Abstract
Background
Dysferlinopathy has a high prevalence in relatively isolated ethnic groups where consanguineous marriages are characteristic and/or the founder effect exists. However, the frequency of endemic mutations in most isolates has not been investigated.
Methods
The prevalence of the pathological DYSF gene variant (NM_003494.4); c.200_201delinsAT, p. Val67Asp (rs121908957) was investigated in an isolated Avar population in the Republic of Dagestan. Genetic screenings were conducted in a remote mountainous region characterized by a high level of consanguinity among its inhabitants. In total, 746 individuals were included in the screenings.
Results
This pathological DYSF gene variant causes two primary phenotypes of dysferlinopathy: limb‐girdle muscular dystrophy (LGMD) type R2 and Miyoshi muscular dystrophy type 1. Results indicated a high prevalence of the allele at 14% (95% confidence interval [CI]: 12–17; 138 out of 1518 alleles), while the allele in the homozygous state was detected in 29 cases—3.8% (CI: 2.6–5.4). The population load for dysferlinopathy was 832.3 ± 153.9 per 100,000 with an average prevalence of limb‐girdle muscular dystrophies ranging from 0.38 ± 0.38 to 5.93 ± 1.44 per 100,000.
Conclusion
A significant burden of the allele was due to inbreeding, as evidenced by a deficiency of heterozygotes and the Wright fixation index equal to 0.14 (CI 0.06–0.23).
Keywords: DYSF, dysferlinopathy, endemic allele, endogamy, ethnic isolate, founder effect
Genetic screenings were conducted in a remote mountainous region characterized by a high level of consanguinity among its inhabitants. Results indicated a high prevalence of the c.200_201delinsAT, p. Val67Asp allele at 14% (95% confidence interval [CI]: 12–17; 138 out of 1518 alleles), while the allele in the homozygous state was detected in 29 cases—3.8% (CI 2.6–5.4). A significant burden of the allele was due to inbreeding, as evidenced by a deficiency of heterozygotes and the Wright fixation index equal to 0.14 (CI: 0.06–0.23).

1. INTRODUCTION
Dysferlinopathy is a phenotypically heterogeneous disease caused by pathogenic variants in the DYSF gene (MIM#603009) and is typified by progressive muscle weakness caused by the death of muscle fibers (Aoki, 1993). The prevalence of dysferlinopathy among different countries is approximately 5–10 per 1,000,000 (Mah et al., 2016; Theadom et al., 2014). As of 2015, the existing Universal Mutation Database for Dysferlin (UMD‐DYSF), established in Marseille in 2000 (Béroud et al., 2000) in collaboration with the North American Jain Foundation, contains data on 1174 mutations and 843 patients worldwide (Blandin et al., 2012; Urtizberea, 2011). Dysferlinopathy is most common in regions with a high level of consanguinity such as the Maghreb countries, Israel, Saudi Arabia, Egypt, Iran, India, and the Republic of Dagestan (Fanin & Angelini, 2016; Illarioshkin et al., 2000; Umakhanova et al., 2017). Dysferlinopathy is also common in Japan (Tagawa et al., 2003) and Italy (Bejaoui et al., 1995). Dysferlinopathy ranks second after calpainopathy in terms of prevalence among limb‐girdle muscular dystrophies in southern and northern Europe (Fanin & Angelini, 2016). The presence of geographically, or culturally mediated, isolate populations with a high level of consanguineous marriages or the presence of the founder effect significantly increases the local prevalence of the condition. In particular, ethnic groups in which the proportion of individual mutations is high include Jewish populations in Tripoli, Libya (c.1624delG; frequency = 9.75%) (Argov et al., 2000), Spaniards (c.6086C>T (p.R1905X)) (Vilchez et al., 2005), Italians (c.2875C>T (p.R959W)) (Cagliani et al., 2003), Jewish populations in the Caucasus (c.2779delG; approximate frequency of 4%) (Leshinsky‐Silver et al., 2007), Mexicans (c.1418G>D) (Rosas‐Vargas et al., 2007), Saudi Arabians (c.164_165insA) (Alharbi et al., 2022), and the Avars of the Republic of Dagestan (c.200_201delinsAT (p.Val67Asp)) (Illarioshkin et al., 2000; Umakhanova et al., 2017). However, screening for endemic variants of the DYSF gene have only been carried out in a minority of the described ethnic groups. Therefore, the aim of this study was to assess the prevalence of the endemic pathogenic variant of the DYSF gene (the c.200_201delinsAT allele) among residents of a village in the Botlikhsky district of the Republic of Dagestan via genetic screening.
2. PATIENTS AND METHODS
2.1. Ethical compliance and patients
Genetic screening was voluntary and anonymous. Informed written consent was obtained from screened individuals or by the parents of underage participants and was followed by medical genetic counseling if necessary. The study was based on all legal and regulatory acts regulating the collection, analysis, and storage of genetic data in the Russian Federation and was approved by the local ethics committee of the Dagestan Medical University (protocol #AC‐391‐032021).
The study included 759 residents from multiple villages in the Botlikhsky district in the Republic of Dagestan, Russian Federation (Figure 1). The sample was formed by the random sampling of 746 individuals, as well as the inclusion of 13 previously identified patients with dysferlinopathy (participants mainly from Rakhata village with a population of 3484).
FIGURE 1.

Distribution of subjects by age groups, n = 759.
2.2. Genetic testing
DNA was obtained from peripheral venous blood. The search for the c.200_201delinsAT mutation in DYSF (NM_003494.4) was carried out by PCR according to the standard method (Lorenz, 2012). The primer sequence used was: agtgccctggtggcacgaagg and cctacctgcaccttcaagccatgg, and the length of the product was 228 base pairs. In the first round of PCR, BETAQ‐1000 Bullseye Taq DNA Polymerase (Midwest Scientific) was used. The PCR products were then dispersed in a 2.5% agarose gel and visualized under ultraviolet light. The sequencing reaction was performed using the BigDye™ Terminator v1.1 Cycle Sequencing Kit and amplification primers (ThermoFisher Scientific). Capillary electrophoresis was performed on a 3130xl Genetic Analyzer (Applied Biosystems).
The endemic allele in the previously identified 13 patients who were not included in the screening was detected by whole exome sequencing and analyzed. This was conducted via the pair‐ended method (2 × 75 base pairs) on an Illumina NextSeq 500 platform using the selective capture of DNA regions belonging to the coding regions of more than 20,000 genes (Illumina TruSeq ExomeKit; Illumina Inc.). The average read coverage in all samples was 78.7x with a read length of 2 × 75 bp.
2.3. Statistical analysis
The quantitative results of this study are presented as mean (M) or median (Me) values with 95% confidence intervals (calculated via the Klopper‐Pearson and bootstrap methods) depending on whether the data were normally distributed. Statistical significance was evaluated using the Mann–Whitney signed‐rank test and Student's t‐test (p < 0.05).
3. RESULTS
There were slightly more females (397/759; 52%) than males (362/759; 48%) in our sample. The average age of the participants was 17 years. Among subjects under 25, those between 10 and 14 years old predominated. The distribution of participants by age groups is shown in Figure 1. The genotypes of the 759 study participants revealed a high prevalence for the c.200_201delinsAT allele at 14.4% (CI: 12.6–16.2) (218 out of 1518 analyzed alleles). In 21% (CI 18–24) of the subjects, the allele was found in the heterozygous state in individuals with no clinical or laboratory manifestations of dysferlinopathy. In 29 cases—3.8% (CI: 3–5), both alleles were represented by the endemic variant (recessive homozygotes), causing varying degrees of clinical manifestations. A majority of the study participants—570 individuals (75% [CI: 72–78]) did not have the allele (Figure 2).
FIGURE 2.

Sequence diagrams showing the nucleotide sequences of the studied region of exon 3 of DYSF in the norm (a), in heterozygous carriers of the endemic allele (NM_003494.4) (b), in homozygous patients (c). Sixty‐seven codons are highlighted in red. Proportional distribution of carriers of the endemic variant, patients and healthy individuals in the study group of patients (d).
The distribution of genotypic frequencies did not agree with the Hardy–Weinberg equilibrium (HWE) (Table 1). The observed deviation from HWE was statistically significant and due to an excess of homozygotes (inbreeding): p = 2 × 10−4, which is consistent with the estimate of the fixation index (inbreeding coefficient) F IS = 0.14, (95%, CI: 0.05–0.23) and did not span the equilibrium value of 0. An inbreeding coefficient of 0.14 corresponds to the crossing of half‐siblings, while the upper value of the confidence interval (0.23) approached the value of 0.25, corresponding to marriage between siblings (Rousset, 2002). The 29 cases of homozygous individuals came from 16 families. Sporadic cases of homozygosity were observed in 24 cases −83% (64–94), while only one case of consanguineous marriage (marriage between siblings and/or cousins) was registered. The average age for homozygous individuals was 29 (CI: 23–36) years, among which men predominated 69% (CI: 49–85), while women accounted for 31% (CI: 15–51).
TABLE 1.
Verification of agreement with the Hardy–Weinberg equilibrium and an analysis of the frequencies of the studied alleles.
| Genotypes | TG/TG | TG/AT | AT/AT | Total | ||
|---|---|---|---|---|---|---|
| Numbers |
|
570 | 160 | 29 | 759 | |
| Observed frequencies (%) with exact 95% CI |
|
75 (72–78) | 21 (18–24) | 3.8 (2.6–5.4) | 100 | |
| Observed frequencies (%) with exact 99% CI | 75 (70–80) | 21 (26–17) | 3.8 (2.1–6.3) | 100 | ||
| Expected frequencies (%) |
|
73.3 | 24.7 | 2.1 | 100 | |
| F IS—fixation index with 95% CI |
|
0.14 (0.06–0.23) | ||||
| p | ||||||
| Excess heterozygotes (outbreeding) |
|
0.9999 | ||||
| Deficiency of heterozygotes (inbreeding) |
|
2 × 10−4 | ||||
| Alleles | TG | AT | ||||
| Numbers | 1380 | 138 | 1518 | |||
| Frequencies (%) with 95% CI with FIS |
|
86 (78–93) | 14 (12–17) | 100 | ||
Despite only one type of endemic allele variant being associated with the development of dysferlinopathy, interfamilial phenotypic polymorphism was observed. The most common was the Miyoshi phenotype, which occurred in 14 patients—48% (CI 29–67), while the limb‐girdle phenotype was less common and occurred in five cases—17% (CI 6–36) and the proximo‐distal phenotype in three patients—10% (CI 2–27). The average age of disease manifestation in those with the Miyoshi phenotype was 17 years (CI 15–19) and did not significantly differ from those with limb‐girdle and proximo‐distal phenotypes that also occurred at 17 years of age (CI 14–19) (Student's t‐test, p = 0.79). Most remarkable was the identification of seven cases at the presymptomatic stage of dysferlinopathy—24% (CI 10–44), occurring in individuals whose average age was 8 years (CI 5–10).
The average age of heterozygous mutation carriers was 26 years (CI 14–22), with females predominately affected (68%; CI: 60–75). Cases of heterozygosity were nearly evenly distributed across age groups from 1 to 49 years (Figure 3a), and there were no statistically significant age differences between patients with TG/AT and AT/AT genotypes (Mann–Whitney test, p = 0.32) (Figure 3). During the screening in March 2022, there were 3484 people in the area yielding a population load corresponding to 832.3 ± 153.9 per 100,000 people, and an incidence of dysferlinopathy of 1:120.
FIGURE 3.

Distribution by age groups of patients with genotype TG/AT (a), patients with genotype AT/AT (b). Boxplot of age characteristics of patients with AT/AT and TG/AT genotypes (c). Boxing reflects quartiles of 25% and 75%, T‐shaped whiskers—95% confidence interval, +, median; horizontal line, average value; dark gray rectangle, 95% CI for average values.
4. DISCUSSION
In a previous study by Illarioshkin et al. (1996), the authors examined 258 individuals from the same isolated population as in this study and identified 14 patients. They were able to localize and determine a commonality of haplotypes (i.e., substantiate the founder effect) (Illarioshkin et al., 1996) and subsequently identified the endemic variant of the c.200_201delinsAT allele in the DYSF gene (Illarioshkin et al., 2000). In this study, the prevalence of the endemic allele among 759 Avars from this region was 14% (CI: 12–17; 218 out of 1518 alleles). These results do not differ from those of Magomedova et al. (2014) who found a prevalence of 14.4% (CI: 9.3–20.8) during a screening of 80 individuals from the same isolated population (Magomedova et al., 2014). The occurrence of the variant in our study (29/3484) exceeds the frequency of the endemic allele 1624delG in the Jewish populations in Tripoli, Libya (4.3%), which has an estimated prevalence of disease at 1:1300 (41/55000) adults (Argov et al., 2000) (Pearson's test, χ 2 = 156.04, df = −1, p = 8.3 × 10−34). In addition, the occurrence of the c.200_201delinsAT allele among 759 Avars was higher than the frequency of carriage of the endemic 2779delG variant occurring in Jewish populations in the Caucasus, (4%; CI 0.16–7.84) (Leshinsky‐Silver et al., 2007).
The high frequency of the c.200_201delinsAT allele in the Botlikhsky region has resulted in a large number of homozygosity cases among individuals from nonconsanguineous families −83% (CI: 64–94). However, the deficiency of heterozygotes indicates the presence of a high level of inbreeding in this community. This may be due to isolation factors including cultural, geographical, and social. The isolation of large Avar families identifies this population as being part of a unique cluster of ethnic communities with an identified founder effect and the accumulation of a single pathogenic mutation that has also been observed in Jewish populations in Libya (Leshinsky‐Silver et al., 2007) and the mountainous regions of the Caucasus (Leshinsky‐Silver et al., 2007), as well as in Italians (Cagliani et al., 2003), Swiss (Petersen et al., 2015), Spaniards (Vilchez et al., 2005), Portuguese (Santos et al., 2010), and Saudi Arabians (Alharbi et al., 2022).
Our study further clarifies the degree of genetic burden of dysferlinopathy in the population in 2022 (832.3 ± 153.9 per 100,000), which significantly exceeds the prevalence that was estimated 7 years ago (515.6 ± 13.3 per 100,000) (Magomedova et al., 2014). Due to this isolated population, the average prevalence of dysferlinopathy in the Republic of Dagestan is significantly higher (0.34 ± 0.04 in 2017 and 1.09 ± 0.02 per 100,000 people in 2022) than in other regions of the Russian Federation as a whole, where the average prevalence of limb muscular dystrophies is 2.4 per 100,000 population (Zinchenko et al., 2001). The prevalence of dysferlinopathy in this region is also significantly higher than in Northern England (LGMD = 2.27 per 100,000; dysferlinopathy = 0.13 per 100,000) (Norwood et al., 2009) or the Netherlands (LGMD = 0.144 per 100,000; 10% dysferlinopathy) (Ten Dam et al., 2019).
Among individuals that were homozygous for the allele variant, variability in phenotypes (Miyoshi, LGMD, and proximo‐distal) was observed, which has been previously described in this group (Illarioshkin et al., 2000) and among other ethnic communities (Argov et al., 2000; Liu et al., 1998; Santos et al., 2010; Tagawa et al., 2003; Weiler et al., 1999)
The disadvantage of this study is the incomplete coverage of the population of this area due to the refusal of participants in the older age group.
The results of screening for carriers of the allele associated with dysferlinopathy in individuals of childbearing age and married couples can contribute to helping individuals make decisions regarding reproductive behavior by assessing the risk of the disease developing in their children. In cases of a risk of homozygosity for the pathogenic allele, families may be offered prenatal gene diagnostics, while homozygous carriers at the subclinical stage can receive recommendations aimed at preventing the early manifestation and progression of the disease.
AUTHOR CONTRIBUTIONS
Collecting the data: Sergey N. Bardakov, Roman V. Deev, Zoya R. Umakhanova, Аrtur А. Isaev, Ivan A. Yakovlev, and Evgeniy V. Presnyakov. Analyzing the data: Roman V. Deev, Sergey N. Bardakov, Nikita N. Khromov‐Borisov, Vladimir S. Kaimonov, Aleksandra А. Tveleneva, Yana V. Sofronova, Мaria R. Savchuk, and Raisat M. Magomedova. Interpreting the data: Zoya R. Umakhanova, Sergey N. Bardakov, Elizaveta V. Musatova, Nikita N. Khromov‐Borisov, Konstantin А. Blagodatskikh, Yana V. Sofronova, and Аrtur А. Isaev. Drafting the article: Sergey N. Bardakov, Maxim S. Pushkin, Evgeniy V. Presnyakov, Zoya R. Umakhanova and Konstantin А. Blagodatskikh. Genetic testing: Аrtur А. Isaev, Yana V. Sofronova, Aleksandra А. Tveleneva, Konstantin А. Blagodatskikh, and Elizaveta V. Musatova. The concept of this research: Sergey N. Bardakov, Roman V. Deev, and Аrtur А. Isaev. All authors discussed the results and commented on the article. Furthermore, each author certifies that this material or similar material has not been and will not be submitted to or published in any other publication.
CONFLICT OF INTEREST STATEMENT
The authors declare that they have no competing interests.
ETHICAL STATEMENT
Informed written consent was obtained from study participants or by the parents of underage participants and was approved by the local ethics committee of the Dagestan Medical University (protocol #AC‐391‐032021).
ACKNOWLEDGMENTS
The study was supported by the Ministry of Science and Higher Education of Russia, agreement No. 075‐15‐2021‐1346.
Bardakov, S. N. , Deev, R. V. , Isaev, А. А. , Khromov‐Borisov, N. N. , Kopylov, E. D. , Savchuk, М. R. , Pushkin, M. S. , Presnyakov, E. V. , Magomedova, R. M. , Achmedova, P. G. , Umakhanova, Z. R. , Kaimonov, V. S. , Musatova, E. V. , Blagodatskikh, K. А. , Tveleneva, A. А. , Sofronova, Y. V. , & Yakovlev, I. A. (2023). Genetic screening of an endemic mutation in the DYSF gene in an isolated, mountainous population in the Republic of Dagestan. Molecular Genetics & Genomic Medicine, 11, e2236. 10.1002/mgg3.2236
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
REFERENCES
- Alharbi, N. , Matar, R. , Cupler, E. , Al‐Hindi, H. , Murad, H. , Alhomud, I. , Monies, D. , Alshehri, A. , Alyahya, M. , Meyer, B. , & Bohlega, S. (2022). Clinical, neurophysiological, radiological, pathological, and genetic features of dysferlinopathy in Saudi Arabia. Frontiers in Neuroscience, 16, 815556. 10.3389/fnins.2022.815556 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Aoki, M. (1993). Dysferlinopathy. In Adam M. P., Ardinger H. H., Pagon R. A., Wallace S. E., Bean L. J. H., Stephens K., & Amemiya A. (Eds.), GeneReviews((R)). University of Washington. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved. [Google Scholar]
- Argov, Z. , Sadeh, M. , Mazor, K. , Soffer, D. , Kahana, E. , Eisenberg, I. , Mitrani‐Rosenbaum, S. , Richard, I. , Beckmann, J. , Keers, S. , Bashir, R. , Bushby, K. , & Rosenmann, H. (2000). Muscular dystrophy due to dysferlin deficiency in Libyan Jews. Clinical and genetic features. Brain, 123(Pt 6), 1229–1237. 10.1093/brain/123.6.1229 [DOI] [PubMed] [Google Scholar]
- Bejaoui, K. , Hirabayashi, K. , Hentati, F. , Haines, J. L. , Ben Hamida, C. , Belal, S. , Miller, R. G. , McKenna‐Yasek, D. , Weissenbach, J. , Rowland, L. P. , & Griggs, R. C. (1995). Linkage of Miyoshi myopathy (distal autosomal recessive muscular dystrophy) locus to chromosome 2p12‐14. Neurology, 45(4), 768–772. 10.1212/wnl.45.4.768 [DOI] [PubMed] [Google Scholar]
- Béroud, C. , Collod‐Béroud, G. , Boileau, C. , Soussi, T. , & Junien, C. (2000). UMD (Universal mutation database): A generic software to build and analyze locus‐specific databases. Human Mutation, 15(1), 86–94. [DOI] [PubMed] [Google Scholar]
- Blandin, G. , Beroud, C. , Labelle, V. , Nguyen, K. , Wein, N. , Hamroun, D. , Williams, B. , Monnier, N. , Rufibach, L. E. , Urtizberea, J. A. , Cau, P. , Bartoli, M. , Lévy, N. , & Krahn, M. (2012). UMD‐DYSF, a novel locus specific database for the compilation and interactive analysis of mutations in the dysferlin gene. Human Mutation, 33(3), E2317–E2331. 10.1002/humu.22015 [DOI] [PubMed] [Google Scholar]
- Cagliani, R. , Fortunato, F. , Giorda, R. , Rodolico, C. , Bonaglia, M. C. , Sironi, M. , D'Angelo, M. G. , Prelle, A. , Locatelli, F. , Toscano, A. , Bresolin, N. , & Comi, G. P. (2003). Molecular analysis of LGMD‐2B and MM patients: Identification of novel DYSF mutations and possible founder effect in the Italian population. Neuromuscular Disorders, 13(10), 788–795. 10.1016/s0960-8966(03)00133-0 [DOI] [PubMed] [Google Scholar]
- Fanin, M. , & Angelini, C. (2016). Progress and challenges in diagnosis of dysferlinopathy. Muscle & Nerve, 54(5), 821–835. 10.1002/mus.25367 [DOI] [PubMed] [Google Scholar]
- Illarioshkin, S. N. , Ivanova‐Smolenskaya, I. A. , Greenberg, C. R. , Nylen, E. , Sukhorukov, V. S. , Poleshchuk, V. V. , Markova, E. D. , & Wrogemann, K. (2000). Identical dysferlin mutation in limb‐girdle muscular dystrophy type 2B and distal myopathy. Neurology, 55(12), 1931–1933. 10.1212/wnl.55.12.1931 [DOI] [PubMed] [Google Scholar]
- Illarioshkin, S. N. , Ivanova‐Smolenskaya, I. A. , Tanaka, H. , Vereshchagin, N. V. , Markova, E. D. , Poleshchuk, V. V. , Lozhnikova, S. M. , Sukhorukov, V. S. , Limborska, S. A. , Slominsky, P. A. , Bulayeva, K. B. , & Tsuji, S. (1996). Clinical and molecular analysis of a large family with three distinct phenotypes of progressive muscular dystrophy. Brain, 119(Pt 6), 1895–1909. 10.1093/brain/119.6.1895 [DOI] [PubMed] [Google Scholar]
- Leshinsky‐Silver, E. , Argov, Z. , Rozenboim, L. , Cohen, S. , Tzofi, Z. , Cohen, Y. , Wirguin, Y. , Dabby, R. , Lev, D. , & Sadeh, M. (2007). Dysferlinopathy in the Jews of the Caucasus: A frequent mutation in the dysferlin gene. Neuromuscular Disorders, 17(11–12), 950–954. 10.1016/j.nmd.2007.07.010 [DOI] [PubMed] [Google Scholar]
- Liu, J. , Aoki, M. , Illa, I. , Wu, C. , Fardeau, M. , Angelini, C. , Serrano, C. , Urtizberea, J. A. , Hentati, F. , Hamida, M. B. , Bohlega, S. , Culper, E. J. , Amato, A. A. , Bossie, K. , Oeltjen, J. , Bejaoui, K. , McKenna‐Yasek, D. , Hosler, B. A. , Schurr, E. , … Brown, R. H., Jr. (1998). Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy. Nature Genetics, 20(1), 31–36. 10.1038/1682 [DOI] [PubMed] [Google Scholar]
- Lorenz, T. C. (2012). Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments, 63, e3998. 10.3791/3998 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Magomedova, R. M. , Mutovin, G. R. , Akhmedova, P. G. , Zinchenko, R. A. , & Umakhanova, Z. R. (2014). Clinical‐epidemiological and molecular‐genetic study of the limb‐girdle forms of progressive muscular dystrophy in the Republic of Dagestan. Yakut Medical Journal, 2(46), 23–25. [Google Scholar]
- Mah, J. K. , Korngut, L. , Fiest, K. M. , Dykeman, J. , Day, L. J. , Pringsheim, T. , & Jette, N. (2016). A systematic review and meta‐analysis on the epidemiology of the muscular dystrophies. The Canadian Journal of Neurological Sciences, 43(1), 163–177. 10.1017/cjn.2015.311 [DOI] [PubMed] [Google Scholar]
- Norwood, F. L. , Harling, C. , Chinnery, P. F. , Eagle, M. , Bushby, K. , & Straub, V. (2009). Prevalence of genetic muscle disease in Northern England: In‐depth analysis of a muscle clinic population. Brain, 132(Pt 11), 3175–3186. 10.1093/brain/awp236 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Petersen, J. A. , Kuntzer, T. , Fischer, D. , von der Hagen, M. , Huebner, A. , Kana, V. , Lobrinus, J. A. , Kress, W. , Rushing, E. J. , Sinnreich, M. , & Jung, H. H. (2015). Dysferlinopathy in Switzerland: Clinical phenotypes and potential founder effects. BMC Neurology, 15, 182. 10.1186/s12883-015-0449-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosas‐Vargas, H. , Gomez‐Diaz, B. , Ruano‐Calderon, L. , Fernandez‐Valverde, F. , Roque‐Ramirez, B. , Portillo‐Bobadilla, T. , Ordoñez‐Razo, R. M. , Minauro‐Sanmiguel, F. , & Coral‐Vazquez, R. (2007). Dysferlin homozygous mutation G1418D causes limb‐girdle type 2B in a Mexican family. Genetic Testing, 11(4), 391–396. 10.1089/gte.2007.0039 [DOI] [PubMed] [Google Scholar]
- Rousset, F. (2002). Inbreeding and relatedness coefficients: What do they measure? Heredity, 88(5), 371–380. 10.1038/sj.hdy.6800065 [DOI] [PubMed] [Google Scholar]
- Santos, R. , Oliveira, J. , Vieira, E. , Coelho, T. , Carneiro, A. L. , Evangelista, T. , Dias, C. , Fortuna, A. , Geraldo, A. , Negrão, L. , Guimarães, A. , & Bronze‐da‐Rocha, E. (2010). Private dysferlin exon skipping mutation (c.5492G>A) with a founder effect reveals further alternative splicing involving exons 49‐51. Journal of Human Genetics, 55(8), 546–549. 10.1038/jhg.2010.60 [DOI] [PubMed] [Google Scholar]
- Tagawa, K. , Ogawa, M. , Kawabe, K. , Yamanaka, G. , Matsumura, T. , Goto, K. , Nonaka, I. , Nishino, I. , & Hayashi, Y. K. (2003). Protein and gene analyses of dysferlinopathy in a large group of Japanese muscular dystrophy patients. Journal of the Neurological Sciences, 211(1–2), 23–28. 10.1016/s0022-510x(03)00041-8 [DOI] [PubMed] [Google Scholar]
- Ten Dam, L. , Frankhuizen, W. S. , Linssen, W. , Straathof, C. S. , Niks, E. H. , Faber, K. , Fock, A. , Kuks, J. B. , Brusse, E. , de Coo, R. , Voermans, N. , Verrips, A. , Hoogendijk, J. E. , van der Pol, L. , Westra, D. , de Visser, M. , van der Kooi, A. J. , & Ginjaar, I. (2019). Autosomal recessive limb‐girdle and Miyoshi muscular dystrophies in The Netherlands: The clinical and molecular spectrum of 244 patients. Clinical Genetics, 96(2), 126–133. 10.1111/cge.13544 [DOI] [PubMed] [Google Scholar]
- Theadom, A. , Rodrigues, M. , Roxburgh, R. , Balalla, S. , Higgins, C. , Bhattacharjee, R. , Jones, K. , Krishnamurthi, R. , & Feigin, V. (2014). Prevalence of muscular dystrophies: A systematic literature review. Neuroepidemiology, 43(3–4), 259–268. 10.1159/000369343 [DOI] [PubMed] [Google Scholar]
- Umakhanova, Z. R. , Bardakov, S. N. , Mavlikeev, M. O. , Chernova, O. N. , Magomedova, R. M. , Akhmedova, P. G. , Yakovlev, I. A. , Dalgatov, G. D. , Fedotov, V. P. , Isaev, A. A. , & Deev, R. V. (2017). Twenty‐year clinical progression of dysferlinopathy in patients from Dagestan. Frontiers in Neurology, 8, 77. 10.3389/fneur.2017.00077 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Urtizberea, A. (2011). Les dysferlinopathies: Audelà des myopathies distales. Les Cahiers de Myologie (4), 26–35.
- Vilchez, J. J. , Gallano, P. , Gallardo, E. , Lasa, A. , Rojas‐Garcia, R. , Freixas, A. , De Luna, N. , Calafell, F. , Sevilla, T. , Mayordomo, F. , Baiget, M. , & Illa, I. (2005). Identification of a novel founder mutation in the DYSF gene causing clinical variability in the Spanish population. Archives of Neurology, 62(8), 1256–1259. 10.1001/archneur.62.8.1256 [DOI] [PubMed] [Google Scholar]
- Weiler, T. , Bashir, R. , Anderson, L. V. , Davison, K. , Moss, J. A. , Britton, S. , Nylen, E. , Keers, S. , Vafiadaki, E. , Greenberg, C. R. , Bushby, C. R. , & Wrogemann, K. (1999). Identical mutation in patients with limb girdle muscular dystrophy type 2B or Miyoshi myopathy suggests a role for modifier gene(s). Human Molecular Genetics, 8(5), 871–877. 10.1093/hmg/8.5.871 [DOI] [PubMed] [Google Scholar]
- Zinchenko, R. A. , Elchinova, G. I. , Gavrilina, S. G. , & Ginter, E. K. (2001). Analysis of diversity of autosomal recessive diseases in populations of Russia. Genetika, 37(11), 1559–1570. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
