Skip to main content
PMC home page
Plant Physiology logoLink to Plant Physiology
. 1990 Jun;93(2):572–577. doi: 10.1104/pp.93.2.572

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana1

David E Somers 1,2, Timothy Caspar 1,2, Peter H Quail 1,2
PMCID: PMC1062552  PMID: 16667505

Abstract

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

Full text

PDF
576

Images in this article

573Figure 1
on p.573
575Figure 4
on p.575

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Buchanan B. B. The ferredoxin/thioredoxin system: a key element in the regulatory function of light in photosynthesis. Bioscience. 1984 Jun;34(6):378–383. [PubMed] [Google Scholar]
  2. Castresana C., Garcia-Luque I., Alonso E., Malik V. S., Cashmore A. R. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia. EMBO J. 1988 Jul;7(7):1929–1936. doi: 10.1002/j.1460-2075.1988.tb03030.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Devereux J., Haeberli P., Smithies O. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 1984 Jan 11;12(1 Pt 1):387–395. doi: 10.1093/nar/12.1part1.387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Elliott R. C., Dickey L. F., White M. J., Thompson W. F. cis-Acting Elements for Light Regulation of Pea Ferredoxin I Gene Expression Are Located within Transcribed Sequences. Plant Cell. 1989 Jul;1(7):691–698. doi: 10.1105/tpc.1.7.691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Elliott R. C., Pedersen T. J., Fristensky B., White M. J., Dickey L. F., Thompson W. F. Characterization of a single copy gene encoding ferredoxin I from pea. Plant Cell. 1989 Jul;1(7):681–690. doi: 10.1105/tpc.1.7.681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Feinberg A. P., Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983 Jul 1;132(1):6–13. doi: 10.1016/0003-2697(83)90418-9. [DOI] [PubMed] [Google Scholar]
  7. Fluhr R., Kuhlemeier C., Nagy F., Chua N. H. Organ-specific and light-induced expression of plant genes. Science. 1986 May 30;232(4754):1106–1112. doi: 10.1126/science.232.4754.1106. [DOI] [PubMed] [Google Scholar]
  8. Giuliano G., Pichersky E., Malik V. S., Timko M. P., Scolnik P. A., Cashmore A. R. An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc Natl Acad Sci U S A. 1988 Oct;85(19):7089–7093. doi: 10.1073/pnas.85.19.7089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Green P. J., Kay S. A., Chua N. H. Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene. EMBO J. 1987 Sep;6(9):2543–2549. doi: 10.1002/j.1460-2075.1987.tb02542.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Green P. J., Yong M. H., Cuozzo M., Kano-Murakami Y., Silverstein P., Chua N. H. Binding site requirements for pea nuclear protein factor GT-1 correlate with sequences required for light-dependent transcriptional activation of the rbcS-3A gene. EMBO J. 1988 Dec 20;7(13):4035–4044. doi: 10.1002/j.1460-2075.1988.tb03297.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kaufman L. S., Roberts L. L., Briggs W. R., Thompson W. F. Phytochrome Control of Specific mRNA levels in Developing Pea Buds : Kinetics of Accumulation, Reciprocity, and Escape Kinetics of the Low Fluence Response. Plant Physiol. 1986 Aug;81(4):1033–1038. doi: 10.1104/pp.81.4.1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kuhlemeier C., Fluhr R., Green P. J., Chua N. H. Sequences in the pea rbcS-3A gene have homology to constitutive mammalian enhancers but function as negative regulatory elements. Genes Dev. 1987 May;1(3):247–255. doi: 10.1101/gad.1.3.247. [DOI] [PubMed] [Google Scholar]
  13. Lea P. J., Miflin B. J. Alternative route for nitrogen assimilation in higher plants. Nature. 1974 Oct 18;251(5476):614–616. doi: 10.1038/251614a0. [DOI] [PubMed] [Google Scholar]
  14. Lois R., Dietrich A., Hahlbrock K., Schulz W. A phenylalanine ammonia-lyase gene from parsley: structure, regulation and identification of elicitor and light responsive cis-acting elements. EMBO J. 1989 Jun;8(6):1641–1648. doi: 10.1002/j.1460-2075.1989.tb03554.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Manzano C., Candau P., Gomez-Moreno C., Relimpio A. M., Losada M. Ferredoxin-dependent photosynthetic reduction of nitrate and nitrite by particles of Anacystis nidulans. Mol Cell Biochem. 1976 Feb 25;10(3):161–169. doi: 10.1007/BF01731687. [DOI] [PubMed] [Google Scholar]
  16. Sakihama N., Shin M. Evidence from high-pressure liquid chromatography for the existence of two ferredoxins in plants. Arch Biochem Biophys. 1987 Aug 1;256(2):430–434. doi: 10.1016/0003-9861(87)90599-6. [DOI] [PubMed] [Google Scholar]
  17. Schmidt A., Trebst A. The mechanism of photosynthetic sulfate reduction by isolated chloroplasts. Biochim Biophys Acta. 1969 Aug 5;180(3):529–535. doi: 10.1016/0005-2728(69)90031-0. [DOI] [PubMed] [Google Scholar]
  18. Schulze-Lefert P., Dangl J. L., Becker-André M., Hahlbrock K., Schulz W. Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene. EMBO J. 1989 Mar;8(3):651–656. doi: 10.1002/j.1460-2075.1989.tb03422.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Sharrock R. A., Quail P. H. Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family. Genes Dev. 1989 Nov;3(11):1745–1757. doi: 10.1101/gad.3.11.1745. [DOI] [PubMed] [Google Scholar]
  20. Smeekens S., van Binsbergen J., Weisbeek P. The plant ferredoxin precursor: nucleotide sequence of a full length cDNA clone. Nucleic Acids Res. 1985 May 10;13(9):3179–3194. doi: 10.1093/nar/13.9.3179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Smith R. V., Noy R. J., Evans M. C. Physiological electron donor systems to the nitrogenase of the blue-green alga Anabaena cylindrica. Biochim Biophys Acta. 1971 Nov 2;253(1):104–109. doi: 10.1016/0005-2728(71)90238-6. [DOI] [PubMed] [Google Scholar]
  22. Staiger D., Kaulen H., Schell J. A CACGTG motif of the Antirrhinum majus chalcone synthase promoter is recognized by an evolutionarily conserved nuclear protein. Proc Natl Acad Sci U S A. 1989 Sep;86(18):6930–6934. doi: 10.1073/pnas.86.18.6930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Twell D., Wing R., Yamaguchi J., McCormick S. Isolation and expression of an anther-specific gene from tomato. Mol Gen Genet. 1989 Jun;217(2-3):240–245. doi: 10.1007/BF02464887. [DOI] [PubMed] [Google Scholar]
  24. Wada K., Onda M., Matsubara H. Amino acid sequences of ferredoxin isoproteins from radish roots. J Biochem. 1989 Apr;105(4):619–625. doi: 10.1093/oxfordjournals.jbchem.a122714. [DOI] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES