Abstract
Induction of antioxidant proteins and phase 2 detoxifying enzymes that neutralize reactive electrophiles are important mechanisms for protection against carcinogenesis. Normal cells provide multifaceted pathways to tightly control NF-E2-related factor 2 (NRF2)-mediated gene expression in response to an assault by a range of endogenous and exogenous oncogenic molecules. Transient activation of NRF2 by its activators is able to induce ARE-mediated cytoprotective proteins which are essential for protection against various toxic and oxidative damages, and NRF2 activators thereby have efficacy in cancer chemoprevention. Because NRF2 has a cytoprotective function, it can protect normal cells from carcinogens like an angel, but when the protective effect acts on cancer cells, it will give rise to invincible cancer cells and play a devilish role in tumor progression. Indeed, aberrant activation of NRF2 has been found in a variety of cancers that create a favorable environment for the proliferation and survival of cancer cells and leads to drug resistance, ultimately leading to the poor clinical prognosis of patients. Therefore, pharmacological inhibition of NRF2 signaling has emerged as a promising approach for cancer therapy. This review aims to compile the regulatory mechanisms of NRF2 and its double-edged role in cancer. In addition, we also summarize the research progress of NRF2 modulators, especially phytochemicals, in chemoprevention and cancer therapy.
Keywords: Cancer therapy, Chemoprevention, NRF2, Phytochemicals
1. Discovery of NRF2
NRF2 (Nuclear factor erythroid 2-related factor 2), also known as Nuclear Factor, Erythroid 2 Like 2 (NFE2L2), was discovered as a widely expressed transcription factor belonging to the CNC (cap ‘n’ collar)-basic leucine zipper family [1,2]. In humans, NRF2 protein is composed of 605 amino acids and is encoded by the NFE2L2 gene located at chromosome region 2q31.2 (gene ID: 4780). As the name implies, NRF2 was initially found to bind to the tandem repeats of NF-E2/AP-1 binding sequence ((c/t)gctga(g/c)tca(c/t)) in the promoter region of the β-globin gene [1]. Later, NRF2 was identified as a positive regulator of NAD(P) H:quinone oxidoreductase1 (NQO1) gene induced by antioxidants, such as β-naphthoflavone and tert-butyl hydroquinone (t-BHQ) through antioxidant response element (ARE; gcagtcacagtgactcagcagaatc) [3]. NRF2 protein forms a heterodimer with small muscle aponeurotic fibrosarcoma (small Maf) protein and directly induces the transcription of phase II detoxifying enzymes through ARE binding [4]. NRF2 knockout did not affect mouse development [5], however, NRF2-deficiency leads to increased susceptibility to xenobiotic-induced toxicity due to the impairment of inducible expression of detoxifying enzymes [6–8]. Afterward, the cytoprotective role of NRF2-ARE pathway emerges by regulating the expression of numerous antioxidant proteins and detoxifying enzymes; all of which have been intensively studied and confirmed [9,10].
2. Regulation of NRF2-ARE pathway
2.1. Ubiquitination and proteasomal degradation of NRF2
NRF2-ARE pathway has been conclusively deemed pivotal in cellular defense, especially in warding off oxidative stress-induced cellular damages [11]. When cells confront stressful stimuli, NRF2 is imported into the nucleus and heterodimerizes with one of the small Maf proteins, and induces expression of genes involved in detoxification and antioxidant defense through directly binding to ARE in the promoter region of genes [12,13]. In 1999, Itoh et al. identified a novel cytoplasmic protein, KEAP1 (Kelch-like ECH-associated protein1), which traps NRF2 in the cytoplasm and suppressed transactivation activity of NRF2 through directly interacting with the evolutionary conserved N-terminal domain (Neh2) of NRF2 protein [14].
NRF2 has a short half-life (T1/2 = 15 min–3 h) [15,16], and the rapid turnover of NRF2 is due to ubiquitin-mediated proteasome degradation. In unstressed conditions, dimeric KEAP1 serves as a substrate adaptor protein that interacts with the Cullin3 (CUL3) ubiquitin ligase to form an active E3 ubiquitin ligase complex and triggers the degradation of NRF2 through ubiquitin-proteasome system (UPS) [12,13]. The detailed mechanisms of KAEP1-mediated inhibition of NRF2-ARE pathway have been revealed in several studies via using different experimental approaches [17–21].
When confronted with stressful conditions, reactive cysteine residues within KEAP1 protein, which functions as a sensor for stressful stimulus, become modified, thereby resulting in KEAP1-NRF2 disassociation due to a conformational change in dimeric KEAP1 protein [12,13]. Subsequently, NRF2 is stabilized and transported into the nucleus to drive transcriptional activation of target genes through binding to the ARE [12,13]. Therefore, upon directly interrupting protein-protein interaction of NRF2-KEAP1 complex via competitively binding to KEAP1 protein by sequestosome 1/p62 [22–24], dipeptidyl peptidase 3 (DPP3) [25], prothymosin α (ProTα) [26], Wilms tumor gene on X chromosome (WTX) [27], partner and localizer of BRCA2 (PALB2) [28], tripartite motif-containing protein 29 (TRIM29, ATDC) [29], and cell-cycle related kinase 20 (CDK20) [30] or binding to NRF2 protein by p21 (Cip1/Waf1) [31], breast cancer susceptibility protein 1 (BRCA1) [32], and progestin and adipoQ receptor family member 4 (PAQR4) [33] leads to facilitating stabilization, nuclear accumulation and transcriptional activation of NRF2. Similarly, ubiquitin-processing proteases, such as ubiquitin-specific-processing protease 11 (USP11) and deubiquitinating enzyme 3 (DUB3), catalyze the removal of ubiquitin from NRF2, thereby stabilizing NRF2 protein [34,35].
In addition to the destabilization of NRF2 via redox-sensitive interaction with KEAP1 and NRF2 Neh2 domain, the NRF2 Neh6 domain also possesses KEAP1-independent inhibitory activity on NRF2 protein stability [36]. The serine-rich Neh6 domain of NRF2 is recognized by a substrate receptor, β-transducin repeats-containing protein (β-TrCP), of the SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex, resulting in ubiquitin-proteasome degradation of NRF2 [37–39]. Furthermore, Neh6 degron-directed degradation of NRF2 protein is enhanced by glycogen synthase kinase-3β (GSK-3β)-dependent phosphorylation of serine residues within the Neh6 domain [37–39]. Besides KEAP1 and β-TrCP, WD40 Repeat Protein 23 (WDR23) also served as a proteasome substrate receptor for the recruitment of DDB1-CUL4-RBX1 E3 ubiquitin-protein ligase complex to induce the degradation of NRF2 protein [40,41]. Furthermore, ER-associated ubiquitin ligase Hrd1 [42,43], CR6-interacting factor 1 (CRIF1) [43–45], IQ motif-containing GTPase-activating protein 1 (IQGAP1) [46,47], seven in absentia homolog 2 (Siah2) [48], and UFM1-binding and PCI domain-containing protein 1 (UFBP1) [49] were also reported to down-regulated NRF2-ARE pathway through inducing ubiquitination and proteasomal degradation of NRF2.
2.2. Post-translational modification of NRF2
2.2.1. Phosphorylation of NRF2
NRF2-ARE pathway is not only tightly controlled by proteasomal degradation but also regulated by post-translational modification of NRF2 protein [50–52]. In 2000, Huang et al. first demonstrated that activation of protein kinase C (PKC) had a decisive role in inducing NRF2-ARE pathway-dependent gene expression through the phosphorylation of NRF2 protein, which leads to the NRF2 nuclear translocation under antioxidant treatment [53]. Further investigation through utilizing site-directed mutational analysis identified that Ser40 within NRF2 Neh2 domain (KEAP1-interacting domain) is the specific phosphorylation site catalyzed directly by PKC [54]. PKC-mediated phosphorylation of NRF2 at Ser40 enhances KEAP1-NRF2 dissociation, NRF2 stabilization, nuclear accumulation of NRF2, and therefore induces ARE-dependent gene expression [53–55].
Regulation of NRF2-ARE pathway by mitogen-activated protein kinase (MAPK) signaling cascades has been noticed [56–60]. Therefore, several studies have explored and verified the possibility that MAPKs directly phosphorylate NRF2 protein to regulate the NRF2-ARE pathway [61–64]. Furthermore, a comparative analysis of amino acid sequences indicates that several conserved MAPK phosphorylation sites (P-X-S/T-P, or S/T-P) within NRF2 protein in humans and other species (chicken, rat, and mouse) [61]. Moreover, five serine/threonine residues (Ser215, Ser408, Ser558, Thr559, and Ser577) have been identified in NRF2 protein that can be directly phosphorylated by MAPKs [62].
Although the connections between MAPKs and NRF2 activation and direct phosphorylation of NRF2 protein by MAPKs have been reported in numerous studies, the effects of MAPK-dependent phosphorylation of NRF2 on NRF2-ARE pathway are still controversial. For instance, activation of p38 MAPK has been shown to positively regulate NRF2-ARE pathway via enhancing nuclear translocation and transactivation activity of NRF2 [56,57,65]. On the contrary, the increasing interaction between KEAP1 and NRF2, resulting in diminished transactivation activity and nuclear translocation of NRF2 has been observed when p38 MAPK is ectopically overexpressed [63,66]. Likewise, the contradictory regulatory effects of other MAPKs, such as extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK), on NRF2-ARE pathway have also been observed [61,62,66,67]. The opposite effects of MAPK-mediated regulation of NRF2-ARE pathway may be related to the complexity of MAPKs signaling pathways and reciprocal actions with other signaling networks. Hence, the regulatory effects and specific mechanisms of MAPK signaling cascades on NRF2 activity via direct phosphorylation requires further investigation.
Adenosine 5′-monophosphate (AMP)-activated protein kinase (AMPK) has been reported to enhance the nuclear accumulation of NRF2 through directly phosphorylating serine residue at position 558 within the nuclear export signal (NES) of NRF2 protein [68]. Others have found that three serine residues (Ser374, Ser408, and Ser433) of NRF2 protein were hyper-phosphorylated by AMPK [69]. Unlike phosphorylation at Ser558 which involved in nuclear accumulation of NRF2, substitutions of Ser374, Ser408, and Ser433 by alanine had no significant effects on protein stability, nuclear import, and transactivation activity of NRF2 [69].
Additional protein kinases, like protein kinase RNA-like endoplasmic reticulum kinase (PERK), Fyn kinase, ceramide-protein kinase C zeta-casein kinase 2 (CK2), and p35/Cdk5 kinase complex, have been demonstrated to regulate NRF2-ARE pathway through direct phosphorylation of NRF2 [70–77]. PERK directly phosphorylates NRF2 and leads to the liberation of NRF2 from KEAP1 in response to ER stress [70–72]. CK2 enhances NRF2 nuclear translocation and transactivation activity directly by phosphorylating several sites in the transcription activation domains, Neh4 and Neh5, of NRF2 [73,74]. Similarly, activation of cyclin-dependent kinase 5 (Cdk5)-p35 complexes catalyze the phosphorylation of Thr395, Ser433, and Thr439 in NRF2 protein [75]. The direct phosphorylation of NRF2 by active Cdk5-p35 complex in the cytosol triggered nuclear translocation of NRF2 and leads to the induction of genes encoding enzymes involved in glutathione metabolism that protected the cells against oxidative damage [75]. On the contrary, direct phosphorylation of Tyr576 within NRF2 Neh3 domain, which contains nuclear localization sequence, by Fyn appears to suppress NRF2-ARE pathway through inducing nuclear export of NRF2 [76,77].
2.2.2. Acetylation, SUMOylation, methylation, and glycation of NRF2
In addition to phosphorylation, other forms of post-translational modification of the NRF2 protein, including acetylation, SUMOylation, and methylation, also contribute to the control of the NRF2-ARE pathway. CREB binding protein (CBP)/p300-mediated acetylated NRF2 protein at several specific lysine residues, which are located in NRF2 Neh1 DNA-binding domain and Neh3 transactivation domain containing a nuclear localization signal (NLS) [78]. Acetylation of these lysine residues enhanced nuclear retention and DNA-binding activity of NRF2, consequently driving transcriptional activation of ARE-mediated genes. Furthermore, NRF2 acetylation also facilitated the association of NRF2 and CBP, which functions as a transcriptional co-activator [79]. Another post-translational modification, SUMOylation, has been reported to positively regulate NRF2-ARE pathway [80–83]. Increased transcriptional activity of SUMOylated NRF2 has been observed due to the enhancement of NRF2 protein stability, nuclear localization, and promoting heterodimerization of NRF2 and MafG [80–83]. Conversely, SUMOylattion of NRF2 also serves as an inhibitory regulation of NRF2 protein stability within the nucleus [84,85]. SUMO-modification of nuclear NRF2 is ubiquitinated by poly-SUMO-specific E3 ubiquitin ligase, RING finger protein 4 (RNF4), and to be degraded in the promyelocytic leukemia nuclear bodies [84,85]. Arg437 in NRF2 protein is methylated by arginine methyltransferase-1 (PRMT1), resulting in up-regulating DNA-binding and gene transactivation activities of NRF2 [86]. In addition, de-glycation of NRF2 protein by fructosamine-3-kinase (FN3K) increases its protein stability and heterodimerization with small Maf proteins, indicating that protein glycation is involved in modulating NRF2 activity [87,88].
2.3. Regulation of the NRF2-ARE pathway by interacting with transcriptional co-factors or other proteins in the nucleus
Small Maf proteins, which contain basic region-leucine zipper (bZIP) motif, are transcription coactivators necessary for gearing up NRF2-mediated activation of ARE-dependent gene transcription [4,89,90]. NRF2 heterodimerizes with one of the small Maf proteins (MafF, MafG, and MafK) via Neh1 Cap’n’Collar (CNC)-bZIP domain within the NRF2 protein, and then interacts with the ARE sequences to trigger transcriptional activation [89,91]. Other bZIP transcriptional regulatory factors, such as Jun family proteins (c-Jun, JunB, and JunD) and activating transcription factor 4 (ATF4) have also been shown to induce transcriptional activation of NRF2 through direct interaction with NRF2 [92,93]. Similarly, Jun dimerization protein 2 (JDP2) [94], p300/CBP [95], Brahma-related gene 1 (BRG1) [96], nuclear-restricted protein/brain (NRP/ B) [97], receptor-associated coactivator 3 (RAC3) [98,99], mediator of RNA polymerase II transcription subunit 16 (MED16) [100], p63 [101] and chromodomain helicase DNA binding protein 6 (CHD6) [102] have been reported to function as transcriptional coactivators, contributing to the enhancement of NRF2-regulated transcriptional activity of the ARE-driven genes in the nucleus. A recent study found that NRF2 directly interacts with STAT3 dimers and enhances the transcription of interleukin 23A to promote breast cancer progression [103].
BTB domain and CNC Homolog 1 and 2 (BACH1 and BACH2) act as transcriptional repressors of ARE-regulated genes by competing with NRF2 for binding to the small Maf proteins [104–106]. Similarly, Replication Protein A1 (RPA1) has also been shown to compete for the interaction between NRF2 and small Maf proteins by forming NRF2-RPA1 heterodimers that bind AREs and adjacent 7-nt negative regulatory sequence to down-regulate MYLK transcription [107]. Homodimerization of small Maf proteins acts as a negative regulator of the NRF2-ARE pathway by competing for ARE binding due to the scarcity of transcriptional activation domains [89,91]. In addition, c-MYC [108], retinoid X receptor alpha (RXRα) [109–111], retinoic acid receptor alpha (RARα) [112], estrogen-related receptor beta (ERRβ) [113], silencing mediator for retinoid and thyroid hormone receptors (SMRT) [114], p14ARF [115] and estrogen receptor α (ERα) [116] are involved in the repression of NRF2-mediated transcription by directly binding to NRF2. Furthermore, a controversial role for peroxisome proliferator-activated receptor γ (PPARγ) in the regulation of NRF2 activity has been reported. Interaction with PPARγ decreases the transcription of the thromboxane synthase gene in rat macrophages [117], while the expression of heme oxygenase-1 (HO-1) is activated by NRF2-PPARγ complex in rat brain astrocytes [118]. Moreover, truncated lamin A protein progerin is implicated in Hutchinson-Gilford progeria syndrome (HGPS), which impairs NRF2 transcriptional activity by trapping NRF2 in the nuclear periphery, leading to mislocalization of NRF2 in the nucleus and then reducing access of NRF2 to ARE [86].
2.4. Transcriptional and translational regulation of NRF2
Regulation of NRF2 gene expression at transcriptional and post-transcriptional levels has been extensively studied [9,51,119]. Besides NRF2 itself [120,121], other transcription factors, AhR-ARNT complex [122,123], human telomerase reverse transcriptase (hTERT)-Y-Box binding protein 1 (YBX1) [124], NF-κB [125,126], BRCA1 [127], myocyte enhancer factor 2d (MEF2D) [128], Notch [129], KRAS, BRAF and c-MYC [130] have been reported to up-regulate the transcription of NRF2 gene. In contrast, the tumor suppressor p53 represses the promotor activity of NRF2 [131]. Epigenetic modifications (such as DNA methylation and histone modifications) within the NRF2 promoter region and post-transcriptional regulation by microRNAs have also emerged as important regulatory mechanisms for NRF2 expression [50,132–136]. Recently, direct interactions between RNA-binding proteins (RBPs), HuR and AUF1, and the 3-UTR of NRF2-mRNA have been shown to activate the NRF2 pathway by enhancing the maturation, nuclear export, and stability of NRF2 mRNA [137]. Furthermore, encoding an NRF2 protein isoform without the KEAP1 interaction domain via alternative splicing is another post-transcriptional regulation of NRF2 activity [138].
Both 5′- and 3′-untranslated region (UTR) of NRF2 mRNA transcript are involved in the regulation of NRF2 protein translation. Under basal conditions, translation of NRF2 protein is strongly suppressed by Sg3 motif within the open reading frame (ORF) of NRF2 mRNA 3′-portion in a capdependent process [139,140]. On the contrary, 5′-UTR of NRF2 mRNA transcript contains two regulatory elements, internal ribosomal entry site (IRES) and G-quadruplex, which contribute to inducing de novo NRF2 protein translation in response to oxidative stress [141–144]. Small RNA binding exonuclease protection factor La (La/SSB), eukaryotic translation elongation factor 1 alpha 1 (EF1α), and the far upstream element binding protein 1 (FUBP1) are shown to play crucial regulatory roles in oxidative stress-induced translation of NRF2 protein through facilitating the recruitment of the translation machinery by interaction with NRF2 5′-UTR [142,145].
3. NRF2 and cancer progression
3.1. NRF2 acts as a double-edged sword in cancer
NRF2 exhibits dual pro- and anti-tumorigenic effects in cancer cells and normal cells, respectively [10,146,147]. NRF2 activation is considered as a protector during the initiation of carcinogenesis by its protective effects on enzymatic detoxification and elimination of chemical carcinogens and re-establishing cellular redox homeostasis in normal cells [2,10,147,148]. Several in vivo studies demonstrated that NRF2 deficiency enhances susceptibility to carcinogen-induced tumorigenesis and results in a more aggressive tumor phenotype in many types of cancers [149–154]. In addition, activation of NRF2 in hepatocytes by deletion of the KEAP1 gene attenuates steatohepatitis-induced fibrosis and tumor development, indicating that NRF2 plays an important role in preventing inflammation-triggered carcinogenesis [154,155].
However, NRF2-governed cytoprotective pathways endow transformed cells with biological capabilities – the hallmarks of cancer – acquired during malignant progression [10,156–160]. In 2017, an in vivo study has demonstrated that activation of NRF2 before chemical carcinogen exposure suppresses tumor development, whereas activation of NRF2 after tumor initiation facilitates the malignant progression of both chemically and genetically induced tumors [148]. Before tumor initiation, inhibition of NRF2 promotes cell proliferation and activation of NRF2-induced apoptosis accompanied with the generation of oxidative DNA damage in response to carcinogen treatment [148]. Conversely, after tumor development, suppression of NRF2 increases apoptosis, along with higher oxidative DNA damage, in both genetic and chemical-induced models of lung cancer in mice [148]. These studies have clarified that NRF2-mediated antioxidant response exerts strikingly opposite effects on determining whether cells undergo apoptosis or proliferation during cancer initiation and progression.
3.2. Mechanisms of NRF2 over-activation in cancer
Persistent NRF2 over-activation is frequently observed in different types of cancer and is associated with poor clinical outcomes [10,161–167]. Somatic gain-of-function mutations of NRF2 gene and somatic loss-of-function mutations of NRF2 repressors, KEAP1, and CUL3 genes, are common genetic mechanisms underlying over-activation of NRF2 pathway in cancer cells [156,168–171] (Fig. 1). Genome-scale analysis, covering gene expression levels from RNA sequencing, somatic mutations from whole-exome sequencing, DNA copy-number variation, and DNA methylation, of nearly 9000 samples on 33 cancer types from the entire collection of TCGA PanCancer Atlas revealed that 6 types of cancer exhibited higher (greater than 10%) frequency of alterations in NRF2 pathway, including lung squamous cell carcinoma (LUSC) (25% altered), esophagogastric squamous cell carcinoma (STES ESCC) (23% altered), uterine corpus endometrial carcinoma with microsatellite instability and polymerase ε (UCEC MSI-POLE) (19% altered), lung adenocarcinoma (LUAD) (15% altered), headneck squamous cell carcinoma (HNSC) (HPV-) (13% altered), and cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) (10% altered) [171]. The gain-of-function mutations of the NRF2 gene are predominantly detected in the ETGE and DLG motifs within the Neh2 domain, which is required for NRF2-KEAP1 protein-protein interaction [168,170,172,173]. Furthermore, constitutively active forms of NRF2 protein, which are encoded by the truncated transcripts lacking exon 2 or exon 2/3, have been found in lung and head-neck squamous cell carcinoma [138,174]. These aberrant NRF2 protein isoforms lacking the Neh2 domain would cause the stabilization and persistent nuclear localization of NRF2 by preventing KEAP1-mediated proteolysis [138,174]. In contrast to NRF2, the loss-of-function mutations of KEAP1 gene are found throughout the entire gene [168,172,175]. Most inactivating mutations of the KEAP1 and CUL3 result in impairing NRF2 degradation and contribute to constitutive NRF2 activation in cancer cells [168,175–177].
Fig. 1.
Schematic illustration depicts mechanisms causing the NRF2 over-activation in cancer cells.
As mentioned in Section 1–2, the cellular abundance and activity of NRF2 are rigorously controlled at the transcriptional, post-transcriptional, translational, and post-translational levels. Therefore, in addition to the genetic deregulation of NRF2 and KAEP1, aberrations in these regulatory mechanisms also play crucial roles in the constitutive activation of NRF2 in cancer cells [52,134,146,175,178] (Fig. 1). For instance, NRF2 gene transcription can be up-regulated by oncogenic transcription factors, such as c-MYC, KRAS, BRAF, and NF-κB [125,126,130,159,179]. In cancer cells, NRF2 mRNA level can also be regulated by several miRNAs [168], such as miR-28 [180], miR-144 [181], and miR-153 [182]. The reduction of these microRNAs leads to an increase in NRF2 levels. In addition to up-regulation of NRF2 expression, impairment of KEAP1-mediated NRF2 degradation due to the reduction of KEAP1 expression (through DNA methylation, miRNA-mediated gene regulation) and suppression of NRF2-KEAP1 interaction (through modification of KEAP1 protein, competing directly for NRF2-KEAP1 interaction) is an important regulatory mechanism which involves in sustained over-activation of NRF2 in cancer cells [146,168,175,183,184]. Furthermore, activation of oncogenic signaling pathways, such as EGFR, PI3K/ AKT, and MAPK signaling pathway, also contributes to the enhancement of the NRF2-ARE pathway [171,185–187].
3.3. NRF2 and cancer metabolic reprogramming
3.3.1. NRF2 and Warburg effect
Metabolic reprogramming is widely considered as one of the hallmarks of cancer, which not only provides cancer cells themselves with advantages for survival and proliferation but also helps create a favorable microenvironment that facilitates metastasis during cancer progression [188,189]. In 1956, Otto Warburg discovered that, unlike normal cells generating energy by oxidative phosphorylation in mitochondria, cancer cells mainly tend to produce ATP through the aerobic glycolysis pathway despite oxygen availability [190]. This metabolic adaptation supplies cancer cells with a higher rate of ATP generation enhances the carbons from glucose feeding into biosynthetic pathways, provides an advantageous microenvironment for cancer cells proliferation and metastasis as well as directly manipulates signal transductions through reactive oxidative stress (ROS) or chromatin modulation [191]. In addition to the changes in glucose metabolism, accumulating evidence verified that dysregulation of lipid and amino acid metabolism are also involved in the enhancement of malignant progression [192,193]. Abnormalities in proto-oncogenes or tumor suppressor genes directly drive the metabolic rewiring in cancer cells [194,195].
Besides the transactivation of genes involved in the maintenance of cellular redox homeostasis, increasing evidence emerges that NRF2 pleiotropically modulates cancer cell metabolism [196,197]. Over-activation of NRF2 has been reported to promote the Warburg effect in cancer cells [10,198]. NRF2 enhanced glucose uptake, induced transcriptional up-regulation of genes encoding glycolytic enzymes, such as HK2, PFKFB3, GAPDH, PGK1, and ENO1/2, and then reduced the entry of glycolysis-derived pyruvate into the TCA cycle through induction of LDHA and PDK1 [198–200]. In addition to central carbon metabolism, NRF2 regulates numerous metabolic processes, including amino acid metabolism, lipid metabolism, and iron/heme metabolism, that enhance cellular plasticity of cancer cells to enable malignant progression [197] (Fig. 2).
Fig. 2.
Schematic illustration depicts mechanisms of actions of NRF2 on cancer metabolic reprogramming.
3.3.2. NRF2 plays a pivotal role in the satisfaction of NADPH demand in cancer cells
Maintaining the optimal balance of redox status is a crucial requisite within the cells of living organisms. Compared with normal cells, cancer cells commonly encounter greater oxidative stress in virtue of environmental stress as well as the upregulation of growth signals, metabolic activity, mitochondrial function, and integrin activation [201]. A large part of NRF2-regulated metabolic pathways, such as NADPH generation, glutathione synthesis, and cysteine metabolism, is hijacked by cancer cells to cope with excessive ROS production to adapt and survive under such stressful conditions [196]. NRF2 directly regulated major cytosolic NADPH-producing enzymes, two of the pentose phosphate pathway (glucose-6-phosphate dehydrogenase (G6PD), 6-phosphogluconate dehydrogenase (PGD)), one of TCA cycle (isocitrate dehydrogenase 1 (IDH1), and one is a link between glycolysis and citric acid cycle (malic enzyme 1 (ME1)) [202,203]. Furthermore, a mitochondrial enzyme, methylenetetrahydrofolate dehydrogenase 2 (MTHFD2), involved in mitochondrial NADPH production is also regulated by NRF2 [202,204]. Conversely, pyruvate kinase, a key glycolytic enzyme that controls glucose carbon toward oxidative phosphorylation or pentose phosphate pathway, is negatively regulated by NRF2 [205]. Suppression of pyruvate kinase promoted the influx of glucose into the pentose phosphate pathway, thereby increasing NADPH production through G6PD and PGD [206].
De novo fatty acid synthesis is one of the most NADPH-consuming metabolic processes in the cells [207,208]. Genetic (KEAP1 knockout) and chemical activation of NRF2 in vivo reduce the genes encoding the key enzymes for de novo lipogenesis, like ATP-citrate lyase (ACLY), Acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), fatty acid desaturases (FADS), fatty acid elongases (ELOVL), and stearoyl CoA desaturase (SCD1) [205]. This evidence has indicated that NRF2 increases the intracellular NADPH pool not only through induction of NADPH-generating enzymes and enforced carbon-flux toward NADPH generation but also suppressed NADPH-consuming metabolic pathway. Up-regulation of the de novo fatty acid biosynthetic pathway is a common metabolic feature of cancer cells [207,208], however, the exact role of NRF2-regulated de novo fatty acid biosynthesis in tumor progression remains uncertain and requires systematic investigations.
3.3.3. NRF2 and fatty acid oxidation
Unlike suppression of de novo fatty acid biosynthesis, several in vivo studies have demonstrated that NRF2 enhances fatty acid oxidation (FAO) via upregulation of FAO-related enzymes expression, such as carnitine palmitoyltransferase (CPT1/2) and acyl-CoA oxidase (ACOX1/2) [196,209,210]. Further, peroxisome proliferator-activated receptor δ (PPARδ), a transcription factor with key roles in regulating the expression of several genes encoding main enzymes involved in fatty acid oxidation and cholesterol metabolism, is upregulated by the constitutively-active mutant form of NRF2 (NRF2 E79Q) in the hyperplastic mouse squamous epithelial cells [211]. In addition to inducing the expression of FAO-related genes, NRF2 has been verified to enhance lipid uptake through activation of cluster of differentiation 36 (CD36), a fatty acid translocase in macrophages [212,213] and hepatocellular carcinoma (Huh-7) cells [214]. Although CD36-dependent lipid metabolism exhibits a tumor-promoting role in cancer cells [215], the dual effects of NRF2 in CD36-mediated enhancement of tumor progression are still unclear. Accordingly, even though the role of NRF2 in fatty acid metabolismhas been identified, further investigations are needed to clarify the influences of NRF2-directed lipid metabolism on malignant progression.
3.3.4. NRF2 and amino acid metabolism
In addition to increasing intracellular NADPH amount, NRF2-mediated activation of thioredoxin (Trx) and glutathione (GSH) systems is the principal mechanism for coping with ROS overproduction in cancer cells [216]. NRF2 enhances de novo synthesis of glutathione from glutamate, cysteine, and glycine via inductions in the expression of glutamatecysteine ligase modifier subunit (GCLM), the glutamate-cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GSS) [217]. NRF2 promotes transcriptional upregulations of the cystine/ glutamate antiporter, SLC7A11 (xCT), to enhance cystine uptake [218] as well as glutathione reductase (GR) and glutathione peroxidase (GPx) to facilitate glutathione recycling [9]. Furthermore, NRF2 also up-regulates the expression of genes encoding enzymes involved in the thioredoxin systems to increase the reduction of cystine to cysteine [219].
Glutamine, a conditionally essential amino acid, is an important amino acid with pleiotropic functions for tumor progression [220]. Glutaminolysis, a metabolic process composed of several steps for catalyzing glutamine, has been considered as one of the hallmarks of cancer metabolism [220] and a potential therapeutic target for cancer therapy [221]. Persistent activation of NRF2 enhanced the dependency of cancer cells on glutaminolysis and thereby resulted in sensitizing tumors to glutaminase inhibition [222,223]. A significantly higher requirement for exogenous glutamine has been observed in the NSCLC cells with loss-of-function mutations in KEAP1 than in the KEAP1-wild-type NSCLC cells [224]. The enhanced dependency of exogenous glutamine in NRF2-hyperactive cancer cells is due to the decreased intracellular glutamate pools induced by the induction of glutathione synthesis and glutamate excretion via cystine/glutamate antiporter [224]. NRF2 facilities glutaminolysis through transcriptional activation of the enzymes involved in glutamine uptake (solute carrier family 1 member 5 (SLC1A5) [222]), hydrolysis of glutamine forming glutamate (glutaminase 2 (GLS2) [225]), and reversible transamination between alanine and 2-oxoglutarate to form pyruvate and glutamate (glutamic-pyruvic transaminase 2 (GPT2) [225]). Enhanced glutaminolysis not only provides glutamate for increased glutathione biosynthesis but also fuels the TCA cycle through replenishing intermediates from glutamine [222,224], and promotes the synthesis of nonessential amino acids through aminotransferases in cancer cells [220]. Furthermore, up-regulation of glutaminolysis also fulfills the needs of de novo nucleic acid and lipid biosynthesis in cancer cells [202,226].
Asparagine and aspartate play important roles in the maintenance of cancer cell proliferation, and survival under stress conditions, such as nutrientlimiting conditions (especially glucose and glutamine deprivation), ETC dysfunction and hypoxia [227–230]. Decreasing the bioavailability of asparagine through knockdown of asparagine synthetase (ASNS) reduces the transcription of EMT-related genes and metastasis of breast cancer cells, indicating that asparagine bioavailability may be an important regulatory mechanism in cancer metastasis [231]. Asparagine synthetase (ASNS) catalyzes the synthesis of the asparagine from aspartate and glutamine that require ATP hydrolysis [232]. The expression of ASNA is induced by activating transcription factor 4 (ATF4), thereby maintaining intracellular asparagine levels in response to nutrient-limiting conditions [227,233]. NRF2 promoted ATF4-regulated ASNS expression induced by activating PI3K-AKT pathway during glutamine deprivation in a KRASG12D-driven mouse lung cancer model [234]. Thus, asparagine biosynthesis was enhanced and then glutamine deprivation-induced apoptosis was suppressed. In addition, NRF2 may transactivated ATF4 gene expression through direct binding to its promoter, thus allowing amplification of ATF4-driven ASNS expression to contribute to the development of esophageal squamous cell carcinoma (ESCC) under glucose-deprived conditions [227].
Besides regulation of de novo asparagine synthesis via ATF4, NRF2 has also been reported to increase serine/glycine biosynthesis from glucose through enhancing ATF4-mediated phosphoglycerate dehydrogenase (PHGDH), phosphoserine aminotransferase 1 (PSAT1), and serine hydroxymethyltransferase 2 (SHMT2) expressions in NSCLC cells [235]. Activation of serine/glycine biosynthesis pathway replenishes carbons from glycolysis to fuel GSH, nucleotides, and NADPH synthesis and then promoted lung cancer progression [235]. Serine biosynthesis is dependent on GLUT8 (SLC2A8)-mediated glucose uptake in the KRAS-mutant KEAP1 deficient NSCLC cell lines, indicating that glucose availability played an important role in NRF2-mediated serine biosynthesis in lung cancer [236]. In addition to NSCLC, NRF2 is also involved in the regulation of de novo serine synthesis in hepatocellular carcinoma (HCC) [80]. Under serine-deprived conditions, an increased SUMOylation of NRF2 enhances de novo serine synthesis through up-regulating the translation of the first rate-limiting enzyme, PHGDH, of the pathway, contributing to the maintenance of HCC. This enhancement of serine biosynthesis by NRF2 SUMOylation is partly dependent on the intracellular ROS level in HCC.
3.3.5. NRF2 and de novo nucleotide synthesis
Over-activation of NRF2 empowers de novo nucleotide synthesis to satisfy the constant demands of rapid proliferation in cancer cells through metabolic network rewiring to provide building blocks for fueling nucleotide synthesis and transactivation of the genes that encode for nucleotide synthesis enzymes [196,202,235]. For instance, increased activity of the pentose phosphate pathway caused by constitutive activation of NRF2 promoted nucleotide synthesis by raising the availabilities of the sugar backbone of the nucleotide (ribose 5-phosphate (R5P)) [179,196,206]. Up-regulation of intracellular NADPH level by NRF2 provides advantages for deoxyribonucleotides synthesis via supporting the enzymatic reaction of ribonucleotide reductase [196]. Furthermore, NRF2 directly transactivates the expression of phosphoribosyl pyrophosphate amidotransferase (PPAT), an important rate-limiting enzyme for the de novo nucleotide biosynthetic pathway [202,237]. Up-regulation of the expression of methylenetetrahydrofolate dehydrogenase 2 (MTHFD2), a mitochondrial enzyme involved in folate-mediated one-carbon metabolism, by NRF2 also promotes de novo synthesis of purine in cancer cells [202,237]. Another mitochondrial enzyme, methylenetetrahydrofolate dehydrogenase 1-like (MTHFD1L), which is downstream of MTHFD2 in the mitochondrial folate cycle, is also found to be directly regulated by NRF2 in HCC [238,239]. In addition, oxidative pentose phosphate pathway (oxPPP)-generated NADPH plays a critical role in supporting folate metabolism by regulation of dihydrofolate reductase (DHFR) activity, indicating that NRF2 promotes folate-mediated one-carbon metabolism to support de novo nucleotide synthesis not only directly through transactivation of MTHFD2 and MTHFD1L gene expressions but also indirectly through up-regulation of PPP [240].
3.3.6. NRF2 and iron/heme metabolism
The role of NRF2 in iron/heme metabolism has been well established [241]. NRF2 controls the intracellular iron homeostasis through regulating the expression of genes involved in heme biosynthesis (ferrochelatase (FECH) [242]), heme catabolism (heme oxygenase (HMOX-1) [243], biliverdin reductase A/B (BLVR A/B) [244]), heme/iron transport (ATP binding cassette subfamily B member 6 (ABCB6) [245], transferrin receptor-1 (TFR1), ferroportin-1 (FPN1) [246]), and heme transporter (HRG1) [242]) and intracellular iron storage (ferritin heavy chain 1 (FTH1) and ferritin light chain [247]). Ferroptosis is iron-dependent programmed necrosis, which is induced by ferrous iron (Fe2+)-mediated lipid peroxidation [248]. Recently, triggering ferroptosis is considered as a novel therapeutic strategy in cancer treatment [249]. Owing to the regulatory role in iron/heme metabolism and ROS detoxification, NRF2 functions as the protector of cancer cells against ferroptosis [250]. Notably, the activity of glutathione peroxidase 4 (GPX4), the gatekeeper for ferroptosis, is directly or indirectly up-regulated by NRF2 [250]. Another ferroptosis-inhibiting protein, cystine/glutamate antiporter, SLC7A11 (xCT), which maintains intracellular cysteine availability for glutathione production, is also induced by NRF2 activation [250]. Therefore, inducing ferroptosis via inhibition of NRF2 has been viewed as a potential therapeutic strategy for the treatment of cancer, especially for re-sensitization of treatment-resistant cancer cells [251].
4. Chemopreventive effects and therapeutic potentials of NRF2 modulators
4.1. Applications of NRF2 activators in cancer chemoprevention
One of the most prominent strategies in cancer chemoprevention is to protect cells or tissues from various carcinogens and carcinogenic metabolites, both exogenous and endogenous, by inducing detoxifying enzymes and antioxidant proteins. NRF2 plays an important role in preventing carcinogenesis through antioxidant response element (ARE)-mediated transcriptional activation of several detoxifying and antioxidant enzymes [120,252,253]. The exploration of phytochemicals and food constituents which exerted chemopreventive potential via the elimination of electrophile-induced carcinogenesis by Nrf2-driven antioxidants and detoxifying proteins are hot areas in cancer prevention research [252–256].
In order to discover more novel NRF2 modulators, we have established a cell-based NRF2/ARE-driven luciferase reporter system that can efficiently and accurately screen large compound libraries [257]. This platform has helped us to successfully develop many NRF2 activators [257–263]. Among them, we first identified 4-ketopinoresinol as a novel NRF2 activator. 4-Ketopinoresinol was isolated from adlay and exhibited a potent cytoprotective effect against oxidative stress-induced cell injury through activation of PI3K/AKT/NRF2/HO-1 axis [257]. In addition to 4-Ketopinoresinol, several phytochemicals isolated from adlay, such as trans-coniferylaldehyde and sinapaldehyde, were also identified to possess free-radical scavenging and antimutagenic activities by inducing NRF2/ARE pathway [259]. We noticed that trans-coniferylaldehyde increased the level of Nrf2-mediated detoxifying/antioxidant proteins in vitro and in vivo, and attenuated carcinogen-induced oxidative stress by activating Nrf2 via p38α/ MAPKAPK-2- and PK-N3-dependent signaling pathways [260]. Adlay has been recognized as a chemopreventive blocking and suppressing agent against carcinogenesis [261]. Enhancement of NRF2-mediated antioxidant and detoxifying enzyme induction is one of the important mechanisms underlying the cancer chemopreventive effects of adlay [261].
By exploiting the NRF2/ARE-driven luciferase reporter system, we also noted that resveratrol, hydroquinone, ethyl ferulate, tert-Butylhydroquinone, apigenin, piceatannol, ebselen, curcumin, n-octyl caffeate, carnosic acid, tanshinone IIA, and bis-demethoxycurcumin possessed significant abilities to induce NRF2/ARE-driven luciferase activities [263]. In fact, some of the several phytochemicals mentioned above are known NRF2 activators and potent cancer chemopreventive agents, such as resveratrol, piceatannol, pterostilbene, curcumin, and bis-demethoxycurcumin. Resveratrol and its hydroxyl derivative piceatannol exert significant cancer preventive benefits through activation of NRF2 and NRF2-mediated cellular defense system [264,265]. A natural methoxylated analog of resveratrol, pterostilbene has been found to be more effective than resveratrol in reducing chemically induced mouse colon carcinogenesis by induction of NRF2/ARE pathway [266]. Furthermore, pterostilbene also effectually prevents chemical-induced skin and lung tumorigenesis [267,268]. Curcumin and its analogues such as bis-demethoxycurcumin possess chemopreventive ability through activation of NRF2 [269–273]. In addition, other natural polyphenolic compounds, such as apigenin and carnosic acid, activate NRF2-mediated antioxidant signaling thereby providing significant cancer preventive benefits [274–277].
Although some of the NRF2 activators identified from our study [263] are not directly linked to the chemopreventive capability of cancer, however, their ability to induce NRF2-mediated protection against oxidative stress and inflammation has been reported in previous studies. For example, tanshinone IIA, a lipophilic diterpene isolated from the root of Salvia miltiorrhiza Bunge (Lamiaceae), exerts renal- and neuron-protective actions and anti-fibrotic effects in the silica-induced lung fibrosis model via increasing the induction of NRF2 [278,279]. The n-Octyl caffeate facilitates NRF2-mediated cytoprotection through increasing nuclear accumulation of NRF2, thus proving the multiple countervailing effects of oxidative hepatotoxicity [280]. Ebselen effectively protects auditory and retinal Müller cells against oxidative damages by eliciting activation of NRF2 pathway [281,282]. Although ebselen has cancer chemopreventive activity in inflammation-related carcinogenesis, there is no evidence that this is related to NRF2 activation [283]. Ethyl ferulate, a naturally lipophilic polyphenol, guards against inflammation-induced acute lung injury and renal damage caused by hyperglycemia-induced oxidative stress through NRF2 activation [284,285]. Ethyl ferulate has been reported to be a chemopreventive agent through targeting the mTOR signaling pathway [286].
Based on the above discussion, we believe that our screening platform is efficient and accurate. It accurately presented consistent results to validate NRF2 activators identified by others, and has also helped us to discover many novel and potent NRF2 activators. The role of some above-mentioned NRF2 activators in NRF2-mediated cancer chemoprevention has been validated, but more studies are still needed to elucidate other phytochemicals that have not been systematically studied in NRF2-mediated cancer chemoprevention.
4.2. Applications of NRF2 inhibitors in cancer therapy
Several lines of evidence have demonstrated that elevated NRF2 activity is strongly correlated with tumor progression. Cancer cells acquire resistance by producing high levels of detoxifying enzymes that destroy chemotherapy drugs, pumping chemotherapy drugs out by efflux pumps, or by producing antioxidants that protect cells from oxidative damage caused by certain chemotherapy drugs. Our previous studies demonstrated that activation of NRF2-ARE pathway is critical for the development of chemoresistance of tumor cells [159,160,263]. Considering the role of Nrf2 in regulating a battery of genes that act to detoxify anticancer drugs and/or attenuate drug-induced oxidative stress or induced drug efflux, it is noted that Nrf2/ARE pathway plays an important role in cancer etiology and developing the chemoresistance in the clinical setting [287,288].
The diversity of changes in metabolic programs within the cancer cells can determine how proliferative rewiring is driven. Therefore, cancer cells must rewire cellular metabolism to meet the demands of growth and proliferation, and cancer metabolism has long been considered a hallmark of cancer [289]. Recent studies have identified novel functions of NRF2 in cancer metabolic reprogramming [10], and has been explored and confirmed in different studies (Please refer Section 3–3. NRF2 and cancer metabolic reprogramming). Recently, we revealed that carcinogens, such as nicotine and arecoline, trigger c-MYC-directed NRF2 activation in head and neck cancer. Over-activation of NRF2 promotes malignant progression of HNSCC through reprogramming a wide range of cancer metabolic pathways, including pentose phosphate pathway (PPP), valine leucine and isoleucine degradation, pyrimidine metabolism, glycolysis and gluconeogenesis, purine metabolism, oxidative phosphorylation, xenobiotic metabolism, heme metabolism, fatty acid metabolism, and adipogenesis, in head and neck cancer. Targeting NRF2-directed cellular metabolism could be an effective strategy for the development of novel treatments for head and neck cancer [179].
There are no clinically available inhibitors of NRF2 in cancer therapy. Generally, except for the ligand-inducible nuclear receptors, directly modulating the activities of transcription factors remains extremely challenging [290]. Therefore, similar to most transcription factors, the development of NRF2 inhibitors, which directly and specifically targeting of NRF2 itself, is a tremendous obstacle for researchers. Several natural compounds have been reported to exert their tumor-suppressive functions through inhibition of NRF2 activity. Notably, procyanidins isolated from cinnamomi cortex promoted nuclear degradation of NRF2 through insulin-like growth factor-1 receptor-induced activation of cysteine proteases in lung cancer cells resulting in inhibition of cell proliferation and increased doxorubicin- and etoposide-induced cytotoxicity [291–293]. Convallatoxin, derived from Adonis amurensis Regel et Radde, enhances GSK-3β/β-TrCP-mediated NRF2 degradation, thereby contributing to the enhancement of 5-fluorouracil cytotoxicity [294]. Hinokitiol (β-Thujaplicin), isolated from Chymacy-paris obtuse, has been demonstrated to attenuate self-renewal and invasiveness of glioblastoma stem cells by reducing both mRNA and protein expression of NRF2 [295]. Brusatol and halofuginone, which can enhance cancer cell sensitivity to chemotherapeutic agents, have been demonstrated to act as NRF2 inhibitors through reducing NRF2 protein levels [296,297]. Furthermore, some natural compounds play ambiguous roles in the regulation of NRF2 activity. For example, luteolin was shown to induce apoptosis in colorectal cancer cells by reducing nuclear localization of NRF2 [298]; and to increase NRF2 mRNA expression by reducing the methylation status of the NRF2 promoter [299]. Furthermore, Dolastatin 12, a marine natural product isolated from marine cyanobacteria, inhibits ARE-mediated reporter gene activity and exhibits potent inhibition of the NRF2/ NQO1 axis in cancer cells [300].
Recently, drug repurposing is considered an emerging strategy to identify NRF2 inhibitors for the effective treatment of cancer. For example, all-trans retinoic acid (ATRA), currently used to treat acute promyelocytic leukemia (APL) and dermatologic diseases, has been found to block nuclear translocation of NRF2, enhance NRF2 degradation, and suppress NRF2 recruitment to ARE, resulting to reduce expression of NRF2/ARE-driven genes and diminish stem cell characteristics of ALDHhigh ovarian cancer [112,301]. Clobetasol propionate, a corticosteroid used in the treatment of inflammatory skin diseases, inhibits the NRF2 pathway by triggering GSK3/β-TrCP-mediated degradation of NRF2, contributing to inhibiting growth of NRF2-overactive lung cancer cells [302]. Isoniazid, a tuberculosis drug, has been shown to prevent nuclear translocation of NRF2 via reducing karyopherin β1-mediated nuclear import of NRF2 [303] and ERK1-dependent NRF2 phosphorylation [304] in human hepatoma cells.
To identify specific inhibitors that could directly target NRF2, several research groups have performed screening tests to identify active compounds using ARE-driven cell-based reporter assays from small molecule compound libraries [300,305–307]. 4-(2-Cyclohexylethoxy)aniline (IM3829) has been discovered to have a significant inhibitory effect on the NRF2/ARE pathway and can be used as an effective lung cancer radiosensitizer [307]. Later, thienopyrimidine-containing compound ARE Expression Modulator 1 (AEM1) is found to inhibit ARE-driven luciferase activity, NRF2-regulated gene expression, and has the ability to reduce tumor growth and increase chemosensitivity in lung cancer cells [305]. Furthermore, small molecule ML385 has been discovered to directly target NRF2 itself by binding to Neh1 domain, which is involved in heterodimerization with small Maf proteins and DNA binding [306]. ML385 inhibits the binding of the NRF2/small Maf complex to ARE, causing repression of NRF2-regulated gene expression, thereby sensitizing KEAP1-mutant NSCLC cells to chemotoxicity.
Over the past few decades, several studies have been done to identify potential inhibitors of NRF2; not surprisingly, a number of compounds have been shown to exhibit anti-NRF2 activity through reducing its intracellular content, impairing nuclear localization, blocking NRF2 binding to its co-operators, and interrupting DNA binding activity [308,309]. To date, NRF2 inhibitors that have been reported so far lack specificity and selectivity, which poses a major limitation for subsequent clinical application. By utilizing a cell-based ARE reporter gene system, we have screened a small-molecule compound library and discovered that HBED, hinokitiol, U83836E, GERIBP002A, CDC, and gossypol are potential NRF2 inhibitors [263]. Among them, gossypol displayed the highest ARE-driven luciferase inhibitory activity, and the second most potent compound was hinokitiol. Hinokitiol is a known NRF2 inhibitor [295]. Notably, HBED, U83836E, GERIBP002A, CDC, and gossypol have never been reported to have NRF2 inhibitory activity before, and this role was elucidated for the first time by our group [263]. This novel NRF2 inhibitor, gossypol, has been demonstrated to enhance the therapeutic effects of etoposide and cisplatin in chemo-resistant cancer cells by inhibiting the NRF2/MRP1 and NRF2/G6PD axis, respectively. These results suggest that gossypol has a high potential to improve clinical efficacy in chemo-refractory tumors by blocking NRF2 signaling to overcome drug pumping and reprogram cancer metabolism [263].
Based on the above discussion, one can find many NRF2 activators are natural products and belong to dietary phytochemicals. However, naturally occurring NRF2 inhibitors are mostly isolated from inedible plants or microorganisms (Fig. 3). These results reflect the recognized role of phytochemicals in edible foods that helps us build good antioxidant and detoxification defenses and support the use of NRF2 activators for chemoprevention. Conversely, NRF2 inhibitors are mostly found in non-edible plants, which indicates their use is not for daily health care, but rather as a strategy for treatment or adjuvant treatment of diseases, such as cancer.
Fig. 3.
Representative naturally occurring NRF2 activators and inhibitors.
5. Conclusion
As NRF2 acts as a double-edged sword in cancer, it protects normal cells from the initiation of carcinogenesis induced by carcinogens, but it may also prompt the cancer cells to become aggressive and resistant to treatment. Therefore, the use of NRF2 activators or inhibitors in the correct and precise context is critical to the success of cancer prevention or treatment. For example, supplementation of a large amount of antioxidants with NRF2-activating capacity during the treatment phase may raise concerns about the diminished efficacy of chemo-and radiotherapy. It must be noted that NRF2 plays an important regulatory role in cancer metabolic reprogramming, in addition to activating detoxifying enzymes, antioxidant proteins, and drug efflux transporters. Reprogramming metabolic pathways in cancer cells is critical for increasing energy production and supporting the biosynthesis of precursors required for tumor progression. In the future, it is worth exploring the mechanism of action of NRF2 inhibitors to achieve therapeutic effects by reprogramming tumor metabolism.
Supplementary Information
Grant support
This study was supported by Research Grants NSTC 110-2320-B-400-005-MY3, NSTC 111-2314-B-400-010, and NSTC 111-2622-B-400-003 from National Science and Technology Council, Taiwan.
Funding Statement
This study was supported by Research Grants NSTC 110-2320-B-400-005-MY3, NSTC 111-2314-B-400-010, and NSTC 111-2622-B-400-003 from National Science and Technology Council, Taiwan.
References
- 1. Moi P, Chan K, Asunis I, Cao A, Kan YW. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc Natl Acad Sci USA. 1994;91:9926–30. doi: 10.1073/pnas.91.21.9926. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Menegon S, Columbano A, Giordano S. The dual roles of NRF2 in cancer. Trends Mol Med. 2016;22:578–93. doi: 10.1016/j.molmed.2016.05.002. [DOI] [PubMed] [Google Scholar]
- 3. Venugopal R, Jaiswal AK. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H: quinone oxidoreductase1 gene. Proc Natl Acad Sci USA. 1996;93:14960–5. doi: 10.1073/pnas.93.25.14960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, et al. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun. 1997;236:313–22. doi: 10.1006/bbrc.1997.6943. [DOI] [PubMed] [Google Scholar]
- 5. Chan K, Lu R, Chang JC, Kan YW. NRF2, a member of the NFE2 family of transcription factors, is not essential for murine erythropoiesis, growth, and development. Proc Natl Acad Sci USA. 1996;93:13943–8. doi: 10.1073/pnas.93.24.13943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Chan K, Han XD, Kan YW. An important function of Nrf2 in combating oxidative stress: detoxification of acetaminophen. Proc Natl Acad Sci USA. 2001;98:4611–6. doi: 10.1073/pnas.081082098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Chan K, Kan YW. Nrf2 is essential for protection against acute pulmonary injury in mice. Proc Natl Acad Sci USA. 1999;96:12731–6. doi: 10.1073/pnas.96.22.12731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P, et al. Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice. Proc Natl Acad Sci USA. 2001;98:3410–5. doi: 10.1073/pnas.051618798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. He F, Ru X, Wen T. NRF2, a transcription factor for stress response and beyond. 2020 doi: 10.3390/ijms21134777. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Rojo de la Vega M, Chapman E, Zhang DD. NRF2 and the hallmarks of cancer. Cancer Cell. 2018;34:21–43. doi: 10.1016/j.ccell.2018.03.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Shaw P, Chattopadhyay A. Nrf2-ARE signaling in cellular protection: mechanism of action and the regulatory mechanisms. 2020;235:3119–30. doi: 10.1002/jcp.29219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Tonelli C, Chio IIC, Tuveson DA. Transcriptional regulation by Nrf2. Antioxidants Redox Signal. 2018;29:1727–45. doi: 10.1089/ars.2017.7342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Yamamoto M, Kensler TW, Motohashi H. The KEAP1-NRF2 system: a thiol-based sensor-effector apparatus for maintaining redox homeostasis. Physiol Rev. 2018;98:1169–203. doi: 10.1152/physrev.00023.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, et al. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Gene Dev. 1999;13:76–86. doi: 10.1101/gad.13.1.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Nguyen T, Sherratt PJ, Huang HC, Yang CS, Pickett CB. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J Biol Chem. 2003;278:4536–41. doi: 10.1074/jbc.M207293200. [DOI] [PubMed] [Google Scholar]
- 16. Stewart D, Killeen E, Naquin R, Alam S, Alam J. Degradation of transcription factor Nrf2 via the ubiquitin-proteasome pathway and stabilization by cadmium. J Biol Chem. 2003;278:2396–402. doi: 10.1074/jbc.M209195200. [DOI] [PubMed] [Google Scholar]
- 17. Zipper LM, Mulcahy RT. The Keap1 BTB/POZ dimerization function is required to sequester Nrf2 in cytoplasm. J Biol Chem. 2002;277:36544–52. doi: 10.1074/jbc.M206530200. [DOI] [PubMed] [Google Scholar]
- 18. Kobayashi M, Itoh K, Suzuki T, Osanai H, Nishikawa K, Katoh Y, et al. Identification of the interactive interface and phylogenic conservation of the Nrf2-Keap1 system. Gene Cell Devoted Mol Cell Mech. 2002;7:807–20. doi: 10.1046/j.1365-2443.2002.00561.x. [DOI] [PubMed] [Google Scholar]
- 19. Dinkova-Kostova AT, Holtzclaw WD, Cole RN, Itoh K, Wakabayashi N, Katoh Y, et al. Direct evidence that sulf-hydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc Natl Acad Sci USA. 2002;99:11908–13. doi: 10.1073/pnas.172398899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Furukawa M, Xiong Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol. 2005;25:162–71. doi: 10.1128/MCB.25.1.162-171.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Kobayashi A, Kang MI, Okawa H, Ohtsuji M, Zenke Y, Chiba T, et al. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol. 2004;24:7130–9. doi: 10.1128/MCB.24.16.7130-7139.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Taniguchi K, Yamachika S, He F, Karin M. p62/SQSTM1-Dr. Jekyll and Mr. Hyde that prevents oxidative stress but promotes liver cancer. FEBS Lett. 2016;590:2375–97. doi: 10.1002/1873-3468.12301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, et al. The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol. 2010;12:213–23. doi: 10.1038/ncb2021. [DOI] [PubMed] [Google Scholar]
- 24. Umemura A, He F, Taniguchi K, Nakagawa H, Yamachika S, Font-Burgada J, et al. p62, upregulated during preneoplasia, induces hepatocellular carcinogenesis by maintaining survival of stressed HCC-initiating cells. Cancer Cell. 2016;29:935–48. doi: 10.1016/j.ccell.2016.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Hast BE, Goldfarb D, Mulvaney KM, Hast MA, Siesser PF, Yan F, et al. Proteomic analysis of ubiquitin ligase KEAP1 reveals associated proteins that inhibit NRF2 ubiquitination. Cancer Res. 2013;73:2199–210. doi: 10.1158/0008-5472.CAN-12-4400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Karapetian RN, Evstafieva AG, Abaeva IS, Chichkova NV, Filonov GS, Rubtsov YP, et al. Nuclear oncoprotein prothymosin alpha is a partner of Keap1: implications for expression of oxidative stress-protecting genes. Mol Cell Biol. 2005;25:1089–99. doi: 10.1128/MCB.25.3.1089-1099.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Camp ND, James RG, Dawson DW, Yan F, Davison JM, Houck SA, et al. Wilms tumor gene on X chromosome (WTX) inhibits degradation of NRF2 protein through competitive binding to KEAP1 protein. J Biol Chem. 2012;287:6539–50. doi: 10.1074/jbc.M111.316471. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Ma J, Cai H, Wu T, Sobhian B, Huo Y, Alcivar A, et al. PALB2 interacts with KEAP1 to promote NRF2 nuclear accumulation and function. Mol Cell Biol. 2012;32:1506–17. doi: 10.1128/MCB.06271-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Purohit V, Wang L, Yang H, Li J, Ney GM, Gumkowski ER, et al. ATDC binds to KEAP1 to drive NRF2-mediated tumorigenesis and chemoresistance in pancreatic cancer. Gene Dev. 2021;35:218–33. doi: 10.1101/gad.344184.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wang Q, Ma J, Lu Y, Zhang S, Huang J, Chen J, et al. CDK20 interacts with KEAP1 to activate NRF2 and promotes radiochemoresistance in lung cancer cells. Oncogene. 2017;36:5321–30. doi: 10.1038/onc.2017.161. [DOI] [PubMed] [Google Scholar]
- 31. Chen W, Sun Z, Wang XJ, Jiang T, Huang Z, Fang D, et al. Direct interaction between Nrf2 and p21(Cip1/WAF1) upregulates the Nrf2-mediated antioxidant response. Mol Cell. 2009;34:663–73. doi: 10.1016/j.molcel.2009.04.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Gorrini C, Baniasadi PS, Harris IS, Silvester J, Inoue S, Snow B, et al. BRCA1 interacts with Nrf2 to regulate antioxidant signaling and cell survival. J Exp Med. 2013;210:1529–44. doi: 10.1084/jem.20121337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Xu P, Jiang L, Yang Y, Wu M, Liu B, Shi Y, et al. PAQR4 promotes chemoresistance in non-small cell lung cancer through inhibiting Nrf2 protein degradation. Theranostics. 2020;10:3767–78. doi: 10.7150/thno.43142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Meng C, Zhan J, Chen D, Shao G, Zhang H, Gu W, et al. The deubiquitinase USP11 regulates cell proliferation and ferroptotic cell death via stabilization of NRF2 USP11 deubiquitinates and stabilizes NRF2. Oncogene. 2021;40:1706–20. doi: 10.1038/s41388-021-01660-5. [DOI] [PubMed] [Google Scholar]
- 35. Zhang Q, Zhang ZY, Du H, Li SZ, Tu R, Jia YF, et al. DUB3 deubiquitinates and stabilizes NRF2 in chemotherapy resistance of colorectal cancer. Cell Death Differ. 2019;26:2300–13. doi: 10.1038/s41418-019-0303-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. McMahon M, Thomas N, Itoh K, Yamamoto M, Hayes JD. Redox-regulated turnover of Nrf2 is determined by at least two separate protein domains, the redox-sensitive Neh2 degron and the redox-insensitive Neh6 degron. J Biol Chem. 2004;279:31556–67. doi: 10.1074/jbc.M403061200. [DOI] [PubMed] [Google Scholar]
- 37. Rada P, Rojo AI, Evrard-Todeschi N, Innamorato NG, Cotte A, Jaworski T, et al. Structural and functional characterization of Nrf2 degradation by the glycogen synthase kinase 3/β-TrCP axis. Mol Cell Biol. 2012;32:3486–99. doi: 10.1128/MCB.00180-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Chowdhry S, Zhang Y, McMahon M, Sutherland C, Cuadrado A, Hayes JD. Nrf2 is controlled by two distinct β-TrCP recognition motifs in its Neh6 domain, one of which can be modulated by GSK-3 activity. Oncogene. 2013;32:3765–81. doi: 10.1038/onc.2012.388. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Hayes JD, Chowdhry S, Dinkova-Kostova AT, Sutherland C. Dual regulation of transcription factor Nrf2 by Keap1 and by the combined actions of β-TrCP and GSK-3. Biochem Soc Trans. 2015;43:611–20. doi: 10.1042/BST20150011. [DOI] [PubMed] [Google Scholar]
- 40. Lo JY, Spatola BN, Curran SP. WDR23 regulates NRF2 independently of KEAP1. PLoS Genet. 2017;13:e1006762. doi: 10.1371/journal.pgen.1006762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Siswanto FM, Oguro A, Arase S, Imaoka S. WDR23 regulates the expression of Nrf2-driven drug-metabolizing enzymes. Drug Metabol Pharmacokinet. 2020;35:441–55. doi: 10.1016/j.dmpk.2020.06.007. [DOI] [PubMed] [Google Scholar]
- 42. Wu T, Zhao F, Gao B, Tan C, Yagishita N, Nakajima T, et al. Hrd1 suppresses Nrf2-mediated cellular protection during liver cirrhosis. Gene Dev. 2014;28:708–22. doi: 10.1101/gad.238246.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Zhang J, Zhang J, Ni H, Wang Y, Katwal G, Zhao Y, et al. Downregulation of XBP1 protects kidney against ischemia-reperfusion injury via suppressing HRD1-mediated NRF2 ubiquitylation. Cell Death Discov. 2021;7:44. doi: 10.1038/s41420-021-00425-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Kang HJ, Hong YB, Kim HJ, Bae I. CR6-interacting factor 1 (CRIF1) regulates NF-E2-related factor 2 (NRF2) protein stability by proteasome-mediated degradation. J Biol Chem. 2010;285:21258–68. doi: 10.1074/jbc.M109.084590. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Cheng X, Qian W, Chen F, Jin Y, Wang F, Lu X, et al. ATRA protects skin fibroblasts against UV-induced oxidative damage through inhibition of E3 ligase Hrd1. Mol Med Rep. 2019;20:2294–302. doi: 10.3892/mmr.2019.10450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Cheung KL, Lee JH, Shu L, Kim JH, Sacks DB, Kong AN. The Ras GTPase-activating-like protein IQGAP1 mediates Nrf2 protein activation via the mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) kinase (MEK)-ERK pathway. J Biol Chem. 2013;288:22378–86. doi: 10.1074/jbc.M112.444182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Kim JH, Xu EY, Sacks DB, Lee J, Shu L, Xia B, et al. Identification and functional studies of a new Nrf2 partner IQGAP1: a critical role in the stability and transactivation of Nrf2. Antioxidants Redox Signal. 2013;19:89–101. doi: 10.1089/ars.2012.4586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Baba K, Morimoto H, Imaoka S. Seven in absentia homolog 2 (Siah2) protein is a regulator of NF-E2-related factor 2 (Nrf2) J Biol Chem. 2013;288:18393–405. doi: 10.1074/jbc.M112.438762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Hu Z, Wang X, Li D, Cao L, Cui H, Xu G. UFBP1, a key component in ufmylation, enhances drug sensitivity by promoting proteasomal degradation of oxidative stress-response transcription factor Nrf2. Oncogene. 2021;40:647–62. doi: 10.1038/s41388-020-01551-1. [DOI] [PubMed] [Google Scholar]
- 50. Silva-Islas CA, Maldonado PD. Canonical and non-canonical mechanisms of Nrf2 activation. Pharmacol Res. 2018;134:92–9. doi: 10.1016/j.phrs.2018.06.013. [DOI] [PubMed] [Google Scholar]
- 51. Baird L, Yamamoto M. The molecular mechanisms regulating the KEAP1-NRF2 pathway. Mol Cell Biol. 2020:40. doi: 10.1128/MCB.00099-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Liu T, Lv YF, Zhao JL, You QD, Jiang ZY. Regulation of Nrf2 by phosphorylation: consequences for biological function and therapeutic implications. Free Rad Biol Med. 2021;168:129–41. doi: 10.1016/j.freeradbiomed.2021.03.034. [DOI] [PubMed] [Google Scholar]
- 53. Huang HC, Nguyen T, Pickett CB. Regulation of the antioxidant response element by protein kinase C-mediated phosphorylation of NF-E2-related factor 2. Proc Natl Acad Sci USA. 2000;97:12475–80. doi: 10.1073/pnas.220418997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Huang HC, Nguyen T, Pickett CB. Phosphorylation of Nrf2 at Ser-40 by protein kinase C regulates antioxidant response element-mediated transcription. J Biol Chem. 2002;277:42769–74. doi: 10.1074/jbc.M206911200. [DOI] [PubMed] [Google Scholar]
- 55. Numazawa S, Ishikawa M, Yoshida A, Tanaka S, Yoshida T. Atypical protein kinase C mediates activation of NF-E2-related factor 2 in response to oxidative stress. Am J Physiol Cell Physiol. 2003;285:C334–42. doi: 10.1152/ajpcell.00043.2003. [DOI] [PubMed] [Google Scholar]
- 56. Alam J, Wicks C, Stewart D, Gong P, Touchard C, Otterbein S, et al. Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J Biol Chem. 2000;275:27694–702. doi: 10.1074/jbc.M004729200. [DOI] [PubMed] [Google Scholar]
- 57. Zipper LM, Mulcahy RT. Inhibition of ERK and p38 MAP kinases inhibits binding of Nrf2 and induction of GCS genes. Biochem Biophys Res Commun. 2000;278:484–92. doi: 10.1006/bbrc.2000.3830. [DOI] [PubMed] [Google Scholar]
- 58. Yu R, Chen C, Mo YY, Hebbar V, Owuor ED, Tan TH, et al. Activation of mitogen-activated protein kinase pathways induces antioxidant response element-mediated gene expression via a Nrf2-dependent mechanism. J Biol Chem. 2000;275:39907–13. doi: 10.1074/jbc.M004037200. [DOI] [PubMed] [Google Scholar]
- 59. Yuan X, Xu C, Pan Z, Keum YS, Kim JH, Shen G, et al. Butylated hydroxyanisole regulates ARE-mediated gene expression via Nrf2 coupled with ERK and JNK signaling pathway in HepG2 cells. Mol Carcinog. 2006;45:841–50. doi: 10.1002/mc.20234. [DOI] [PubMed] [Google Scholar]
- 60. Yao P, Nussler A, Liu L, Hao L, Song F, Schirmeier A, et al. Quercetin protects human hepatocytes from ethanol-derived oxidative stress by inducing heme oxygenase-1 via the MAPK/Nrf2 pathways. J Hepatol. 2007;47:253–61. doi: 10.1016/j.jhep.2007.02.008. [DOI] [PubMed] [Google Scholar]
- 61. Zipper LM, Mulcahy RT. Erk activation is required for Nrf2 nuclear localization during pyrrolidine dithiocarbamate induction of glutamate cysteine ligase modulatory gene expression in HepG2 cells. Toxicol Sci Off J Soc Toxicol. 2003;73:124–34. doi: 10.1093/toxsci/kfg083. [DOI] [PubMed] [Google Scholar]
- 62. Sun Z, Huang Z, Zhang DD. Phosphorylation of Nrf2 at multiple sites by MAP kinases has a limited contribution in modulating the Nrf2-dependent antioxidant response. PLoS One. 2009;4:e6588. doi: 10.1371/journal.pone.0006588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Keum YS, Yu S, Chang PP, Yuan X, Kim JH, Xu C, et al. Mechanism of action of sulforaphane: inhibition of p38 mitogen-activated protein kinase isoforms contributing to the induction of antioxidant response element-mediated heme oxygenase-1 in human hepatoma HepG2 cells. Cancer Res. 2006;66:8804–13. doi: 10.1158/0008-5472.CAN-05-3513. [DOI] [PubMed] [Google Scholar]
- 64. Xu C, Yuan X, Pan Z, Shen G, Kim JH, Yu S, et al. Mechanism of action of isothiocyanates: the induction of ARE-regulated genes is associated with activation of ERK and JNK and the phosphorylation and nuclear translocation of Nrf2. Mol Cancer Therapeut. 2006;5:1918–26. doi: 10.1158/1535-7163.MCT-05-0497. [DOI] [PubMed] [Google Scholar]
- 65. Yeh CT, Yen GC. Involvement of p38 MAPK and Nrf2 in phenolic acid-induced P-form phenol sulfotransferase expression in human hepatoma HepG2 cells. Carcinogenesis. 2006;27:1008–17. doi: 10.1093/carcin/bgi281. [DOI] [PubMed] [Google Scholar]
- 66. Shen G, Hebbar V, Nair S, Xu C, Li W, Lin W, et al. Regulation of Nrf2 transactivation domain activity. The differential effects of mitogen-activated protein kinase cascades and synergistic stimulatory effect of Raf and CREB-binding protein. J Biol Chem. 2004;279:23052–60. doi: 10.1074/jbc.M401368200. [DOI] [PubMed] [Google Scholar]
- 67. Chen Y, Liu K, Zhang J, Hai Y, Wang P, Wang H, et al. c-Jun NH2 -terminal protein kinase phosphorylates the nrf2-ECH homology 6 domain of nuclear factor erythroid 2-related factor 2 and downregulates cytoprotective genes in acetaminophen-induced liver injury in mice. Hepatology. 2020;71:1787–801. doi: 10.1002/hep.31116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Joo MS, Kim WD, Lee KY, Kim JH, Koo JH, Kim SG. AMPK facilitates nuclear accumulation of nrf2 by phosphorylating at serine 550. Mol Cell Biol. 2016;36:1931–42. doi: 10.1128/MCB.00118-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Matzinger M, Fischhuber K, Pölöske D, Mechtler K, Heiss EH. AMPK leads to phosphorylation of the transcription factor Nrf2, tuning transactivation of selected target genes. Redox Biol. 2020;29:101393. doi: 10.1016/j.redox.2019.101393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Cullinan SB, Zhang D, Hannink M, Arvisais E, Kaufman RJ, Diehl JA. Nrf2 is a direct PERK substrate and effector of PERK-dependent cell survival. Mol Cell Biol. 2003;23:7198–209. doi: 10.1128/MCB.23.20.7198-7209.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Kuper A, Baumann J, Gopelt K, Baumann M, Sanger C, Metzen E, et al. Overcoming hypoxia-induced resistance of pancreatic and lung tumor cells by disrupting the PERK-NRF2-HIF-axis. Cell Death Dis. 2021;12:82. doi: 10.1038/s41419-020-03319-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Del Vecchio CA, Feng Y, Sokol ES, Tillman EJ, Sanduja S, Reinhardt F, et al. De-differentiation confers multidrug resistance via noncanonical PERK-Nrf2 signaling. PLoS Biol. 2014;12:e1001945. doi: 10.1371/journal.pbio.1001945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Pi J, Bai Y, Reece JM, Williams J, Liu D, Freeman ML, et al. Molecular mechanism of human Nrf2 activation and degradation: role of sequential phosphorylation by protein kinase CK2. Free Rad Biol Med. 2007;42:1797–806. doi: 10.1016/j.freeradbiomed.2007.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74. Apopa PL, He X, Ma Q. Phosphorylation of Nrf2 in the transcription activation domain by casein kinase 2 (CK2) is critical for the nuclear translocation and transcription activation function of Nrf2 in IMR-32 neuroblastoma cells. J Biochem Mol Toxicol. 2008;22:63–76. doi: 10.1002/jbt.20212. [DOI] [PubMed] [Google Scholar]
- 75. Jimenez-Blasco D, Santofimia-Castaño P, Gonzalez A, Almeida A, Bolaños JP. Astrocyte NMDA receptors’ activity sustains neuronal survival through a Cdk5-Nrf2 pathway. Cell Death Differ. 2015;22:1877–89. doi: 10.1038/cdd.2015.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Beneduce E, Matte A, De Falco L, Mbiandjeu S, Chiabrando D, Tolosano E, et al. Fyn kinase is a novel modulator of erythropoietin signaling and stress erythropoiesis. Am J Hematol. 2019;94:10–20. doi: 10.1002/ajh.25295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77. Jain AK, Jaiswal AK. GSK-3beta acts upstream of Fyn kinase in regulation of nuclear export and degradation of NF-E2 related factor 2. J Biol Chem. 2007;282:16502–10. doi: 10.1074/jbc.M611336200. [DOI] [PubMed] [Google Scholar]
- 78. Yang X, Park SH, Chang HC, Shapiro JS, Vassilopoulos A, Sawicki KT, et al. Sirtuin 2 regulates cellular iron homeostasis via deacetylation of transcription factor NRF2. J Clin Invest. 2017;127:1505–16. doi: 10.1172/JCI88574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79. Zhou T, Zhang M, Zhao L, Li A, Qin X. Activation of Nrf2 contributes to the protective effect of Exendin-4 against angiotensin II-induced vascular smooth muscle cell senescence. Am J Physiol Cell Physiol. 2016;311:C572–82. doi: 10.1152/ajpcell.00093.2016. [DOI] [PubMed] [Google Scholar]
- 80. Guo H, Xu J, Zheng Q, He J, Zhou W, Wang K, et al. NRF2 SUMOylation promotes de novo serine synthesis and maintains HCC tumorigenesis. Cancer Lett. 2019;466:39–48. doi: 10.1016/j.canlet.2019.09.010. [DOI] [PubMed] [Google Scholar]
- 81. McIntosh DJ, Walters TS, Arinze IJ, Davis J. Arkadia (RING finger protein 111) mediates sumoylation-dependent stabilization of Nrf2 through K48-linked ubiquitination. Cell Physiol Biochem Int J Exp Cell Physiol Biochem Pharmacol. 2018;46:418–30. doi: 10.1159/000488475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82. Walters TS, McIntosh DJ, Ingram SM, Tillery L, Motley ED, Arinze IJ, et al. SUMO-modification of human Nrf2 at K(110) and K(533) regulates its nucleocytoplasmic localization, stability and transcriptional activity. Cell Physiol Biochem Int J Exp Cell Physiol Biochem Pharmacol. 2021;55:141–59. doi: 10.33594/000000351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83. Ramani K, Tomasi ML, Yang H, Ko K, Lu SC. Mechanism and significance of changes in glutamate-cysteine ligase expression during hepatic fibrogenesis. J Biol Chem. 2012;287:36341–55. doi: 10.1074/jbc.M112.370775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84. Malloy MT, McIntosh DJ, Walters TS, Flores A, Goodwin JS, Arinze IJ. Trafficking of the transcription factor Nrf2 to promyelocytic leukemia-nuclear bodies: implications for degradation of NRF2 in the nucleus. J Biol Chem. 2013;288:14569–83. doi: 10.1074/jbc.M112.437392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85. Burroughs AF, Eluhu S, Whalen D, Goodwin JS, Sakwe AM, Arinze IJ. PML-nuclear bodies regulate the stability of the fusion protein dendra2-nrf2 in the nucleus. Cell Physiol Biochem Int J Exp Cell Physiol Biochem Pharmacol. 2018;47:800–16. doi: 10.1159/000490033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86. Kubben N, Zhang W, Wang L, Voss TC, Yang J, Qu J, et al. Repression of the antioxidant NRF2 pathway in premature aging. Cell. 2016;165:1361–74. doi: 10.1016/j.cell.2016.05.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87. Sanghvi VR, Leibold J, Mina M, Mohan P, Berishaj M, Li Z, et al. The oncogenic action of NRF2 depends on de-glycation by fructosamine-3-kinase. Cell. 2019;178:807–819e21. doi: 10.1016/j.cell.2019.07.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88. Beeraka NM, Bovilla VR, Doreswamy SH, Puttalingaiah S, Srinivasan A, Madhunapantula SV. The taming of nuclear factor erythroid-2-related factor-2 (Nrf2) deglycation by fructosamine-3-kinase (FN3K)-Inhibitors-A novel strategy to combat cancers. Cancers. 2021:13. doi: 10.3390/cancers13020281. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89. Li W, Yu S, Liu T, Kim JH, Blank V, Li H, et al. Heterodimerization with small Maf proteins enhances nuclear retention of Nrf2 via masking the NESzip motif. Biochim Biophys Acta. 2008;1783:1847–56. doi: 10.1016/j.bbamcr.2008.05.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90. Katsuoka F, Otsuki A, Takahashi M, Ito S, Yamamoto M. Direct and specific functional evaluation of the Nrf2 and MafG heterodimer by introducing a tethered dimer into small maf-deficient cells. Mol Cell Biol. 2019;39 doi: 10.1128/MCB.00273-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91. Katsuoka F, Yamamoto M. Small Maf proteins (MafF, MafG, MafK): history, structure and function. Gene. 2016;586:197–205. doi: 10.1016/j.gene.2016.03.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92. Venugopal R, Jaiswal AK. Nrf2 and Nrf1 in association with Jun proteins regulate antioxidant response element-mediated expression and coordinated induction of genes encoding detoxifying enzymes. Oncogene. 1998;17:3145–56. doi: 10.1038/sj.onc.1202237. [DOI] [PubMed] [Google Scholar]
- 93. He CH, Gong P, Hu B, Stewart D, Choi ME, Choi AM, et al. Identification of activating transcription factor 4 (ATF4) as an Nrf2-interacting protein. Implication for heme oxygenase-1 gene regulation. J Biol Chem. 2001;276:20858–65. doi: 10.1074/jbc.M101198200. [DOI] [PubMed] [Google Scholar]
- 94. Tanigawa S, Lee CH, Lin CS, Ku CC, Hasegawa H, Qin S, et al. Jun dimerization protein 2 is a critical component of the Nrf2/MafK complex regulating the response to ROS homeostasis. Cell Death Dis. 2013;4:e921. doi: 10.1038/cddis.2013.448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95. Katoh Y, Itoh K, Yoshida E, Miyagishi M, Fukamizu A, Yamamoto M. Two domains of Nrf2 cooperatively bind CBP, a CREB binding protein, and synergistically activate transcription. Gene Cell Devoted Mol Cell Mech. 2001;6:857–68. doi: 10.1046/j.1365-2443.2001.00469.x. [DOI] [PubMed] [Google Scholar]
- 96. Zhang J, Hosoya T, Maruyama A, Nishikawa K, Maher JM, Ohta T, et al. Nrf2 Neh5 domain is differentially utilized in the transactivation of cytoprotective genes. Biochem J. 2007;404:459–66. doi: 10.1042/BJ20061611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97. Seng S, Avraham HK, Birrane G, Jiang S, Avraham S. Nuclear matrix protein (NRP/B) modulates the nuclear factor (Erythroid-derived 2)-related 2 (NRF2)-dependent oxidative stress response. J Biol Chem. 2010;285:26190–8. doi: 10.1074/jbc.M109.095786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98. Kim JH, Yu S, Chen JD, Kong AN. The nuclear cofactor RAC3/AIB1/SRC-3 enhances Nrf2 signaling by interacting with transactivation domains. Oncogene. 2013;32:514–27. doi: 10.1038/onc.2012.59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99. Lin W, Shen G, Yuan X, Jain MR, Yu S, Zhang A, et al. Regulation of Nrf2 transactivation domain activity by p160 RAC3/SRC3 and other nuclear co-regulators. J Biochem Mol Biol. 2006;39:304–10. doi: 10.5483/bmbrep.2006.39.3.304. [DOI] [PubMed] [Google Scholar]
- 100. Sekine H, Okazaki K, Ota N, Shima H, Katoh Y, Suzuki N, et al. The mediator subunit MED16 transduces NRF2-activating signals into antioxidant gene expression. Mol Cell Biol. 2016;36:407–20. doi: 10.1128/MCB.00785-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101. Kurinna S, Seltmann K, Bachmann AL, Schwendimann A, Thiagarajan L, Hennig P, et al. Interaction of the NRF2 and p63 transcription factors promotes keratinocyte proliferation in the epidermis. Nucleic Acids Res. 2021;49:3748–63. doi: 10.1093/nar/gkab167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102. Nioi P, Nguyen T, Sherratt PJ, Pickett CB. The carboxyterminal Neh3 domain of Nrf2 is required for transcriptional activation. Mol Cell Biol. 2005;25:10895–906. doi: 10.1128/MCB.25.24.10895-10906.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103. Kim SJ, Saeidi S, Cho NC, Kim SH, Lee HB, Han W, et al. Interaction of Nrf2 with dimeric STAT3 induces IL-23 expression: implications for breast cancer progression. Cancer Lett. 2021;500:147–60. doi: 10.1016/j.canlet.2020.11.047. [DOI] [PubMed] [Google Scholar]
- 104. Jyrkkänen HK, Kuosmanen S, Heinäniemi M, Laitinen H, Kansanen E, Mella-Aho E, et al. Novel insights into the regulation of antioxidant-response-element-mediated gene expression by electrophiles: induction of the transcriptional repressor BACH1 by Nrf2. Biochem J. 2011;440:167–74. doi: 10.1042/BJ20110526. [DOI] [PubMed] [Google Scholar]
- 105. Hoshino H, Kobayashi A, Yoshida M, Kudo N, Oyake T, Motohashi H, et al. Oxidative stress abolishes leptomycin Bsensitive nuclear export of transcription repressor Bach2 that counteracts activation of Maf recognition element. J Biol Chem. 2000;275:15370–6. doi: 10.1074/jbc.275.20.15370. [DOI] [PubMed] [Google Scholar]
- 106. Dhakshinamoorthy S, Jain AK, Bloom DA, Jaiswal AK. Bach1 competes with Nrf2 leading to negative regulation of the antioxidant response element (ARE)-mediated NAD(P) H:quinone oxidoreductase 1 gene expression and induction in response to antioxidants. J Biol Chem. 2005;280:16891–900. doi: 10.1074/jbc.M500166200. [DOI] [PubMed] [Google Scholar]
- 107. Liu P, Rojo de la Vega M, Sammani S, Mascarenhas JB, Kerins M, Dodson M, et al. RPA1 binding to NRF2 switches ARE-dependent transcriptional activation to ARE-NRE-dependent repression. Proc Natl Acad Sci USA. 2018;115:10352–61. doi: 10.1073/pnas.1812125115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108. Levy S, Forman HJ. C-Myc is a Nrf2-interacting protein that negatively regulates phase II genes through their electrophile responsive elements. IUBMB Life. 2010;62:237–46. doi: 10.1002/iub.314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109. Wang H, Liu K, Geng M, Gao P, Wu X, Hai Y, et al. RXRα inhibits the NRF2-ARE signaling pathway through a direct interaction with the Neh7 domain of NRF2. Cancer Res. 2013;73:3097–108. doi: 10.1158/0008-5472.CAN-12-3386. [DOI] [PubMed] [Google Scholar]
- 110. Jiang H, Li R, Zhang Z, Chang C, Liu Y, Liu Z, et al. Retinoid X receptor α (RXRα)-mediated erythroid-2-related factor-2 (NRF2) inactivation contributes to N,N-dimethylformamide (DMF)-induced oxidative stress in HL-7702 and HuH6 cells. J Appl Toxicol. 2020;40:470–82. doi: 10.1002/jat.3919. [DOI] [PubMed] [Google Scholar]
- 111. Chorley BN, Campbell MR, Wang X, Karaca M, Sambandan D, Bangura F, et al. Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha. Nucleic Acids Res. 2012;40:7416–29. doi: 10.1093/nar/gks409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112. Wang XJ, Hayes JD, Henderson CJ, Wolf CR. Identification of retinoic acid as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha. Proc Natl Acad Sci USA. 2007;104:19589–94. doi: 10.1073/pnas.0709483104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 113. Zhou W, Lo SC, Liu JH, Hannink M, Lubahn DB. ERRbeta: a potent inhibitor of Nrf2 transcriptional activity. Mol Cell Endocrinol. 2007;278:52–62. doi: 10.1016/j.mce.2007.08.011. [DOI] [PubMed] [Google Scholar]
- 114. Ki SH, Cho IJ, Choi DW, Kim SG. Glucocorticoid receptor (GR)-associated SMRT binding to C/EBPbeta TAD and Nrf2 Neh4/5: role of SMRT recruited to GR in GSTA2 gene repression. Mol Cell Biol. 2005;25:4150–65. doi: 10.1128/MCB.25.10.4150-4165.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115. Chen D, Tavana O, Chu B, Erber L, Chen Y, Baer R, et al. NRF2 is a major target of ARF in p53-independent tumor suppression. Mol Cell. 2017;68:224–232e4. doi: 10.1016/j.molcel.2017.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116. Ansell PJ, Lo SC, Newton LG, Espinosa-Nicholas C, Zhang DD, Liu JH, et al. Repression of cancer protective genes by 17beta-estradiol: ligand-dependent interaction between human Nrf2 and estrogen receptor alpha. Mol Cell Endocrinol. 2005;243:27–34. doi: 10.1016/j.mce.2005.08.002. [DOI] [PubMed] [Google Scholar]
- 117. Ikeda Y, Sugawara A, Taniyama Y, Uruno A, Igarashi K, Arima S, et al. Suppression of rat thromboxane synthase gene transcription by peroxisome proliferator-activated receptor gamma in macrophages via an interaction with NRF2. J Biol Chem. 2000;275:33142–50. doi: 10.1074/jbc.M002319200. [DOI] [PubMed] [Google Scholar]
- 118. Lin CC, Yang CC, Chen YW, Hsiao LD, Yang CM. Arachidonic acid induces ARE/Nrf2-Dependent heme oxygenase-1 transcription in rat brain astrocytes. Mol Neurobiol. 2018;55:3328–43. doi: 10.1007/s12035-017-0590-7. [DOI] [PubMed] [Google Scholar]
- 119. Raghunath A, Sundarraj K, Nagarajan R, Arfuso F, Bian J, Kumar AP, et al. Antioxidant response elements: discovery, classes, regulation and potential applications. Redox Biol. 2018;17:297–314. doi: 10.1016/j.redox.2018.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120. Kwak MK, Itoh K, Yamamoto M, Kensler TW. Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2 promoter. Mol Cell Biol. 2002;22:2883–92. doi: 10.1128/MCB.22.9.2883-2892.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121. Lee OH, Jain AK, Papusha V, Jaiswal AK. An auto-regulatory loop between stress sensors INrf2 and Nrf2 controls their cellular abundance. J Biol Chem. 2007;282:36412–20. doi: 10.1074/jbc.M706517200. [DOI] [PubMed] [Google Scholar]
- 122. Miao W, Hu L, Scrivens PJ, Batist G. Transcriptional regulation of NF-E2 p45-related factor (NRF2) expression by the aryl hydrocarbon receptor-xenobiotic response element signaling pathway: direct cross-talk between phase I and II drug-metabolizing enzymes. J Biol Chem. 2005;280:20340–8. doi: 10.1074/jbc.M412081200. [DOI] [PubMed] [Google Scholar]
- 123. Ma Q, Kinneer K, Bi Y, Chan JY, Kan YW. Induction of murine NAD(P)H:quinone oxidoreductase by 2,3,7,8-tetrachlorodibenzo-p-dioxin requires the CNC (cap ‘n’ collar) basic leucine zipper transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2): cross-interaction between AhR (aryl hydrocarbon receptor) and Nrf2 signal transduction. Biochem J. 2004;377:205–13. doi: 10.1042/BJ20031123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 124. Gong C, Yang H, Wang S, Liu J, Li Z, Hu Y, et al. hTERT promotes CRC proliferation and migration by recruiting YBX1 to increase NRF2 expression. Front Cell Dev Biol. 2021;9:658101. doi: 10.3389/fcell.2021.658101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 125. Rushworth SA, Zaitseva L, Murray MY, Shah NM, Bowles KM, MacEwan DJ. The high Nrf2 expression in human acute myeloid leukemia is driven by NF-κB and underlies its chemo-resistance. Blood. 2012;120:5188–98. doi: 10.1182/blood-2012-04-422121. [DOI] [PubMed] [Google Scholar]
- 126. Wang Z, Sun X, Feng Y, Wang Y, Zhang L, Wang Y, et al. Dihydromyricetin reverses MRP2-induced multidrug resistance by preventing NF-kappaB-Nrf2 signaling in colorectal cancer cell. Phytomedicine. 2021;82:153414. doi: 10.1016/j.phymed.2020.153414. [DOI] [PubMed] [Google Scholar]
- 127. Kang HJ, Hong YB, Kim HJ, Rodriguez OC, Nath RG, Tilli EM, et al. Detoxification: a novel function of BRCA1 in tumor suppression? Toxicol Sci Off J Soc Toxicol. 2011;122:26–37. doi: 10.1093/toxsci/kfr089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 128. Nagar S, Noveral SM, Trudler D, Lopez KM, McKercher SR, Han X, et al. MEF2D haploinsufficiency downregulates the NRF2 pathway and renders photoreceptors susceptible to light-induced oxidative stress. Proc Natl Acad Sci USA. 2017;114:E4048–56. doi: 10.1073/pnas.1613067114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 129. Wakabayashi N, Skoko JJ, Chartoumpekis DV, Kimura S, Slocum SL, Noda K, et al. Notch-Nrf2 axis: regulation of Nrf2 gene expression and cytoprotection by notch signaling. Mol Cell Biol. 2014;34:653–63. doi: 10.1128/MCB.01408-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 130. DeNicola GM, Karreth FA, Humpton TJ, Gopinathan A, Wei C, Frese K, et al. Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature. 2011;475:106–9. doi: 10.1038/nature10189. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 131. Tung MC, Lin PL, Wang YC, He TY, Lee MC, Yeh SD, et al. Mutant p53 confers chemoresistance in non-small cell lung cancer by upregulating Nrf2. Oncotarget. 2015;6:41692–705. doi: 10.18632/oncotarget.6150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 132. Bai M, Yang L, Liao H, Liang X, Xie B, Xiong J, et al. Metformin sensitizes endometrial cancer cells to chemotherapy through IDH1-induced Nrf2 expression via an epigenetic mechanism. Oncogene. 2018;37:5666–81. doi: 10.1038/s41388-018-0360-7. [DOI] [PubMed] [Google Scholar]
- 133. Silva-Palacios A, Ostolga-Chavarría M, Zazueta C, Königsberg M. Nrf2: molecular and epigenetic regulation during aging. Ageing Res Rev. 2018;47:31–40. doi: 10.1016/j.arr.2018.06.003. [DOI] [PubMed] [Google Scholar]
- 134. Zimta AA, Cenariu D, Irimie A, Magdo L, Nabavi SM, Atanasov AG, et al. The role of Nrf2 activity in cancer development and progression. Cancers. 2019;11 doi: 10.3390/cancers11111755. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 135. Choi JH, Lee H, Lee H, Lee H. Dopant-dependent toxicity of CeO(2) nanoparticles is associated with dynamic changes in H3K4me3 and H3K27me3 and transcriptional activation of NRF2 gene in HaCaT human keratinocytes. Int J Mol Sci. 2021:22. doi: 10.3390/ijms22063087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 136. Ashrafizadeh M, Ahmadi Z, Samarghandian S, Mohammadinejad R, Yaribeygi H, Sathyapalan T, et al. MicroRNA-mediated regulation of Nrf2 signaling pathway: implications in disease therapy and protection against oxidative stress. Life Sci. 2020;244:117329. doi: 10.1016/j.lfs.2020.117329. [DOI] [PubMed] [Google Scholar]
- 137. Poganik JR, Long MJC, Disare MT, Liu X, Chang SH, Hla T, et al. Post-transcriptional regulation of Nrf2-mRNA by the mRNA-binding proteins HuR and AUF1. Faseb J. 2019;33:14636–52. doi: 10.1096/fj.201901930R. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 138. Goldstein LD, Lee J, Gnad F, Klijn C, Schaub A, Reeder J, et al. Recurrent loss of NFE2L2 exon 2 is a mechanism for Nrf2 pathway activation in human cancers. Cell Rep. 2016;16:2605–17. doi: 10.1016/j.celrep.2016.08.010. [DOI] [PubMed] [Google Scholar]
- 139. Perez-Leal O, Barrero CA, Merali S. Translational control of Nrf2 within the open reading frame. Biochem Biophys Res Commun. 2013;437:134–9. doi: 10.1016/j.bbrc.2013.06.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 140. Perez-Leal O, Barrero CA, Merali S. Pharmacological stimulation of nuclear factor (erythroid-derived 2)-like 2 translation activates antioxidant responses. J Biol Chem. 2017;292:14108–21. doi: 10.1074/jbc.M116.770925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 141. Li W, Thakor N, Xu EY, Huang Y, Chen C, Yu R, et al. An internal ribosomal entry site mediates redox-sensitive translation of Nrf2. Nucleic Acids Res. 2010;38:778–88. doi: 10.1093/nar/gkp1048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 142. Lee SC, Zhang J, Strom J, Yang D, Dinh TN, Kappeler K, et al. G-quadruplex in the NRF2 mRNA 5’ untranslated region regulates de novo NRF2 protein translation under oxidative stress. Mol Cell Biol. 2017;37 doi: 10.1128/MCB.00122-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 143. Purdom-Dickinson SE, Sheveleva EV, Sun H, Chen QM. Translational control of nrf2 protein in activation of antioxidant response by oxidants. Mol Pharmacol. 2007;72:1074–81. doi: 10.1124/mol.107.035360. [DOI] [PubMed] [Google Scholar]
- 144. Shay KP, Michels AJ, Li W, Kong AN, Hagen TM. Cap-independent Nrf2 translation is part of a lipoic acid-stimulated detoxification stress response. Biochim Biophys Acta. 2012;1823:1102–9. doi: 10.1016/j.bbamcr.2012.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 145. Zhang J, Dinh TN, Kappeler K, Tsaprailis G, Chen QM. La autoantigen mediates oxidant induced de novo Nrf2 protein translation. Mol Cell Proteomics MCP. 2012;11:M111. 015032. doi: 10.1074/mcp.M111.015032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 146. Wu S, Lu H, Bai Y. Nrf2 in cancers: a double-edged sword. Cancer Med. 2019;8:2252–67. doi: 10.1002/cam4.2101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 147. Sajadimajd S, Khazaei M. Oxidative stress and cancer: the role of Nrf2. Curr Cancer Drug Targets. 2018;18:538–57. doi: 10.2174/1568009617666171002144228. [DOI] [PubMed] [Google Scholar]
- 148. Tao S, Rojo de la Vega M, Chapman E, Ooi A, Zhang DD. The effects of NRF2 modulation on the initiation and progression of chemically and genetically induced lung cancer. Mol Carcinog. 2018;57:182–92. doi: 10.1002/mc.22745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 149. Becks L, Prince M, Burson H, Christophe C, Broadway M, Itoh K, et al. Aggressive mammary carcinoma progression in Nrf2 knockout mice treated with 7,12-dimethylbenz[a] anthracene. BMC Cancer. 2010;10:540. doi: 10.1186/1471-2407-10-540. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 150. Zhang D, Rennhack J, Andrechek ER, Rockwell CE, Liby KT. Identification of an unfavorable immune signature in advanced lung tumors from nrf2-deficient mice. Antioxidants Redox Signal. 2018;29:1535–52. doi: 10.1089/ars.2017.7201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 151. Kitamura Y, Umemura T, Kanki K, Kodama Y, Kitamoto S, Saito K, et al. Increased susceptibility to hepatocarcinogenicity of Nrf2-deficient mice exposed to 2-amino-3-methylimidazo[4,5-f]quinoline. Cancer Sci. 2007;98:19–24. doi: 10.1111/j.1349-7006.2006.00352.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 152. Zhu H, Jia Z, Trush MA, Li YR. Nrf2 deficiency promotes melanoma growth and lung metastasis. Reactive Oxygen Spec. 2016;2:308–14. doi: 10.20455/ros.2016.853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 153.Khor TO, Huang MT, Prawan A, Liu Y, Hao X, Yu S, et al. Increased susceptibility of Nrf2 knockout mice to colitis-associated colorectal cancer. Vol. 1. Philadelphia, Pa: Cancer prevention research; 2008. pp. 187–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 154. Mohs A, Otto T, Schneider KM, Peltzer M, Boekschoten M, Holland CH, et al. Hepatocyte-specific NRF2 activation controls fibrogenesis and carcinogenesis in steatohepatitis. J Hepatol. 2021;74:638–48. doi: 10.1016/j.jhep.2020.09.037. [DOI] [PubMed] [Google Scholar]
- 155.Sarkar S, Ghosh N, Kundu M, Sil PC. Nrf2 and inflammation-triggered carcinogenesis. In: Deng H, editor. Nrf2 and its modulation in inflammation. Cham: Springer International Publishing; 2020. pp. 129–52. [Google Scholar]
- 156. Jung BJ, Yoo HS, Shin S, Park YJ, Jeon SM. Dysregulation of NRF2 in cancer: from molecular mechanisms to therapeutic opportunities. Biomol Therapeut. 2018;26:57–68. doi: 10.4062/biomolther.2017.195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 157. Robertson H, Dinkova-Kostova AT, Hayes JD. NRF2 and the ambiguous consequences of its activation during initiation and the subsequent stages of tumourigenesis. Cancers. 2020:12. doi: 10.3390/cancers12123609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 158. Wu W, Papagiannakopoulos T. The pleiotropic role of the KEAP1/NRF2 pathway in cancer. Annu Rev Cell Biol. 2020;4:413–35. [Google Scholar]
- 159. Chen HH, Chang HH, Chang JY, Tang YC, Cheng YC, Lin LM, et al. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells. Free Rad Biol Med. 2017;113:505–18. doi: 10.1016/j.freeradbiomed.2017.10.375. [DOI] [PubMed] [Google Scholar]
- 160. Chen CC, Chu CB, Liu KJ, Huang CY, Chang JY, Pan WY, et al. Gene expression profiling for analysis acquired oxaliplatin resistant factors in human gastric carcinoma TSGH-S3 cells: the role of IL-6 signaling and Nrf2/AKR1C axis identification. Biochem Pharmacol. 2013;86:872–87. doi: 10.1016/j.bcp.2013.07.025. [DOI] [PubMed] [Google Scholar]
- 161. Singh A, Daemen A, Nickles D, Jeon SM, Foreman O, Sudini K, et al. NRF2 activation promotes aggressive lung cancer and associates with poor clinical outcomes. Clin Cancer Res Off J Am Assoc Cancer Res. 2021;27:877–88. doi: 10.1158/1078-0432.CCR-20-1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 162. Torrente L, Maan G, Oumkaltoum Rezig A, Quinn J, Jackson A, Grilli A, et al. High NRF2 levels correlate with poor prognosis in colorectal cancer patients and with sensitivity to the kinase inhibitor AT9283 in vitro. Biomolecules. 2020:10. doi: 10.3390/biom10101365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 163. O’Cathail SM, Wu CH, Lewis A, Holmes C, Hawkins MA, Maughan T. NRF2 metagene signature is a novel prognostic biomarker in colorectal cancer. Cancer Genet. 2020;248–249:1–10. doi: 10.1016/j.cancergen.2020.08.006. [DOI] [PubMed] [Google Scholar]
- 164. Ramesh PS, Devegowda D, Singh A, Thimmulappa RK. NRF2, p53, and p16: predictive biomarkers to stratify human papillomavirus associated head and neck cancer patients for de-escalation of cancer therapy. Crit Rev Oncol-Hematol. 2020;148:102885. doi: 10.1016/j.critrevonc.2020.102885. [DOI] [PubMed] [Google Scholar]
- 165. Huang CF, Zhang L, Ma SR, Zhao ZL, Wang WM, He KF, et al. Clinical significance of Keap1 and Nrf2 in oral squamous cell carcinoma. PLoS One. 2013;8:e83479. doi: 10.1371/journal.pone.0083479. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 166. Namani A, Matiur Rahaman M, Chen M, Tang X. Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer. BMC Cancer. 2018;18:46. doi: 10.1186/s12885-017-3907-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 167. Wicker CA, Takiar V, Suganya R, Arnold SM, Brill YM, Chen L, et al. Evaluation of antioxidant network proteins as novel prognostic biomarkers for head and neck cancer patients. Oral Oncol. 2020;111:104949. doi: 10.1016/j.oraloncology.2020.104949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 168. Cloer EW, Goldfarb D, Schrank TP, Weissman BE, Major MB. NRF2 activation in cancer: from DNA to protein. Cancer Res. 2019;79:889–98. doi: 10.1158/0008-5472.CAN-18-2723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 169. Kang JS, Nam LB, Yoo OK, Keum YS. Molecular mechanisms and systemic targeting of NRF2 dysregulation in cancer. Biochem Pharmacol. 2020;177:114002. doi: 10.1016/j.bcp.2020.114002. [DOI] [PubMed] [Google Scholar]
- 170. Kerins MJ, Ooi A. A catalogue of somatic NRF2 gain-of-function mutations in cancer. Sci Rep. 2018;8:12846. doi: 10.1038/s41598-018-31281-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 171. Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC, et al. Oncogenic signaling pathways in the cancer genome Atlas. Cell. 2018;173:321–337e10. doi: 10.1016/j.cell.2018.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 172. Best SA, Sutherland KD. “Keaping” a lid on lung cancer: the Keap1-Nrf2 pathway. Cell Cycle. 2018;17:1696–707. doi: 10.1080/15384101.2018.1496756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 173. Liu Y, Lang F, Yang C. NRF2 in human neoplasm: cancer biology and potential therapeutic target. Pharmacol Ther. 2021;217:107664. doi: 10.1016/j.pharmthera.2020.107664. [DOI] [PubMed] [Google Scholar]
- 174. Mikac S, Rychłowski M, Dziadosz A, Szabelska-Beresewicz A, Fahraeus R, Hupp T, et al. Identification of a stable, non-canonically regulated Nrf2 form in lung cancer cells. Antioxidants. 2021;10:786. doi: 10.3390/antiox10050786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 175. Fabrizio FP, Sparaneo A, Trombetta D, Muscarella LA. Epigenetic versus genetic deregulation of the KEAP1/NRF2 Axis in solid tumors: focus on methylation and noncoding RNAs. Oxid Med Cell Longev. 2018;2018:2492063. doi: 10.1155/2018/2492063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 176. Hast BE, Cloer EW, Goldfarb D, Li H, Siesser PF, Yan F, et al. Cancer-derived mutations in KEAP1 impair NRF2 degradation but not ubiquitination. Cancer Res. 2014;74:808–17. doi: 10.1158/0008-5472.CAN-13-1655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 177. Chen RH. Cullin 3 and its role in tumorigenesis. Adv Exp Med Biol. 2020;1217:187–210. doi: 10.1007/978-981-15-1025-0_12. [DOI] [PubMed] [Google Scholar]
- 178. Namani A, Li Y, Wang XJ, Tang X. Modulation of NRF2 signaling pathway by nuclear receptors: implications for cancer. Biochim Biophys Acta. 2014;1843:1875–85. doi: 10.1016/j.bbamcr.2014.05.003. [DOI] [PubMed] [Google Scholar]
- 179. Tang YC, Hsiao JR, Jiang SS, Chang JY, Chu PY, Liu KJ, et al. c-MYC-directed NRF2 drives malignant progression of head and neck cancer via glucose-6-phosphate dehydrogenase and transketolase activation. Theranostics. 2021;11:5232–47. doi: 10.7150/thno.53417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 180. Yang M, Yao Y, Eades G, Zhang Y, Zhou Q. MiR-28 regulates Nrf2 expression through a Keap1-independent mechanism. Breast Cancer Res Treat. 2011;129:983–91. doi: 10.1007/s10549-011-1604-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 181. Zhou C, Zhao L, Zheng J, Wang K, Deng H, Liu P, et al. MicroRNA-144 modulates oxidative stress tolerance in SH-SY5Y cells by regulating nuclear factor erythroid 2-related factor 2-glutathione axis. Neurosci Lett. 2017;655:21–7. doi: 10.1016/j.neulet.2017.06.045. [DOI] [PubMed] [Google Scholar]
- 182. Wang B, Teng Y, Liu Q. MicroRNA-153 regulates NRF2 expression and is associated with breast carcinogenesis. Clin Lab. 2016;62:39–47. doi: 10.7754/clin.lab.2015.150518. [DOI] [PubMed] [Google Scholar]
- 183. Hanada N, Takahata T, Zhou Q, Ye X, Sun R, Itoh J, et al. Methylation of the KEAP1 gene promoter region in human colorectal cancer. BMC Cancer. 2012;12:66. doi: 10.1186/1471-2407-12-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 184. Akdemir B, Nakajima Y, Inazawa J, Inoue J. miR-432 induces NRF2 stabilization by directly targeting KEAP1. Mol Cancer Res MCR. 2017;15:1570–8. doi: 10.1158/1541-7786.MCR-17-0232. [DOI] [PubMed] [Google Scholar]
- 185. Jasek-Gajda E, Jurkowska H, Jasinska M, Lis GJ. Targeting the MAPK/ERK and PI3K/AKT signaling pathways affects NRF2, trx and GSH antioxidant systems in leukemia cells. Antioxidants. 2020:9. doi: 10.3390/antiox9070633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 186. Bak MJ, Truong VL, Ko SY, Nguyen XN, Jun M, Hong SG, et al. Induction of Nrf2/ARE-mediated cytoprotective genes by red ginseng oil through ASK1-MKK4/7-JNK and p38 MAPK signaling pathways in HepG2 cells. J Gins Res. 2016;40:423–30. doi: 10.1016/j.jgr.2016.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 187. Fouzder C, Mukhuty A, Mukherjee S, Malick C, Kundu R. Trigonelline inhibits Nrf2 via EGFR signalling pathway and augments efficacy of Cisplatin and Etoposide in NSCLC cells. Toxicol Vitro Int J Pub Assoc BIBRA. 2021;70:105038. doi: 10.1016/j.tiv.2020.105038. [DOI] [PubMed] [Google Scholar]
- 188. Faubert B, Solmonson A, DeBerardinis RJ. Metabolic reprogramming and cancer progression. Science. 2020:368. doi: 10.1126/science.aaw5473. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 189. Ohshima K, Morii E. Metabolic reprogramming of cancer cells during tumor progression and metastasis. Metabolites. 2021:11. doi: 10.3390/metabo11010028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 190. Warburg O. On the origin of cancer cells. Science. 1956;123:309–14. doi: 10.1126/science.123.3191.309. [DOI] [PubMed] [Google Scholar]
- 191. Liberti MV, Locasale JW. The warburg effect: how does it benefit cancer cells? Trends Biochem Sci. 2016;41:211–8. doi: 10.1016/j.tibs.2015.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 192. Long J, Zhang CJ, Zhu N, Du K, Yin YF, Tan X, et al. Lipid metabolism and carcinogenesis, cancer development. Am J Cancer Res. 2018;8:778–91. [PMC free article] [PubMed] [Google Scholar]
- 193. Xu R, Yang J, Ren B, Wang H, Yang G, Chen Y, et al. Reprogramming of amino acid metabolism in pancreatic cancer: recent advances and therapeutic strategies. Front Oncol. 2020;10:572722. doi: 10.3389/fonc.2020.572722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 194. Min HY, Lee HY. Oncogene-driven metabolic alterations in cancer. Biomol Therapeut. 2018;26:45–56. doi: 10.4062/biomolther.2017.211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 195. Iurlaro R, Leön-Annicchiarico CL, Muñoz-Pinedo C. Regulation of cancer metabolism by oncogenes and tumor suppressors. Meth Enzymol. 2014;542:59–80. doi: 10.1016/B978-0-12-416618-9.00003-0. [DOI] [PubMed] [Google Scholar]
- 196. DeBlasi JM, DeNicola GM. Dissecting the crosstalk between NRF2 signaling and metabolic processes in cancer. Cancers. 2020:12. doi: 10.3390/cancers12103023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 197. Okazaki K, Papagiannakopoulos T, Motohashi H. Metabolic features of cancer cells in NRF2 addiction status. Biophys Rev. 2020;12:435–41. doi: 10.1007/s12551-020-00659-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 198. Chang CW, Chen YS, Tsay YG, Han CL, Chen YJ, Yang CC, et al. ROS-independent ER stress-mediated NRF2 activation promotes warburg effect to maintain stemness-associated properties of cancer-initiating cells. Cell Death Dis. 2018;9:194. doi: 10.1038/s41419-017-0250-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 199. Nukui A, Narimatsu T, Kambara T, Abe H, Sakamoto S, Yoshida KI, et al. Clinically significant association of elevated expression of nuclear factor E2-related factor 2 expression with higher glucose uptake and progression of upper urinary tract cancer. BMC Cancer. 2018;18:493. doi: 10.1186/s12885-018-4427-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 200. Bi Z, Zhang Q, Fu Y, Wadgaonkar P, Zhang W, Almutairy B, et al. Nrf2 and HIF1α converge to arsenic-induced metabolic reprogramming and the formation of the cancer stemlike cells. Theranostics. 2020;10:4134–49. doi: 10.7150/thno.42903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 201. Hayes JD, Dinkova-Kostova AT, Tew KD. Oxidative stress in cancer. Cancer Cell. 2020;38:167–97. doi: 10.1016/j.ccell.2020.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 202. Mitsuishi Y, Taguchi K, Kawatani Y, Shibata T, Nukiwa T, Aburatani H, et al. Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell. 2012;22:66–79. doi: 10.1016/j.ccr.2012.05.016. [DOI] [PubMed] [Google Scholar]
- 203. Zhao D, Badur MG, Luebeck J, Magaña JH, Birmingham A, Sasik R, et al. Combinatorial CRISPR-cas9 metabolic screens reveal critical redox control points dependent on the KEAP1-NRF2 regulatory Axis. Mol Cell. 2018;69:699–708e7. doi: 10.1016/j.molcel.2018.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 204. Shin M, Momb J, Appling DR. Human mitochondrial MTHFD2 is a dual redox cofactor-specific methylenete-trahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase. Cancer Metabol. 2017;5:11. doi: 10.1186/s40170-017-0173-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 205. Yates MS, Tran QT, Dolan PM, Osburn WO, Shin S, McCulloch CC, et al. Genetic versus chemoprotective activation of Nrf2 signaling: overlapping yet distinct gene expression profiles between Keap1 knockout and triterpenoid-treated mice. Carcinogenesis. 2009;30:1024–31. doi: 10.1093/carcin/bgp100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 206. Jin L, Zhou Y. Crucial role of the pentose phosphate pathway in malignant tumors. Oncol Lett. 2019;17:4213–21. doi: 10.3892/ol.2019.10112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 207. Nagarajan SR, Butler LM, Hoy AJ. The diversity and breadth of cancer cell fatty acid metabolism. Cancer Metabol. 2021;9:2. doi: 10.1186/s40170-020-00237-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 208. Koundouros N, Poulogiannis G. Reprogramming of fatty acid metabolism in cancer. Br J Cancer. 2020;122:4–22. doi: 10.1038/s41416-019-0650-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 209. Ludtmann MH, Angelova PR, Zhang Y, Abramov AY, Dinkova-Kostova AT. Nrf2 affects the efficiency of mitochondrial fatty acid oxidation. Biochem J. 2014;457:415–24. doi: 10.1042/BJ20130863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 210. Pang S, Lynn DA, Lo JY, Paek J, Curran SP. SKN-1 and Nrf2 couples proline catabolism with lipid metabolism during nutrient deprivation. Nat Commun. 2014;5:5048. doi: 10.1038/ncomms6048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 211. Bowman BM, Montgomery SA, Schrank TP, Simon JM, Ptacek TS, Tamir TY, et al. A conditional mouse expressing an activating mutation in NRF2 displays hyperplasia of the upper gastrointestinal tract and decreased white adipose tissue. J Pathol. 2020;252:125–37. doi: 10.1002/path.5504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 212. Grajchen E, Wouters E, van de Haterd B, Haidar M, Hardonniere K, Dierckx T, et al. CD36-mediated uptake of myelin debris by macrophages and microglia reduces neuroinflammation. J Neuroinflammation. 2020;17:224. doi: 10.1186/s12974-020-01899-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 213. Maruyama A, Tsukamoto S, Nishikawa K, Yoshida A, Harada N, Motojima K, et al. Nrf2 regulates the alternative first exons of CD36 in macrophages through specific antioxidant response elements. Arch Biochem Biophys. 2008;477:139–45. doi: 10.1016/j.abb.2008.06.004. [DOI] [PubMed] [Google Scholar]
- 214. Barroso E, Rodriguez-Rodriguez R, Zarei M, Pizarro-Degado J, Planavila A, Palomer X, et al. SIRT3 deficiency exacerbates fatty liver by attenuating the HIF1alpha-LIPIN 1 pathway and increasing CD36 through Nrf2. Cell Commun Signal : CCS. 2020;18:147. doi: 10.1186/s12964-020-00640-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 215. Wang J, Li Y. CD36 tango in cancer: signaling pathways and functions. Theranostics. 2019;9:4893–908. doi: 10.7150/thno.36037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 216. Jaganjac M, Milkovic L, Sunjic SB, Zarkovic N. The NRF2, thioredoxin, and glutathione system in tumorigenesis and anticancer therapies. Antioxidants. 2020:9. doi: 10.3390/antiox9111151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 217. Hayes JD, Dinkova-Kostova AT. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem Sci. 2014;39:199–218. doi: 10.1016/j.tibs.2014.02.002. [DOI] [PubMed] [Google Scholar]
- 218. Sasaki H, Sato H, Kuriyama-Matsumura K, Sato K, Maebara K, Wang H, et al. Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression. J Biol Chem. 2002;277:44765–71. doi: 10.1074/jbc.M208704200. [DOI] [PubMed] [Google Scholar]
- 219. Hawkes HJ, Karlenius TC, Tonissen KF. Regulation of the human thioredoxin gene promoter and its key substrates: a study of functional and putative regulatory elements. Biochim Biophys Acta. 2014;1840:303–14. doi: 10.1016/j.bbagen.2013.09.013. [DOI] [PubMed] [Google Scholar]
- 220. Yang L, Venneti S, Nagrath D. Glutaminolysis: a hallmark of cancer metabolism. Annu Rev Biomed Eng. 2017;19:163–94. doi: 10.1146/annurev-bioeng-071516-044546. [DOI] [PubMed] [Google Scholar]
- 221. Jin L, Alesi GN, Kang S. Glutaminolysis as a target for cancer therapy. Oncogene. 2016;35:3619–25. doi: 10.1038/onc.2015.447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 222. Romero R, Sayin VI, Davidson SM, Bauer MR, Singh SX, LeBoeuf SE, et al. Keap1 loss promotes Kras-driven lung cancer and results in dependence on glutaminolysis. Nat Med. 2017;23:1362–8. doi: 10.1038/nm.4407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 223. Hamada S, Matsumoto R, Tanaka Y, Taguchi K, Yamamoto M, Masamune A. Nrf2 activation sensitizes K-ras mutant pancreatic cancer cells to glutaminase inhibition. Int J Mol Sci. 2021:22. doi: 10.3390/ijms22041870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 224. Sayin VI, LeBoeuf SE, Singh SX, Davidson SM, Biancur D, Guzelhan BS, et al. Activation of the NRF2 antioxidant program generates an imbalance in central carbon metabolism in cancer. Elife. 2017;6 doi: 10.7554/eLife.28083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 225. Fu J, Xiong Z, Huang C, Li J, Yang W, Han Y, et al. Hyperactivity of the transcription factor Nrf2 causes metabolic reprogramming in mouse esophagus. J Biol Chem. 2019;294:327–40. doi: 10.1074/jbc.RA118.005963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 226. Matés JM, Campos-Sandoval JA, Santos-Jiménez JL, Márquez J. Dysregulation of glutaminase and glutamine synthetase in cancer. Cancer Lett. 2019;467:29–39. doi: 10.1016/j.canlet.2019.09.011. [DOI] [PubMed] [Google Scholar]
- 227. Fang K, Chu Y, Zhao Z, Li Q, Li H, Chen T, et al. Enhanced expression of asparagine synthetase under glucose-deprived conditions promotes esophageal squamous cell carcinoma development. Int J Med Sci. 2020;17:510–6. doi: 10.7150/ijms.39557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 228. Jiang J, Pavlova NN, Zhang J. Asparagine, a critical limiting metabolite during glutamine starvation. Mol Cell Oncol. 2018;5:e1441633. doi: 10.1080/23723556.2018.1441633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 229. Garcia-Bermudez J, Baudrier L, La K, Zhu XG, Fidelin J, Sviderskiy VO, et al. Aspartate is a limiting metabolite for cancer cell proliferation under hypoxia and in tumours. Nat Cell Biol. 2018;20:775–81. doi: 10.1038/s41556-018-0118-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 230. Krall AS, Mullen PJ, Surjono F, Momcilovic M, Schmid EW, Halbrook CJ, et al. Asparagine couples mitochondrial respiration to ATF4 activity and tumor growth. Cell Metabol. 2021;33:1013–1026e6. doi: 10.1016/j.cmet.2021.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 231. Knott SRV, Wagenblast E, Khan S, Kim SY, Soto M, Wagner M, et al. Asparagine bioavailability governs metastasis in a model of breast cancer. Nature. 2018;554:378–81. doi: 10.1038/nature25465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 232. Lomelino CL, Andring JT, McKenna R, Kilberg MS. Asparagine synthetase: function, structure, and role in disease. J Biol Chem. 2017;292:19952–8. doi: 10.1074/jbc.R117.819060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 233. Siu F, Bain PJ, LeBlanc-Chaffin R, Chen H, Kilberg MS. ATF4 is a mediator of the nutrient-sensing response pathway that activates the human asparagine synthetase gene. J Biol Chem. 2002;277:24120–7. doi: 10.1074/jbc.M201959200. [DOI] [PubMed] [Google Scholar]
- 234. Gwinn DM, Lee AG, Briones-Martin-Del-Campo M, Conn CS, Simpson DR, Scott AI, et al. Oncogenic KRAS regulates amino acid homeostasis and asparagine biosynthesis via ATF4 and alters sensitivity to L-asparaginase. Cancer Cell. 2018;33:91–107e6. doi: 10.1016/j.ccell.2017.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 235. DeNicola GM, Chen PH, Mullarky E, Sudderth JA, Hu Z, Wu D, et al. NRF2 regulates serine biosynthesis in nonsmall cell lung cancer. Nat Genet. 2015;47:1475–81. doi: 10.1038/ng.3421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 236. McMillan EA, Ryu MJ, Diep CH, Mendiratta S, Clemenceau JR, Vaden RM, et al. Chemistry-first approach for nomination of personalized treatment in lung cancer. Cell. 2018;173:864–878e29. doi: 10.1016/j.cell.2018.03.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 237. Fox DB, Garcia NMG, McKinney BJ, Lupo R, Noteware LC, Newcomb R, et al. NRF2 activation promotes the recurrence of dormant tumour cells through regulation of redox and nucleotide metabolism. Nat Metabol. 2020;2:318–34. doi: 10.1038/s42255-020-0191-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 238. Lee D, Xu IM, Chiu DK, Lai RK, Tse AP, Lan Li L, et al. Folate cycle enzyme MTHFD1L confers metabolic advantages in hepatocellular carcinoma. J Clin Invest. 2017;127:1856–72. doi: 10.1172/JCI90253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 239. Schulze K, Imbeaud S, Letouzé E, Alexandrov LB, Calderaro J, Rebouissou S, et al. Exome sequencing of hepatocellular carcinomas identifies new mutational signatures and potential therapeutic targets. Nat Genet. 2015;47:505–11. doi: 10.1038/ng.3252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 240. Chen L, Zhang Z, Hoshino A, Zheng HD, Morley M, Arany Z, et al. NADPH production by the oxidative pentose-phosphate pathway supports folate metabolism. Nat Metabol. 2019;1:404–15. [PMC free article] [PubMed] [Google Scholar]
- 241. Kerins MJ, Ooi A. The roles of NRF2 in modulating cellular iron homeostasis. Antioxidants Redox Signal. 2018;29:1756–73. doi: 10.1089/ars.2017.7176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 242. Campbell MR, Karaca M, Adamski KN, Chorley BN, Wang X, Bell DA. Novel hematopoietic target genes in the NRF2-mediated transcriptional pathway. Oxid Med Cell Longev. 2013;2013:120305. doi: 10.1155/2013/120305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 243. Reichard JF, Motz GT, Puga A. Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res. 2007;35:7074–86. doi: 10.1093/nar/gkm638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 244. Hirotsu Y, Katsuoka F, Funayama R, Nagashima T, Nishida Y, Nakayama K, et al. Nrf2-MafG heterodimers contribute globally to antioxidant and metabolic networks. Nucleic Acids Res. 2012;40:10228–39. doi: 10.1093/nar/gks827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 245. Helias V, Saison C, Ballif BA, Peyrard T, Takahashi J, Takahashi H, et al. ABCB6 is dispensable for erythropoiesis and specifies the new blood group system Langereis. Nat Genet. 2012;44:170–3. doi: 10.1038/ng.1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 246. Zhang MW, Yang G, Zhou YF, Qian C, Mu MD, Ke Y, et al. Regulating ferroportin-1 and transferrin receptor-1 expression: a novel function of hydrogen sulfide. J Cell Physiol. 2019;234:3158–69. doi: 10.1002/jcp.27431. [DOI] [PubMed] [Google Scholar]
- 247. Liu Z, Lv X, Song E, Song Y. Fostered Nrf2 expression antagonizes iron overload and glutathione depletion to promote resistance of neuron-like cells to ferroptosis. Toxicol Appl Pharmacol. 2020;407:115241. doi: 10.1016/j.taap.2020.115241. [DOI] [PubMed] [Google Scholar]
- 248. Torti SV, Torti FM. Iron and cancer: 2020 vision. Cancer Res. 2020;80:5435–48. doi: 10.1158/0008-5472.CAN-20-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 249. Su Y, Zhao B, Zhou L, Zhang Z, Shen Y, Lv H, et al. Ferroptosis, a novel pharmacological mechanism of anti-cancer drugs. Cancer Lett. 2020;483:127–36. doi: 10.1016/j.canlet.2020.02.015. [DOI] [PubMed] [Google Scholar]
- 250. Dodson M, Castro-Portuguez R, Zhang DD. NRF2 plays a critical role in mitigating lipid peroxidation and ferroptosis. Redox Biol. 2019;23:101107. doi: 10.1016/j.redox.2019.101107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 251. Roh JL, Kim EH, Jang H, Shin D. Nrf2 inhibition reverses the resistance of cisplatin-resistant head and neck cancer cells to artesunate-induced ferroptosis. Redox Biol. 2017;11:254–62. doi: 10.1016/j.redox.2016.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 252. Hayes JD, McMahon M, Chowdhry S, Dinkova-Kostova AT. Cancer chemoprevention mechanisms mediated through the Keap1-Nrf2 pathway. Antioxidants Redox Signal. 2010;13:1713–48. doi: 10.1089/ars.2010.3221. [DOI] [PubMed] [Google Scholar]
- 253. Kwak MK, Kensler TW. Targeting NRF2 signaling for cancer chemoprevention. Toxicol Appl Pharmacol. 2010;244:66–76. doi: 10.1016/j.taap.2009.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 254. Jeong WS, Jun M, Kong AN. Nrf2: a potential molecular target for cancer chemoprevention by natural compounds. Antioxidants Redox Signal. 2006;8:99–106. doi: 10.1089/ars.2006.8.99. [DOI] [PubMed] [Google Scholar]
- 255. Wang P, Long F, Lin H, Wang T. Dietary phytochemicals targeting Nrf2 for chemoprevention in breast cancer. Food Funct. 2022;13:4273–85. doi: 10.1039/d2fo00186a. [DOI] [PubMed] [Google Scholar]
- 256. Zhu Y, Yang Q, Liu H, Song Z, Chen W. Phytochemical compounds targeting on Nrf2 for chemoprevention in colorectal cancer. Eur J Pharmacol. 2020;887:173588. doi: 10.1016/j.ejphar.2020.173588. [DOI] [PubMed] [Google Scholar]
- 257. Chen HH, Chen YT, Huang YW, Tsai HJ, Kuo CC. 4-Ketopinoresinol, a novel naturally occurring ARE activator, induces the Nrf2/HO-1 axis and protects against oxidative stress-induced cell injury via activation of PI3K/AKT signaling. Free Rad Biol Med. 2012;52:1054–66. doi: 10.1016/j.freeradbiomed.2011.12.012. [DOI] [PubMed] [Google Scholar]
- 258. Chang KM, Chen HH, Wang TC, Chen IL, Chen YT, Yang SC, et al. Novel oxime-bearing coumarin derivatives act as potent Nrf2/ARE activators in vitro and in mouse model. Eur J Med Chem. 2015;106:60–74. doi: 10.1016/j.ejmech.2015.10.029. [DOI] [PubMed] [Google Scholar]
- 259. Chen HH, Chiang W, Chang JY, Chien YL, Lee CK, Liu KJ, et al. Antimutagenic constituents of adlay (Coix lachrymajobi L. var. ma-yuen Stapf) with potential cancer chemopreventive activity. J Agric Food Chem. 2011;59:6444–52. doi: 10.1021/jf200539r. [DOI] [PubMed] [Google Scholar]
- 260. Chen HH, Wang TC, Lee YC, Shen PT, Chang JY, Yeh TK, et al. Novel Nrf2/ARE activator, trans-Coniferylaldehyde, induces a HO-1-mediated defense mechanism through a dual p38α/MAPKAPK-2 and PK-N3 signaling pathway. Chem Res Toxicol. 2015;28:1681–92. doi: 10.1021/acs.chemrestox.5b00085. [DOI] [PubMed] [Google Scholar]
- 261. Kuo CC, Chen HH, Chiang W. Adlay (yì yi˘ “soft-shelled job’s tears”; the seeds of Coix lachryma-jobi L. var. ma-yuen Stapf) is a Potential Cancer Chemopreventive Agent toward Multistage Carcinogenesis Processes. J Tradition Compl Med. 2012;2:267–75. doi: 10.1016/s2225-4110(16)30112-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 262. Li IC, Chang FC, Kuo CC, Chu HT, Li TJ, Chen CC. Pilot study: nutritional and preclinical safety investigation of fermented hispidin-enriched sanghuangporus sanghuang mycelia: a promising functional food material to improve sleep. Front Nutr. 2021;8:788965. doi: 10.3389/fnut.2021.788965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 263. Tang YC, Chang HH, Chen HH, Yao JY, Chen YT, Chuang YJ, et al. A novel NRF2/ARE inhibitor gossypol induces cytotoxicity and sensitizes chemotherapy responses in chemo-refractory cancer cells. J Food Drug Anal. 2021;29:638–52. doi: 10.38212/2224-6614.3376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 264. Alavi M, Farkhondeh T, Aschner M, Samarghandian S. Resveratrol mediates its anti-cancer effects by Nrf2 signaling pathway activation. Cancer Cell Int. 2021;21:579. doi: 10.1186/s12935-021-02280-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 265. Banik K, Ranaware AM, Harsha C, Nitesh T, Girisa S, Deshpande V, et al. Piceatannol: a natural stilbene for the prevention and treatment of cancer. Pharmacol Res. 2020;153:104635. doi: 10.1016/j.phrs.2020.104635. [DOI] [PubMed] [Google Scholar]
- 266. Chiou YS, Tsai ML, Nagabhushanam K, Wang YJ, Wu CH, Ho CT, et al. Pterostilbene is more potent than resveratrol in preventing azoxymethane (AOM)-induced colon tumorigenesis via activation of the NF-E2-related factor 2 (Nrf2)-mediated antioxidant signaling pathway. J Agric Food Chem. 2011;59:2725–33. doi: 10.1021/jf2000103. [DOI] [PubMed] [Google Scholar]
- 267. Tsai ML, Lai CS, Chang YH, Chen WJ, Ho CT, Pan MH. Pterostilbene, a natural analogue of resveratrol, potently inhibits 7,12-dimethylben [a]anthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA)-induced mouse skin carcinogenesis. Food Funct. 2012;3:1185–94. doi: 10.1039/c2fo30105a. [DOI] [PubMed] [Google Scholar]
- 268. Chen RJ, Tsai SJ, Ho CT, Pan MH, Ho YS, Wu CH, et al. Chemopreventive effects of pterostilbene on urethane-induced lung carcinogenesis in mice via the inhibition of EGFR-mediated pathways and the induction of apoptosis and autophagy. J Agric Food Chem. 2012;60:11533–41. doi: 10.1021/jf302778a. [DOI] [PubMed] [Google Scholar]
- 269. Ashrafizadeh M, Ahmadi Z, Mohammadinejad R, Farkhondeh T, Samarghandian S. Curcumin activates the Nrf2 pathway and induces cellular protection against oxidative injury. Curr Mol Med. 2020;20:116–33. doi: 10.2174/1566524019666191016150757. [DOI] [PubMed] [Google Scholar]
- 270. Adeluola A, Zulfiker AHM, Brazeau D, Amin A. Perspectives for synthetic curcumins in chemoprevention and treatment of cancer: an update with promising analogues. Eur J Pharmacol. 2021;906:174266. doi: 10.1016/j.ejphar.2021.174266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 271. Ramezani M, Hatamipour M, Sahebkar A. Promising anti-tumor properties of bisdemethoxycurcumin: a naturally occurring curcumin analogue. J Cell Physiol. 2018;233:880–7. doi: 10.1002/jcp.25795. [DOI] [PubMed] [Google Scholar]
- 272. Devasena T, Menon Venugopal VP, Rajasekaran KN. Chemoprevention of colon cancer by a synthetic curcumin analog involves amelioration of oxidative stress. Toxicol Mech Methods. 2005;15:355–9. doi: 10.1080/15376520500195947. [DOI] [PubMed] [Google Scholar]
- 273. Shahcheraghi SH, Salemi F, Peirovi N, Ayatollahi J, Alam W, Khan H, et al. Nrf2 regulation by curcumin: molecular aspects for therapeutic prospects. Molecules. 2021:27. doi: 10.3390/molecules27010167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 274. Wang Y, Chang W, Li X, Jiang Z, Zhou D, Feng Y, et al. Apigenin exerts chemopreventive effects on lung injury induced by SiO(2) nanoparticles through the activation of Nrf2. J Nat Med. 2022;76:119–31. doi: 10.1007/s11418-021-01561-7. [DOI] [PubMed] [Google Scholar]
- 275. Paredes-Gonzalez X, Fuentes F, Su ZY, Kong AN. Apigenin reactivates Nrf2 anti-oxidative stress signaling in mouse skin epidermal JB6 P + cells through epigenetics modifications. AAPS J. 2014;16:727–35. doi: 10.1208/s12248-014-9613-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 276. Lin CY, Wu CR, Chang SW, Wang YJ, Wu JJ, Tsai CW. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway. Food Funct. 2015;6:1936–43. doi: 10.1039/c4fo01131g. [DOI] [PubMed] [Google Scholar]
- 277. Petiwala SM, Johnson JJ. Diterpenes from rosemary (Rosmarinus officinalis): defining their potential for anti-cancer activity. Cancer Lett. 2015;367:93–102. doi: 10.1016/j.canlet.2015.07.005. [DOI] [PubMed] [Google Scholar]
- 278. Zhong C, Lin Z, Ke L, Shi P, Li S, Huang L, et al. Recent research progress (2015–2021) and perspectives on the pharmacological effects and mechanisms of tanshinone IIA. Front Pharmacol. 2021;12:778847. doi: 10.3389/fphar.2021.778847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 279. Bi Z, Wang Y, Zhang W. A comprehensive review of tanshinone IIA and its derivatives in fibrosis treatment. Biomed Pharmacother. 2021;137:111404. doi: 10.1016/j.biopha.2021.111404. [DOI] [PubMed] [Google Scholar]
- 280. Tsai TH, Yu CH, Chang YP, Lin YT, Huang CJ, Kuo YH, et al. Protective effect of caffeic acid derivatives on tert-butyl hydroperoxide-induced oxidative hepato-toxicity and mitochondrial dysfunction in HepG2 cells. Molecules. 2017;22 doi: 10.3390/molecules22050702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 281. Kim SJ, Park C, Han AL, Youn MJ, Lee JH, Kim Y, et al. Ebselen attenuates cisplatin-induced ROS generation through Nrf2 activation in auditory cells. Hear Res. 2009;251:70–82. doi: 10.1016/j.heares.2009.03.003. [DOI] [PubMed] [Google Scholar]
- 282. Tan SM, Deliyanti D, Figgett WA, Talia DM, de Haan JB, Wilkinson-Berka JL. Ebselen by modulating oxidative stress improves hypoxia-induced macroglial Müller cell and vascular injury in the retina. Exp Eye Res. 2015;136:1–8. doi: 10.1016/j.exer.2015.04.015. [DOI] [PubMed] [Google Scholar]
- 283. Nakamura Y, Feng Q, Kumagai T, Torikai K, Ohigashi H, Osawa T, et al. Ebselen, a glutathione peroxidase mimetic seleno-organic compound, as a multifunctional antioxidant. Implication for inflammation-associated carcinogenesis. J Biol Chem. 2002;277:2687–94. doi: 10.1074/jbc.M109641200. [DOI] [PubMed] [Google Scholar]
- 284. Wu YX, Wang YY, Gao ZQ, Chen D, Liu G, Wan BB, et al. Ethyl ferulate protects against lipopolysaccharide-induced acute lung injury by activating AMPK/Nrf2 signaling pathway. Acta Pharmacol Sin. 2021;42:2069–81. doi: 10.1038/s41401-021-00742-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 285. Kaikini AA, Muke S, Peshattiwar V, Bagle S, Dighe V, Sathaye S. Ethyl ferulate, a lipophilic phenylpropanoid, prevents diabetes-associated renal injury in rats by amelioration of hyperglycemia-induced oxidative stress via activation of nuclear factor erythroid 2-related factor 2. J Food Biochem. 2021;45:e13607. doi: 10.1111/jfbc.13607. [DOI] [PubMed] [Google Scholar]
- 286. Pang M, Xie X, Zhang Y, Laster KV, Liu K, Kim DJ. Ethyl ferulate suppresses esophageal squamous cell carcinoma tumor growth through inhibiting the mTOR signaling pathway. Front Oncol. 2021;11:780011. doi: 10.3389/fonc.2021.780011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 287. Hayes JD, McMahon M. The double-edged sword of Nrf2: subversion of redox homeostasis during the evolution of cancer. Mol Cell. 2006;21:732–4. doi: 10.1016/j.molcel.2006.03.004. [DOI] [PubMed] [Google Scholar]
- 288. Wang XJ, Hayes JD, Wolf CR. Generation of a stable antioxidant response element-driven reporter gene cell line and its use to show redox-dependent activation of nrf2 by cancer chemotherapeutic agents. Cancer Res. 2006;66:10983–94. doi: 10.1158/0008-5472.CAN-06-2298. [DOI] [PubMed] [Google Scholar]
- 289. Cantor JR, Sabatini DM. Cancer cell metabolism: one hallmark, many faces. Cancer Discov. 2012;2:881–98. doi: 10.1158/2159-8290.CD-12-0345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 290. Bushweller JH. Targeting transcription factors in cancer - from undruggable to reality. Nat Rev Cancer. 2019;19:611–24. doi: 10.1038/s41568-019-0196-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 291. Ohnuma T, Anzai E, Suzuki Y, Shimoda M, Saito S, Nishiyama T, et al. Selective antagonization of activated Nrf2 and inhibition of cancer cell proliferation by procyanidins from Cinnamomi Cortex extract. Arch Biochem Biophys. 2015;585:17–24. doi: 10.1016/j.abb.2015.09.007. [DOI] [PubMed] [Google Scholar]
- 292. Ohnuma T, Matsumoto T, Itoi A, Kawana A, Nishiyama T, Ogura K, et al. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract. Biochem Biophys Res Commun. 2011;413:623–9. doi: 10.1016/j.bbrc.2011.09.014. [DOI] [PubMed] [Google Scholar]
- 293. Ohnuma T, Sakamoto K, Shinoda A, Takagi C, Ohno S, Nishiyama T, et al. Procyanidins from Cinnamomi Cortex promote proteasome-independent degradation of nuclear Nrf2 through phosphorylation of insulin-like growth factor-1 receptor in A549 cells. Arch Biochem Biophys. 2017;635:66–73. doi: 10.1016/j.abb.2017.10.007. [DOI] [PubMed] [Google Scholar]
- 294. Lee J, Kang JS, Nam LB, Yoo OK, Keum YS. Suppression of NRF2/ARE by convallatoxin sensitises A549 cells to 5-FU-mediated apoptosis. Free Radic Res. 2018;52:1416–23. doi: 10.1080/10715762.2018.1489132. [DOI] [PubMed] [Google Scholar]
- 295. Ouyang WC, Liao YW, Chen PN, Lu KH, Yu CC, Hsieh PL. Hinokitiol suppresses cancer stemness and oncogenicity in glioma stem cells by Nrf2 regulation. Cancer Chemother Pharmacol. 2017;80:411–9. doi: 10.1007/s00280-017-3381-y. [DOI] [PubMed] [Google Scholar]
- 296. Tsuchida K, Tsujita T, Hayashi M, Ojima A, Keleku-Lukwete N, Katsuoka F, et al. Halofuginone enhances the chemo-sensitivity of cancer cells by suppressing NRF2 accumulation. Free Rad Biol Med. 2017;103:236–47. doi: 10.1016/j.freeradbiomed.2016.12.041. [DOI] [PubMed] [Google Scholar]
- 297. Xiang Y, Ye W, Huang C, Yu D, Chen H, Deng T, et al. Brusatol enhances the chemotherapy efficacy of gemcitabine in pancreatic cancer via the Nrf2 signalling pathway. Oxid Med Cell Longev. 2018;2018:2360427. doi: 10.1155/2018/2360427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 298. Yang H, Liu BF, Xie FJ, Yang WL, Cao N. Luteolin induces mitochondrial apoptosis in HT29 cells by inhibiting the Nrf2/ARE signaling pathway. Exp Ther Med. 2020;19:2179–87. doi: 10.3892/etm.2020.8464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 299. Kang KA, Piao MJ, Hyun YJ, Zhen AX, Cho SJ, Ahn MJ, et al. Luteolin promotes apoptotic cell death via upregulation of Nrf2 expression by DNA demethylase and the interaction of Nrf2 with p53 in human colon cancer cells. Exp Mol Med. 2019;51:1–14. doi: 10.1038/s12276-019-0238-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 300. Matthews JH, Liang X, Paul VJ, Luesch H. A complementary chemical and genomic screening approach for druggable targets in the Nrf2 pathway and small molecule inhibitors to overcome cancer cell drug resistance. ACS Chem Biol. 2018;13:1189–99. doi: 10.1021/acschembio.7b01025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 301. Kim D, Choi BH, Ryoo IG, Kwak MK. High NRF2 level mediates cancer stem cell-like properties of aldehyde dehydrogenase (ALDH)-high ovarian cancer cells: inhibitory role of all-trans retinoic acid in ALDH/NRF2 signaling. Cell Death Dis. 2018;9:896. doi: 10.1038/s41419-018-0903-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 302. Choi EJ, Jung BJ, Lee SH, Yoo HS, Shin EA, Ko HJ, et al. A clinical drug library screen identifies clobetasol propionate as an NRF2 inhibitor with potential therapeutic efficacy in KEAP1 mutant lung cancer. Oncogene. 2017;36:5285–95. doi: 10.1038/onc.2017.153. [DOI] [PubMed] [Google Scholar]
- 303. Verma AK, Yadav A, Singh SV, Mishra P, Rath SK. Isoniazid induces apoptosis: role of oxidative stress and inhibition of nuclear translocation of nuclear factor (erythroidderived 2)-like 2 (Nrf2) Life Sci. 2018;199:23–33. doi: 10.1016/j.lfs.2018.02.037. [DOI] [PubMed] [Google Scholar]
- 304. Verma AK, Yadav A, Dewangan J, Singh SV, Mishra M, Singh PK, et al. Isoniazid prevents Nrf2 translocation by inhibiting ERK1 phosphorylation and induces oxidative stress and apoptosis. Redox Biol. 2015;6:80–92. doi: 10.1016/j.redox.2015.06.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 305. Bollong MJ, Yun H, Sherwood L, Woods AK, Lairson LL, Schultz PG. A small molecule inhibits deregulated NRF2 transcriptional activity in cancer. ACS Chem Biol. 2015;10:2193–8. doi: 10.1021/acschembio.5b00448. [DOI] [PubMed] [Google Scholar]
- 306. Singh A, Venkannagari S, Oh KH, Zhang YQ, Rohde JM, Liu L, et al. Small molecule inhibitor of NRF2 selectively intervenes therapeutic resistance in KEAP1-deficient NSCLC tumors. ACS Chem Biol. 2016;11:3214–25. doi: 10.1021/acschembio.6b00651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 307. Lee S, Lim MJ, Kim MH, Yu CH, Yun YS, Ahn J, et al. An effective strategy for increasing the radiosensitivity of Human lung Cancer cells by blocking Nrf2-dependent antioxidant responses. Free Rad Biol Med. 2012;53:807–16. doi: 10.1016/j.freeradbiomed.2012.05.038. [DOI] [PubMed] [Google Scholar]
- 308. Zhu J, Wang H, Chen F, Fu J, Xu Y, Hou Y, et al. An overview of chemical inhibitors of the Nrf2-ARE signaling pathway and their potential applications in cancer therapy. Free Rad Biol Med. 2016;99:544–56. doi: 10.1016/j.freeradbiomed.2016.09.010. [DOI] [PubMed] [Google Scholar]
- 309. Telkoparan-Akillilar P, Panieri E, Cevik D, Suzen S, Saso L. Therapeutic targeting of the NRF2 signaling pathway in cancer. Molecules. 2021:26. doi: 10.3390/molecules26051417. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.



