Sperm proteins SOF1, TMEM95, and SPACA6 are required for sperm-oocyte fusion in mice. Proc. Natl. Acad. Sci. U. S. A. 117, 11493–11502. 10.1073/pnas.1922650117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Albertson DG (1984). Formation of the first cleavage spindle in nematode embryos. Dev. Biol. 101, 61–72. 10.1016/0012-1606(84)90117-9. [DOI] [PubMed] [Google Scholar]
  • 20.Ward S, and Carrel JS (1979). Fertilization and sperm competition in the nematodeCaenorhabditis elegans. Dev. Biol. 73, 304–321. 10.1016/0012-1606(79)90069-1. [DOI] [PubMed] [Google Scholar]
  • 21.Krauchunas AR, Werner M, Britt N, Chen DS, Maddox AS, and Singson A (2020). C. elegans CYLC-2 localizes to sperm. MicroPublication Biol. 2020. 10.17912/micropub.biology.000314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.LaMunyon CW, and Ward S (1995). Sperm precedence in a hermaphroditic nematode (Caenorhabditis elegans) is due to competitive superiority of male sperm. Experientia 51, 817–823. 10.1007/BF01922436. [DOI] [PubMed] [Google Scholar]
  • 23.Singson A, Hill KL, and L’Hernault SW (1999). Sperm Competition in the Absence of Fertilization in Caenorhabditis elegans. Genetics 152, 201–208. 10.1093/genetics/152.1.201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Muhlrad PJ, and Ward S (2002). Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene. Genetics 161, 143–155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shakes DC, and Ward S (1989). Initiation of spermiogenesis in C. elegans: a pharmacological and genetic analysis. Dev. Biol. 134, 189–200. 10.1016/0012-1606(89)90088-2. [DOI] [PubMed] [Google Scholar]
  • 26.Doitsidou M, Poole RJ, Sarin S, Bigelow H, and Hobert O (2010). C. elegans mutant identification with a one-step whole-genome-sequencing and SNP mapping strategy. PloS One 5, e15435. 10.1371/journal.pone.0015435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pierleoni A, Martelli PL, and Casadio R (2008). PredGPI: a GPI-anchor predictor. BMC Bioinformatics 9, 392. 10.1186/1471-2105-9-392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Krauchunas AR, Marcello MR, and Singson A (2016). The molecular complexity of fertilization: Introducing the concept of a fertilization synapse. Mol. Reprod. Dev. 83, 376–386. 10.1002/mrd.22634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mei X, and Singson AW (2021). The molecular underpinnings of fertility: Genetic approaches in Caenorhabditis elegans. Adv. Genet. 2, e10034. 10.1002/ggn2.10034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fares H, and Grant B (2002). Deciphering endocytosis in Caenorhabditis elegans. Traffic Cph. Den. 3, 11–19. 10.1034/j.1600-0854.2002.30103.x. [DOI] [PubMed] [Google Scholar]
  • 31.Ward S, Hogan E, and Nelson GA (1983). The initiation of spermiogenesis in the nematode Caenorhabditis elegans. Dev. Biol. 98, 70–79. 10.1016/0012-1606(83)90336-6. [DOI] [PubMed] [Google Scholar]
  • 32.Ellis RE, and Stanfield GM (2014). The regulation of spermatogenesis and sperm function in nematodes. Semin. Cell Dev. Biol. 0, 17–30. 10.1016/j.semcdb.2014.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Minniti AN, Sadler C, and Ward S (1996). Genetic and Molecular Analysis of Spe-27, a Gene Required for Spermiogenesis in Caenorhabditis Elegans Hermaphrodites. Genetics 143, 213–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Clark T (2018). HAP2/GCS1: Mounting evidence of our true biological EVE? PLoS Biol. 16, e3000007. 10.1371/journal.pbio.3000007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fedry J, Forcina J, Legrand P, Péhau-Arnaudet G, Haouz A, Johnson M, Rey FA, and Krey T (2018). Evolutionary diversification of the HAP2 membrane insertion motifs to drive gamete fusion across eukaryotes. PLoS Biol. 16, e2006357. 10.1371/journal.pbio.2006357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fédry J, Liu Y, Péhau-Arnaudet G, Pei J, Li W, Tortorici MA, Traincard F, Meola A, Bricogne G, Grishin NV, et al. (2017). The Ancient Gamete Fusogen HAP2 Is a Eukaryotic Class II Fusion Protein. Cell 168, 904–915.e10. 10.1016/j.cell.2017.01.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pérez-Vargas J, Krey T, Valansi C, Avinoam O, Haouz A, Jamin M, Raveh-Barak H, Podbilewicz B, and Rey FA (2014). Structural basis of eukaryotic cell-cell fusion. Cell 157, 407–419. 10.1016/j.cell.2014.02.020. [DOI] [PubMed] [Google Scholar]
  • 38.Pinello JF, Lai AL, Millet JK, Cassidy-Hanley D, Freed JH, and Clark TG (2017). Structure-Function Studies Link Class II Viral Fusogens with the Ancestral Gamete Fusion Protein HAP2. Curr. Biol. CB 27, 651–660. 10.1016/j.cub.2017.01.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Valansi C, Moi D, Leikina E, Matveev E, Graña M, Chernomordik LV, Romero H, Aguilar PS, and Podbilewicz B (2017). Arabidopsis HAP2/GCS1 is a gamete fusion protein homologous to somatic and viral fusogens. J. Cell Biol. 216, 571–581. 10.1083/jcb.201610093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ensslin MA, and Shur BD (2003). Identification of mouse sperm SED1, a bimotif EGF repeat and discoidin-domain protein involved in sperm-egg binding. Cell 114, 405–417. 10.1016/s0092-8674(03)00643-3. [DOI] [PubMed] [Google Scholar]
  • 41.Takagi J, Beglova N, Yalamanchili P, Blacklow SC, and Springer TA (2001). Definition of EGF-like, closely interacting modules that bear activation epitopes in integrin β subunits. Proc. Natl. Acad. Sci. 98, 11175–11180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Yuan R, Primakoff P, and Myles DG (1997). A role for the disintegrin domain of cyritestin, a sperm surface protein belonging to the ADAM family, in mouse sperm-egg plasma membrane adhesion and fusion. J. Cell Biol. 137, 105–112. 10.1083/jcb.137.1.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Carpenter G, and Cohen S (1990). Epidermal growth factor. J. Biol. Chem. 265, 7709–7712. [PubMed] [Google Scholar]
  • 44.Stenflo J (1991). Structure-function relationships of epidermal growth factor modules in vitamin K-dependent clotting factors. Blood 78, 1637–1651. 10.1182/blood.V78.7.1637.1637. [DOI] [PubMed] [Google Scholar]
  • 45.Wagner G, and Wyss DF (1994). Cell surface adhesion receptors. Curr. Opin. Struct. Biol. 4, 841–851. 10.1016/0959-440X(94)90265-8. [DOI] [PubMed] [Google Scholar]
  • 46.Ashrafi S, Betley JN, Comer JD, Brenner-Morton S, Bar V, Shimoda Y, Watanabe K, Peles E, Jessell TM, and Kaltschmidt JA (2014). Neuronal Ig/Caspr Recognition Promotes the Formation of Axoaxonic Synapses in Mouse Spinal Cord. Neuron 81, 120–129. 10.1016/j.neuron.2013.10.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Holcomb RJ, Oura S, Nozawa K, Kent K, Yu Z, Robertson MJ, Coarfa C, Matzuk MM, Ikawa M, and Garcia TX (2020). The testis-specific serine proteases PRSS44, PRSS46, and PRSS54 are dispensable for male mouse fertility†. Biol. Reprod. 102, 84–91. 10.1093/biolre/ioz158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Lu Y, Oura S, Matsumura T, Oji A, Sakurai N, Fujihara Y, Shimada K, Miyata H, Tobita T, Noda T, et al. (2019). CRISPR/Cas9-mediated genome editing reveals 30 testis-enriched genes dispensable for male fertility in mice†. Biol. Reprod. 101, 501–511. 10.1093/biolre/ioz103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, et al. (2016). Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. Proc. Natl. Acad. Sci. 113, 7704–7710. 10.1073/pnas.1608458113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Noda T, Sakurai N, Nozawa K, Kobayashi S, Devlin DJ, Matzuk MM, and Ikawa M (2019). Nine genes abundantly expressed in the epididymis are not essential for male fecundity in mice. Andrology 7, 644–653. 10.1111/andr.12621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Brenner S (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Marcello MR, Singaravelu G, and Singson A (2013). Fertilization. In Germ Cell Development in C. elegans Advances in Experimental Medicine and Biology., Schedl T, ed. (Springer; New York: ), pp. 321–350. 10.1007/978-1-4614-4015-4_11. [DOI] [PubMed] [Google Scholar]
  • 53.Krauchunas AR, Mendez E, Ni JZ, Druzhinina M, Mulia A, Parry J, Gu SG, Stanfield GM, and Singson A (2018). spe-43 is required for sperm activation in C. elegans. Dev. Biol. 436, 75–83. 10.1016/j.ydbio.2018.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Singaravelu G, Chatterjee I, Marcello MR, and Singson A (2011). Isolation and in vitro activation of Caenorhabditis elegans sperm. J. Vis. Exp. JoVE, 2336. 10.3791/2336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.L’Hernault SW, and Roberts TM (1995). Cell biology of nematode sperm. Methods Cell Biol. 48, 273–301. 10.1016/s0091-679x(08)61392-8. [DOI] [PubMed] [Google Scholar]
  • 56.Smith HE, Fabritius AS, Jaramillo-Lambert A, and Golden A (2016). Mapping Challenging Mutations by Whole-Genome Sequencing. G3 Bethesda Md 6, 1297–1304. 10.1534/g3.116.028316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Fares H, and Greenwald I (2001). Regulation of endocytosis by CUP-5, the Caenorhabditis elegans mucolipin-1 homolog. Nat. Genet. 28, 64–68. 10.1038/ng0501-64. [DOI] [PubMed] [Google Scholar]
  • 58.Paix A, Folkmann A, and Seydoux G (2017). Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods San Diego Calif 121–122, 86–93. 10.1016/j.ymeth.2017.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Zhang D, Tu S, Stubna M, Wu W-S, Huang W-C, Weng Z, and Lee H-C (2018). The piRNA targeting rules and the resistance to piRNA silencing in endogenous genes. Science 359, 587–592. 10.1126/science.aao2840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Arduengo PM, Appleberry OK, Chuang P, and L’Hernault SW (1998). The presenilin protein family member SPE-4 localizes to an ER/Golgi derived organelle and is required for proper cytoplasmic partitioning during Caenorhabditis elegans spermatogenesis. J. Cell Sci. 111, 3645–3654. 10.1242/jcs.111.24.3645. [DOI] [PubMed] [Google Scholar]
  • 61.Zannoni S., L’Hernault SW., and Singson AW. (2003). Dynamic localization of SPE-9 in sperm: a protein required for sperm-oocyte interactions in Caenorhabditis elegans. BMC Dev. Biol. 3, 10. 10.1186/1471-213X-3-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1914667-supplement-1.pdf (30.7MB, pdf)
2

Video S1. 3D max projection of SPE-36::GFP in spermatozoa, Related to Figure 4.

Download video file (7.6MB, mp4)

Data Availability Statement

  • All data reported in this paper will be shared by the lead contact upon request.

  • This paper does not report original code.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

RESOURCES