Abstract
Bioluminescence generated by luciferase and luciferin has been extensively used in biological research. However, detecting signals from deep tissues in vivo poses a challenge to traditional methods. To overcome this, the Akaluc and AkaLumine bioluminescent systems were developed, resulting in improved signal detection. We evaluate the potential of Akaluc/AkaLumine in Drosophila melanogaster to establish a highly sensitive, non-invasive, and temporal detection method for gene expression. Our results show that oral administration of AkaLumine to flies expressing Akaluc provided a higher luminescence signal than Luc/D-luciferin, with no observed harmful effects on flies. The Akaluc/AkaLumine system allows for monitoring of dynamic temporal changes in gene expression. Additionally, using the Akaluc fusion gene allows for mRNA splicing monitoring. Our findings indicate that the Akaluc/AkaLumine system is a powerful bioluminescence tool for analyzing gene expression in deep tissues and small numbers of cells in Drosophila.
Subject terms: Drosophila, Drosophila
In Drosophila melanogaster, the red-shifted bioluminescence system Akaluc/AkaLumine is useful for studying gene expression, cell numbers, and innate immunity levels in deep tissues without harming the individual.
Introduction
Bioluminescence is used as a reporter in a wide range of biological research, one of which is gene expression analysis1. Although quantitative real-time PCR (qPCR) is also used for gene expression analysis, this technique requires nucleic acid extraction from biological samples, such as cells and animals. Therefore, it is necessary to prepare multiple samples for temporal analysis. In contrast, the bioluminescence-based method is non-invasive because it analyzes gene expression from the luminescence produced by the reaction between luciferase and luciferin2. This characteristic enables relatively easy analysis of gene expression over time and in the same sample. Because of this advantage, bioluminescence-based gene expression analysis is used to monitor the temporal expression of circadian rhythm genes3 and screen drugs that affect the expression of specific genes4.
In general, bioluminescence-based methods use luciferases and luciferins derived from insects, such as firefly luciferase (Luc) and D-luciferin, or from marine organisms, such as Renilla luciferase (Rluc) and coelenterazine5. However, luciferases and luciferins exhibit several disadvantages in vivo. First, the wavelength of light produced by the reaction between luciferases and luciferins cannot easily penetrate animal tissues. The peak emission wavelength of Luc/D-luciferin is approximately 578 nm and that of Rluc/coelenterazine is approximately 482 nm, which is easily absorbed by hemoglobin5,6. As a result, signals from deep tissue in the body are attenuated. Second, the low tissue permeability of the substrate, D-luciferin, causes its heterogeneous distribution in vivo. In particular, the brain permeability is remarkably low7. To solve these problems, Akaluc and AkaLumine have been developed. AkaLumine is an artificially synthesized analog of D-luciferin8. In addition, AkaLumine-HCl was developed to improve water solubility9. The maximum emission wavelength produced by the reaction between Luc and AkaLumine-HCl is 677 nm in the near-infrared region, indicating high tissue permeability. Akaluc is an enzyme that was developed through directed evolution by introducing mutations in Luc to produce brighter luminescence in the reaction with AkaLumine10. Using Akaluc and AkaLumine-HCl, the detection of luminescent signals from deep tissues, particularly from the brain, in mice and marmosets has dramatically improved.
In Drosophila research, Firefly luciferase and D-luciferin are commonly used. The Drosophila head is about 1 mm thick and is not “deep” compared to the brains of mammals, but it is known that photons are absorbed or scattered by pigments in the eyes and cuticle of Drosophila11 (Supplementary Fig. 1). Therefore, the use of Akaluc/AkaLumine, which produces a signal with better tissue permeability than Luc/D-luciferin, would improve the analysis using bioluminescence in Drosophila.
In this study, we introduced Akaluc/AkaLumine into Drosophila melanogaster to establish a highly sensitive, non-invasive, and continuous gene expression analysis. We generated transgenic strains expressing Akaluc under the control of the GAL4/UAS system and knock-in strains expressing Akaluc from endogenous promoters. Using these strains, we investigated whether the Akaluc/AkaLumine system is superior to Luc/D-luciferin, which is widely used in Drosophila research, and whether this system can be used to perform non-invasive, continuous gene expression analysis in Drosophila. First, we examined the conditions and toxicity of oral administration of AkaLumine, a substrate of Akaluc, to Drosophila. Next, the luminescence levels of Akaluc/AkaLumine and Luc/D-luciferin were compared. The amount of signal detected in the nervous system was significantly higher with Akaluc/AkaLumine than with Luc/D-luciferin. Furthermore, we provided evidence that the Akaluc/AkaLumine system is useful for monitoring the temporal dynamics of genes of interest in vivo. We showed that Akaluc/AkaLumine can be used in Drosophila to perform temporal gene expression analyses with higher sensitivity than the traditional Luc/D-luciferin system.
Results
Oral administration of AkaLumine to Drosophila expressing Akaluc enables in vivo detection of luminescence signals with a high signal-to-noise ratio
Intravenous, intraperitoneal, and oral administration of AkaLumine has been tested in mice10. We administered AkaLumine orally for easy and intact substrate delivery to Drosophila. AkaLumine-HCl (AkaLumine) was used in all the experiments in this study. We added a single fly and food containing AkaLumine to each well of a 24-well plate and measured the luminescence (Fig. 1a). This method allows continuous luminescence measurements while feeding AkaLumine to freely moving flies. Flies expressing Akaluc ubiquitously showed significantly higher luminescence after oral administration of AkaLumine than the background signal exhibited by flies without AkaLumine (Fig. 1b). In addition, a negligible luminescent signal was detected when AkaLumine was administered to wild-type flies, indicating that AkaLumine is unlikely to produce luminescence by oxidation with the endogenous enzyme present in Drosophila. These results indicate that the oral administration of AkaLumine to Akaluc flies allows for luminescence detection with a high signal-to-noise ratio. Next, we determined the appropriate AkaLumine concentration for luminescence production by Drosophila. When flies ubiquitously expressing Akaluc (tubP-Gal4 > UAS-Venus-Akaluc) were administered AkaLumine, the luminescent signal increased with increasing AkaLumine concentrations (Fig. 1c). The luminescence peaked at ~1.0 mM of AkaLumine. We also investigated the temporal changes in the luminescence signals after AkaLumine administration or AkaLumine withdrawal. At concentrations of 0.5, 1.0, and 2.0 mM, the luminescent signal increased quickly and peaked at approximately 5 h after AkaLumine administration (Fig. 1d). We also found that the higher the concentration of AkaLumine administered, the slower the rate of luminescent signal decrease after stopping AkaLumine administration (time required for mean counts per second (cps) to fall below 6,000 after stopping AkaLumine administration, 0.1 mM: 2.6 h, 0.5 mM: 6.2 h, 1.0 mM: 8.8 h, 2.0 mM: 22.8 h). In addition, we compared the changes in luminescence levels of individual flies until 48 h after feeding 1.0 mM AkaLumine. We found no notable differences, and the signal was stable in all individuals (Supplementary Fig. 2). Taken together, these results indicate that the oral administration of AkaLumine at appropriate concentrations to Akaluc-expressing Drosophila enables highly sensitive in vivo detection of bioluminescence.
Fig. 1. Detection of Akaluc/AkaLumine bioluminescence by oral administration of AkaLumine in Drosophila.
a Schematic diagram of the luminescence measurements. Each well of the 24-well plate contained a single fly and food containing AkaLumine. The luminescence emitted from the fly freely moving in the well was measured by the upper and lower bioluminescence detectors. b Luminescence was detected by administering AkaLumine to flies expressing Akaluc. Akaluc flies (tubP-Gal4 > UAS-Venus-Akaluc) or wild-type flies (w1118) were used. In AkaLumine administration groups, flies were fed food with AkaLumine (1.0 mM) for 24 h prior to the start of luminescence measurements, and measurements were performed continuously for 24 h. The group not administered AkaLumine was fed a normal diet and measurements were taken. The graph shows the mean value of luminescence measured continuously for 24 h in each trial. The number of trials for each data set is shown on the graph. One-way ANOVA with Tukey-Kramer test was used for a statistical test. ****p < 0.0001, ns no significance. Error bars indicate s.e.m. c The examination of appropriate AkaLumine concentrations for in vivo monitoring of Akaluc/AkaLumine bioluminescence. Akaluc flies (tubP-Gal4 > UAS-Venus-Akaluc) were orally administered each concentration of AkaLumine 24 h prior to the start of luminescence measurements, and measurements were performed continuously for 24 h. The group with zero AkaLumine was fed normal food. The graph shows the mean value of luminescence measured continuously for 24 h in each trial. The number of trials for each data set is shown in the graph. Error bars indicate s.e.m. d The temporal changes of bioluminescence after the administration or withdrawal of AkaLumine food. Luminescence measurements were started as soon as AkaLumine was administered to Akaluc-expressing flies (red arrows). At 48 h after the start of measurements, the flies were transferred to wells with normal food without AkaLumine under cold anesthesia (blue arrows), and bioluminescence measurements were carried out for an additional 24 h. The darker colored line in each graph indicates the mean and the lighter colored line indicates the error bars (s.e.m). The number of trials for each graph is n = 6.
Oral administration of AkaLumine is not toxic to Drosophila
We investigated whether AkaLumine administration was detrimental to Drosophila survival. We fed AkaLumine (1.0 mM) to flies for 24 h and measured the expression levels of several stress-response genes. Glutathione S transferase D1 (GstD1) expression is upregulated by oxidative stress and aging12. Endoplasmic reticulum (ER) stress induces the expression of Bip, an ER chaperone13. Atg8a, a key component of autophagy, is upregulated under starvation stress14. Expression of the apoptosis activator head involution defective (Hid), is induced by cell death signals15. The expression levels of these genes were not affected by AkaLumine treatment (Fig. 2a, normalized by gapdh2 gene). Similar results were obtained when gene expression levels were normalized to the reference gene, actin 5c (Fig. 2b). These results indicate that the oral administration of AkaLumine does not cause detrimental stress in flies.
Fig. 2. The effects of AkaLumine administration on the stress response and developmental defects of Drosophila.
a, b Short-term oral administration of AkaLumine to flies did not induce oxidative stress, ER stress, starvation stress, or cell death responses. Gene expression in wild-type flies (w1118) fed with food containing AkaLumine (1.0 mM) for 24 h was measured by qPCR. As a control, food without AkaLumine was used. Expression levels were normalized using Gapdh2 (a) and Actin 5 C (b) as an internal control gene. An unpaired t-test was used for statistical analysis. ns: no significance, n = 5. Error bars indicate s.e.m. c, d Long-term administration of AkaLumine did not affect the development of flies. There was no significant difference in the pupation rate (c) and eclosion rate (d) when the wild-type flies (w1118) were raised from embryo to adult on fly food with or without AkaLumine. An unpaired t-test was used for statistical analysis. ns no significance, n = 6. Error bars indicate s.e.m.
We investigated the effects of long-term administration of AkaLumine. Fly eggs were placed on fly food containing AkaLumine (1.0 mM) and reared until adulthood. Rearing flies on AkaLumine food did not significantly affect pupariation or eclosion (Fig. 2c, d). These results indicate that long-term AkaLumine administration did not affect fly development. Together, these results suggest that oral administration of AkaLumine has little or no toxicity in Drosophila.
Akaluc/AkaLumine emits stronger bioluminescence signals from a small number of neurons than Luc/D-luciferin
In mammals, the use of Akaluc/AkaLumine dramatically increases the strength of signals from deep tissues in vivo compared with conventional Luc/D-luciferin10. We compared the luminescence signals of Akaluc/AkaLumine and Luc/D-luciferin in Drosophila. When we measured the luminescence level in flies ubiquitously expressing Luc (tubP-Gal4 > UAS-Luc), the luminescence level increased as the concentration of D-luciferin increased (Fig. 3a). At low substrate concentrations, the Akaluc/AkaLumine signal tended to be stronger than that of Luc/D-luciferin (Figs. 1c, 3a, Akaluc + 0.5 mM AkaLumine mean cps: 4.4 × 105 cps, Luc + 0.5 mM D-luciferin mean cps: 2.7 × 105 cps). In contrast, at high substrate concentrations, the Luc/D-luciferin signal was stronger than that of Akaluc/AkaLumine (Akaluc + 5.0 mM AkaLumine mean cps: 5.3 × 105 cps, Luc + 5.0 mM D-luciferin mean cps: 1.0 × 106 cps). These results suggest that the reaction between Akaluc and AkaLumine is more efficient and emits higher luminescence even at low AkaLumine concentrations; however, the luminescence of Luc/D-luciferin is stronger than that of Akaluc/AkaLumine when luciferase is expressed in the whole body.
Fig. 3. Bioluminescent signals generated from Akaluc/AkaLumine and Luc/D-luciferin in deep tissues and cells.
a Flies expressing Luc ubiquitously (tubP-Gal4 > UAS-Luc) were orally administered each concentration of D-luciferin 24 h before the start of bioluminescence measurement. All of the experiments in Fig. 3 were performed using the same method of substrate administration (AkaLumine or D-luciferin) and luminescence measurement. The group with zero D-luciferin was fed normal food. The graph shows the mean value of luminescence measured continuously for 24 h in each trial. The number of trials for each data set is shown in the graph. Error bars indicate s.e.m. b, c The bioluminescence of Akaluc/AkaLumine detected in the nervous system was stronger than that of Luc/D-luciferin. Flies expressing Akaluc or Luc by elav-Gal4 (b: elav-Gal4 > UAS-Venus-Akaluc and elav-Gal4 > UAS-Luc) and OK107-Gal4 (c: OK107-Gal4 > UAS-Venus-Akaluc and OK107-Gal4 > UAS-Luc) were administered each concentration of AkaLumine or D-luciferin, respectively. One-way ANOVA with Tukey–Kramer test was used for statistical analysis. *p < 0.05, **p < 0.01, ****p < 0.0001, ns no significance. The number of trials for each data set is shown in the graphs. Error bars indicate s.e.m. d The bioluminescence signal of Akaluc/AkaLumine detected in the Or42b ORN was higher than that of Luc/D-Luciferin. Flies expressing Akaluc or Luc by Or42b-Gal4 (Or42b-Gal4 > UAS-Venus-Akaluc and Or42b-Gal4 > UAS-Luc) were fed AkaLumine (1.0, 5.0, 10 mM) or D-luciferin (1.0, 5.0, 10 mM), respectively. One-way ANOVA with Tukey–Kramer test was used for statistical analysis, ****p < 0.0001. The number of trials for each data set is shown in the graphs. Error bars indicate s.e.m. e Flies expressing Akaluc by Or42b-Gal4 (Or42b-Gal4 > UAS-Venus-Akaluc) or Or85a-Gal4 (Or85a-Gal4 > UAS-Venus-Akaluc) were administered AkaLumine (1.0 mM) and the luminescence levels were compared. Flies expressing Luc by Or42b-Gal4 (Or42b-Gal4 > UAS-Luc) or Or85a-Gal4 (Or85a-Gal4 > UAS-Luc) were administered D-luciferin (5.0 mM) and the luminescence levels were compared. One-way ANOVA with Tukey–Kramer test was used for statistical analysis, ****p < 0.0001, ns: no significance, n = 12. Error bars indicate s.e.m.
We examined the luminescence signals of Akaluc/AkaLumine and Luc/D-luciferin in specific tissues. When the pan-neuronal driver elav-Gal4 was used to express Akaluc or Luc, the Akaluc/AkaLumine signal was significantly higher than that of Luc/D-luciferin at both low and high substrate concentrations (Fig. 3b). OK107-Gal4 is mainly expressed in the mushroom body which is composed of ~2500 Kenyon cells16. The Akaluc/AkaLumine signal was significantly stronger than that of Luc/D-luciferin when OK107-Gal4 was used to express Akaluc or Luc (Fig. 3c). Or42b is one of the olfactory receptors (Ors), and is expressed in about 50–90 olfactory receptor neurons (ORN)16. When luminescent signals from Or42b ORNs were detected, Akaluc/AkaLumine provided a stronger signal than Luc/D-luciferin (Fig. 3d). These results indicate that Akaluc/AkaLumine is useful for detecting luminescent signals from deep tissues, such as the nervous system, and a small number of cells, such as Or42b-expressing ORNs, in Drosophila.
Or85a is also an Or, and the number of ORNs expressing Or85a is ~20–5017. We compared the luminescence signals between flies expressing Akaluc in Or42b (Or42b-Gal4 > UAS-Venus-Akaluc) and Or85a (Or85a-Gal4 > UAS-Venus-Akaluc) ORNs and found that a higher signal was detected in flies expressing Akaluc in Or42b ORNs than in those expressing Or85a ORNs (Fig. 3e). However, when Luc/D-luciferin was used, the difference in Or42b and Or85a cell numbers could not be detected by luminescence. These results indicate that a small difference in cell number can be detected as a difference in the luminescence signal using Akaluc/AkaLumine.
Akaluc/AkaLumine enables bioluminescence imaging in the Drosophila brain
In mice and marmosets, the use of Akaluc/AkaLumine dramatically improves imaging based on luminescent signals, particularly in deep tissues10. We investigated whether Akaluc/AkaLumine could improve bioluminescence imaging in Drosophila. When Akaluc or Luc was ubiquitously expressed, Akaluc/AkaLumine was sufficient for imaging at lower concentrations than Luc/D-luciferin (Fig. 4a–c). Interestingly, Akaluc was successfully imaged in the brain and ventral nerve cords when expressed in the nervous system (Fig. 4d–f). In contrast, almost no signal was detected when Luc was used. These results imply that the signals detected in Luc-expressing flies by tubP-Gal4 are likely derived from body surface tissues and not from the nervous system. In addition, we tried to image the intestinal shape from Akaluc/AkaLumine signals using the intestine-specific Gal4 driver (mex1-Gal4 > UAS-Venus-Akaluc). We could not determine the shape of the gut from the signal, but we were able to image the signal from only the abdomen of Drosophila (Supplementary Fig. 3). These results suggest that Akaluc/AkaLumine is suitable for bioluminescence imaging in deep tissues in Drosophila, with spatial resolution at the level of body parts such as the head or abdomen.
Fig. 4. Akaluc/AkaLumine bioluminescence imaging in Drosophila.
a, b tubP-Gal4 > UAS-Luc (a) and tubP-Gal4 > UAS-Venus-Akaluc (b) flies are shown. D-luciferin (5.0 mM) or AkaLumine (1.0 mM) was administered for 24 h to Luc flies or Akaluc flies, respectively (lower flies). The control group was fed normal food (upper flies). Scale bar at the bottom right of each photo indicates 1 mm. c From the imaging results, the overall counts per second (cps) of Luc/D-luciferin and Akaluc/AkaLumine was compared. Unpaired t-test was used for statistical analysis. *p < 0.05, n = 5. Error bars indicate s.e.m. d, e elav-Gal4 > UAS-Luc (d) and elav-Gal4 > UAS-Venus-Akaluc (e) flies are shown. D-luciferin (5.0 mM) or AkaLumine (1.0 mM) was administered for 24 h to Luc flies or Akaluc flies, respectively (lower flies). The control group was fed normal food (upper flies). Scale bar at the bottom right of each photo indicates 1 mm. f From the imaging results, the overall cps of Luc/D-luciferin and Akaluc/AkaLumine was compared. Unpaired t-test was used for statistical analysis. ****p < 0.0001, n = 5. Error bars indicate s.e.m.
Akaluc/AkaLumine provides highly sensitive and temporal gene expression analysis
Since gene expression analysis using bioluminescence is a non-invasive method, it is relatively easy to perform continuous measurements using the same individual2. We investigated whether Akaluc/AkaLumine can be used to monitor gene expression non-invasively and temporally in Drosophila. For this purpose, we generated a Drosophila strain that expressed Akaluc in an expression-dependent manner on the innate immunity-related gene Induced by Infection (IBIN). In this strain, the Akaluc gene was knocked-in at the IBIN locus (IBINAkaluc-KI) (Fig. 5a). IBIN is an innate immune-related gene whose expression is greatly increased by infection with Gram-negative or Gram-positive bacteria and is involved in promoting bacterial resistance18. We expected that IBINAkaluc-KI flies would produce a luminescent signal upon infection, along with an increase in IBIN expression. As expected, we were able to monitor a large increase in luminescent signal in the E. coli DH5α-infected group compared to the DH5α-uninfected group (Fig. 5b). To further expand the utility of this innate immune monitoring system, we generated a transgenic IBINp-Venus-Akaluc strain expressing Akaluc under the control of a putative IBIN promoter region (319 bp between CG30109 and IBIN, Fig. 5a). When the IBINp-Venus-Akaluc strain was infected with DH5α, an increased luminescent signal was observed in a similar pattern to that of IBINAkaluc-KI (Fig. 5c). Next, we compared temporal changes in luminescent signals from IBINAkaluc-KI and IBINp-Venus-Akaluc strains with actual IBIN expression by qPCR. The qPCR results showed that IBIN expression decreased 24 h after infection (Fig. 5d), whereas the results using IBINAkaluc-KI or IBINp-Venus-Akaluc showed high luminescence levels for over 24 h (Fig. 5b, c). This was probably due to the slow degradation rate of Akaluc. Therefore, we generated flies with the PEST sequence connected to the Akaluc sequence (IBINp-Venus-Akaluc-PEST). PEST sequences are rich in proline (P), glutamate (E), serine (S), and threonine (T), which are found in proteins with short lifespans19,20. The addition of this PEST sequence to the Luciferase shortens the intracellular lifetime of the Luciferase protein and allows for monitoring with improved time resolution21. Using IBINp-Venus-Akaluc-PEST, we found that the luminescent signals increased with bacterial infection and decreased 24 h after infection, similar to the qPCR results (Fig. 5e). These results indicate that temporal gene expression analysis can be performed on the same individual in Drosophila using Akaluc/AkaLumine and that the addition of the PEST sequence to Akaluc successfully improved the time resolution.
Fig. 5. The monitoring the temporal expression changes of innate immunity-related gene, IBIN.
a Schematic diagram of IBINAkaluc-KI strain generation. The coding region and 3′ UTR of IBIN were replaced with Venus-Akaluc and the knock-in marker DsRed by homologous recombination using the CRISPR/Cas9 system. b, c, e IBINAkaluc-KI (b), IBINp-Venus-Akaluc (c), and IBINp-Venus-Akaluc-PEST (e) strains could monitor the increase of IBIN expression induced by bacterial infection. Bioluminescence measurements were started 24 h prior to infecting the flies with the bacteria (−24 h timepoint). The flies were infected with E. coli (DH5α) (magenta line, 0 h timepoint), and measurements were performed for another 24 h. The “uninfected group” was pricked by a needle without bacteria (black line). AkaLumine was administered to the flies 24 h before the luminescence measurements were started, and the flies were constantly fed AkaLumine during the measurements. The darker colored line indicates the mean and the lighter colored line indicates the error bars (s.e.m). The number of trials is shown in the graph. d Measurement of IBIN expression using qPCR. At time point 0 h, the “infected” flies were infected with DH5α (magenta) and the “uninfected” flies were pricked by a needle without bacteria (black). At the −0.5 h time point, real-time PCR was performed using intact flies before needle piercing (gray). RpL32 was used as an internal control. n = 5, error bars indicate s.e.m.
Fusion of Akaluc to endogenous protein may affect protein function
To monitor the endogenous levels of the protein of interest, we generated Akaluc knocked-in allele. The Bruchpilot (Brp) protein is localized in the active zone of the presynapse, and Brp protein levels are significantly increased by sleep deprivation22,23. We inserted Akaluc into the 3′-end of the brp gene to generate a brp-Akaluc strain (brpAkaluc-KI) which produces Brp-Akaluc fusion protein (Supplementary Fig. 4a). Using this brpAkaluc-KI strain, we investigated whether sleep-deprivation-induced Brp increases could be monitored. Unexpectedly, 24 h sleep deprivation could not increase Brp protein levels in the brpAkaluc-KI strain, which were detected by luminescence monitoring and Western blotting analysis (Supplementary Fig. 4b–e). On the other hand, when we used wild-type flies, we observed an increase in Brp protein levels with sleep deprivation, consistent with previous studies, indicating that sleep deprivation was successfully achieved with our technique (Supplementary Fig. 4f). These results suggest that the fusion of Akaluc may have affected the functions of Brp, such as transport and localization, and that this should be carefully considered when fusing Akaluc to the protein of interest.
Akaluc/AkaLumine to measure ER stress levels over time
We investigated the potential use of Akaluc/AkaLumine to monitor temporal changes in protein levels in vivo, we used X-box binding protein 1 (Xbp1), a transcription factor that acts in the Inositol-requiring enzyme 1 (Ire1) pathway, an unfolded protein response (UPR) signaling pathway. XBP1 shows no transcription factor activity under normal conditions. However, under ER stress, XBP1 becomes an active transcription factor through unconventional splicing induced by IRE1 and leads to the expression of UPR target genes24. Using this property of Xbp1, ER stress reporters expressing activated XBP1 fused with GFP under ER stress have been developed25,26. Similarly, we aimed to generate an ER stress reporter using the Akaluc/AkaLumine system. We generated an Xbp1-Akaluc strain (UAS-Xbp1-Venus-Akaluc) by linking Akaluc in-frame to the activated XBP1 protein generated by unconventional splicing (Fig. 6a). Heat shock causes protein misfolding and unfolding, and induces unconventional splicing of Xbp127,28. In flies ubiquitously expressing Xbp1-Akaluc (tubP-Gal4 > UAS-Xbp1-Venus-Akaluc), a significant increase in the bioluminescence signal due to heat shock was observed (Fig. 6b). We were also able to monitor the rapid decrease in activated XBP1 expression after stopping the heat shock by measuring the luminescent signal over time (Fig. 6c). To investigate whether Xbp1 unconventional splicing could be detected in deep tissues, we expressed Xbp1-Akaluc in the pan-neurons (elav-Gal4 > UAS-Xbp1-Venus-Akaluc). As a result, we were also able to monitor the significant increase in the luminescent signal by heat shock and the recovery process from post-heat shock to the steady state (Fig. 6d, e). In summary, Xbp1-Akaluc can be used to monitor temporal changes in ER stress levels in specific tissues of a single fly.
Fig. 6. The monitoring of the temporal changes in ER stress induced by heat shock using Xbp1-Akaluc.
a Schematic diagram indicating the unconventional splicing of Xbp1-Venus-Akaluc transcript. Under the ER stress condition, a frameshift was induced by unconventional splicing, resulting in the loss of the stop codon. Thus, the transcription factor XBP1(s) fused with Venus-Akaluc is generated (left). Under normal conditions (no stress), translation is terminated in the middle of Xbp1 transcript by a stop codon. Thus, the following sequences including Venus-Akaluc are not translated. This produces only XBP1(u), which has no activity as a transcription factor (right). b–e Heat shock-induced changes in the expression of activated XBP1 in the whole body and nervous system could be monitored by Xbp1-Akaluc. tubP-Gal4 > UAS-Xbp1-Venus-Akaluc (b, c) and elav-Gal4 > UAS-Xbp1-Venus-Akaluc (d, e) were exposed to a 1 h heat shock at 37 °C and continuous luminescence measurements were performed for 5 h. Flies were administered AkaLumine (1.0 mM) for 24 h prior to heat shock and continued to be administered during heat shock and luminescence measurements. b and d compare the amount of luminescence of the same flies before and immediately after heat shock. The dotted lines on the (c) and (e) indicate the half-life of each signal (~20–30 min). The darker colored lines in c and e indicate the mean and the lighter colored lines indicate the error bars (s.e.m). Unpaired t-test was used for statistical analysis, ****p < 0.0001, n = 24.
Discussion
In this study, we introduced Akaluc/AkaLumine into Drosophila and demonstrated its usefulness for gene and protein expression analyses. After orally administering AkaLumine to Akaluc-expressing flies, we detected luminescence with a high signal-to-noise ratio (Fig. 1). Short- or long-term administration of AkaLumine to Drosophila had no detrimental effects on the flies (Fig. 2). We found that the signal intensity was significantly higher with Akaluc/AkaLumine than with Luc/D-luciferin when the signal was detected in deep tissues, such as the nervous system, or in a small number of cells, such as olfactory receptor neurons (Fig. 3). Akaluc/AkaLumine was also superior to Luc/D-luciferin in the bioluminescence imaging of deep tissues in Drosophila (Fig. 4). We also succeeded in monitoring the changes in the expression of IBIN, which was greatly increased by bacterial infection (Fig. 5). Using Drosophila expressing Akaluc-fused XBP1, we were able to monitor changes in ER stress under heat stress condition (Fig. 6). These results suggest that Akaluc/AkaLumine is a powerful tool for gene and protein expression analysis in Drosophila, especially for temporal and non-invasive analysis of deep tissues and a small number of cells.
When Akaluc was expressed using tubP-Gal4, the signal peaked at 1.0 mM AkaLumine (Fig. 1c). In contrast, when Luc was expressed by tubP-Gal4, the signal peaked at 5.0 mM D-luciferin (Fig. 3a). This may be attributed to the higher affinity between the enzyme and the substrate for Akaluc/AkaLumine than for Luc/D-luciferin. In fact, it has been reported that the affinity of AkaLumine for Luc is significantly higher than that of Luciferin9. Therefore, Akaluc/AkaLumine was expected to reach peak signals at lower substrate concentrations than Luc/D-luciferin. However, the required AkaLumine concentration may be higher when Akaluc is expressed in specific tissues or cell types. In addition, an inhibitory by-product of the Luc/D-luciferin reaction is generated when an excessive concentration of the substrate is administered29. It is unclear whether the same phenomenon occurs during the Akaluc/AkaLumine reaction. Therefore, the concentration of AkaLumine administered to flies should be carefully considered, depending on the tissue in which Akaluc is expressed.
To measure luminescent signals simply and non-invasively, we orally administered AkaLumine to Drosophila by mixing it with fly food. Thus, AkaLumine intake depends on the feeding behavior of the flies, which might be a disadvantage of this method. Therefore, it may be difficult to apply the methods of this study to pupae that are not fed or to experiments that require fasting. A study in mice reported that luminescence was higher when AkaLumine was administered intraperitoneally than when it was administered orally10. If oral administration is experimentally difficult or does not provide a sufficient signal, intraperitoneal administration may solve these problems. Nevertheless, our results showed that, in many cases, oral administration of AkaLumine is sufficient to detect the signal over time in intact flies.
Using strains expressing Akaluc under the control of the IBIN promoter, we monitored temporal changes in IBIN expression during bacterial infection. However, the qPCR results showed a decrease in IBIN expression 24 h after E. coli infection, whereas IBIN-Akaluc maintained its luminescence signals 24 h after infection (Fig. 5b–d). This time difference between the actual gene expression and the luminescent signal was caused by the slow degradation speed of the Akaluc protein. In fact, the half-life of Akaluc protein in cultured human cells has been reported to be ~9 h10. To improve the resolution of temporal gene expression analysis, we added the PEST sequence to the Akaluc protein to shorten its degradation speed. Using IBINp-Akaluc-PEST, we were able to monitor the temporal changes in IBIN expression, which were more similar to the results obtained by qPCR (Fig. 5e). Therefore, Akaluc-PEST is particularly useful for monitoring genes with rapidly increasing or decreasing expression.
In HeLa cells, it has been reported that heat shock increases the number of unfolded proteins, which are rapidly reduced after heat shock is stopped27. A similar phenomenon was observed using Xbp1-Akaluc strain. Heat shock remarkably increased the signal of Xbp1-Akaluc. The luminescence level quickly decreased to the basal level after the heat shock was stopped (signal half-life was ~20–30 min, Fig. 6c). The half-life of Akaluc is ~9 h10, whereas that of XBP1 is much shorter (<30 min)30,31. The rapid decrease in the luminescence signal from the Xbp1-Akaluc strain after heat shock suggests that the Xbp1-Akaluc fusion protein likely reflects the endogenous degradation rate of XBP1. Furthermore, we monitored the increased expression of activated XBP1 in the nervous system induced by heat shock (Fig. 6d, e). Thus, Xbp1-Akaluc is a useful tool for temporal monitoring of ER stress in Drosophila.
Our results show that Akaluc/AkaLumine is particularly useful for analysis in deep tissues such as nervous system and in a small number of cells, with up to about 5-fold greater signal than Luc/D-luciferin, which is commonly used in Drosophila studies (Fig. 3b; Akaluc + 1.0 mM AkaLumine vs. Luc + 1.0 mM D-luciferin), and similar results have been shown in mice and marmosets10,32. It has been reported that Luc/D-luciferin can produce a stronger signal than Akaluc/AkaLumine by increasing the substrate concentration administered33. Consistent with this, in Drosophila, Luc/D-luciferin showed a stronger signal than Akaluc/AkaLumine under high substrate concentration conditions when tubP-Gal4 was used (Figs. 1c and 3a). On the other hand, Akaluc/AkaLumine showed significantly stronger signal than Luc/D-luciferin in detecting luminescence from deep tissues in Drosophila (Fig. 3b, c). When using Or42b-Gal4, the Akaluc/AkaLumine signal was superior to that of Luc/D-luciferin even under the high concentration of 10 mM substrate conditions, although the Luc/D-luciferin signal did not seem to peak even at 10 mM D-luciferin (Fig. 3d). Problems have also been reported with the administration of AkaLumine-HCl. The first is that administration of AkaLumine-HCl generates non-specific signals. A significantly higher non-specific signal was detected with AkaLumine-HCl administration than with D-luciferin, even in naïve mice33. In contrast, no non-specific signal was detected when AkaLumine-HCl was administered to wild-type Drosophila (Fig. 1b). The second problem is the toxicity of AkaLumine-HCl. AkaLumine-HCl administration has been reported to be toxic to the skin and heart, possibly due to the acidity of its solution33,34. We used a method of mixing AkaLumine-HCl with fly food for administering it orally and observed no noticeable toxicity in both short- and long-term administration (Fig. 2). However, it should be noted that we have not completely ruled out the possibility that further long-term administration may have adverse effects on flies. In fact, it has been reported that the pH in the food fed to flies affects the lifespan and other aspects of the flies35. In summary, the problems with Akaluc/AkaLumine shown in mammalian studies are generally not a problem in Drosophila, which further emphasizes the usefulness of Akaluc/AkaLumine in Drosophila research.
In our experiments, the Akaluc fusion protein was found to be a non-negligible limitation of Akaluc/AkaLumine utilization in Drosophila. Experiments with brpAkaluc-KI flies did not show an increase in Brp levels due to sleep deprivation as reported in previous studies22 (Supplementary Fig. 4b–e). This failure to increase Brp levels is most likely due to the fusion of Akaluc to Brp, and the fusion of Akaluc may affect Brp translation, transport, localization, and degradation. The sequence of Akaluc is more than twice that of GFP (Akaluc: 1,653 bp), and the fusion of this relatively large molecule may cause the adverse effects described above. Therefore, although our experiments with Xbp1-Akaluc showed similar results to previous reports, it should be noted that the effects of Akaluc fusion on splicing, translation, etc. of xbp1 cannot be completely ruled out.
NanoLuc is a luciferase derived from deep-sea shrimp, has a smaller molecular weight than firefly luciferase, and NanoLuc/furimazine releases 100 times more luminescence than Fluc/D-luciferin36. Due to its small molecular weight, NanoLuc may be able to solve the above problems of Akaluc fusion to proteins. Although we did not compare the NanoLuc-based luminescence system with Akaluc/AkaLumine in this study, it is possible that Akaluc/AkaLumine is superior in detecting signals from deep tissue because NanoLuc/furimazine emits at a blue wavelength. However, in recent years, many new furimazine analogs with red-shifted emission wavelengths or with enhanced aqueous solubility have been developed, and evaluation of these furimazine analogs and NanoLuc-based systems is being conducted vigorously in mice37–39. Advances in comparison and evaluation of Akaluc/AkaLumine and NanoLuc-based systems in Drosophila will improve bioluminescence-based analysis in Drosophila.
Overall, Akaluc/AkaLumine is a much more powerful tool for gene and protein expression analysis in deep tissues and small numbers of cells in Drosophila than the conventional method Luc/D-luciferin. In addition, Akaluc/AkaLumine can be used to monitor flies non-invasively. Therefore, it is possible to measure flies under free-moving conditions and perform continuous analyses using the same individuals. Akaluc/AkaLumine enables the analysis of in vivo phenomena that are difficult using conventional methods.
Materials and methods
Drosophila stock and culturing condition
The following fly strains were used: w1118, tubP-Gal4, elav-Gal4, OK107-Gal4, Or42b-Gal4, Or85a-Gal4, mex1-Gal4, and UAS-Luc (Bloomington Stock Center, Indiana University, USA), UAS-Venus-Akaluc, UAS-Xbp1-Venus-Akaluc, brpAkaluc-KI, IBINAkaluc-KI, IBINp-Venus-Akaluc, and IBINp-Venus-Akaluc-PEST (this study). In Supplementary Fig. 1, strip-myc flies were used40. These flies were reared on normal fly food and in a 25 °C, 60% humidity, 12 h light and 12 h dark incubator. Adult females (3–5 days old) were used for all experiments and measurements, except those shown in Supplementary Figs. 1 and 4.
Preparation of gene constructs and generation of fly strains
To prepare the UAS-Venus-Akaluc construct, the sequence of Venus-Akaluc was amplified by PCR using pcDNA3 Venus-Akaluc (RIKEN DNA BANK, RDB_15781) as a template and inserted into the pUAST-attB vector digested with EcoR I and Xho I using Ligation high Ver.2 (TOYOBO, Osaka, Japan).
To generate the IBINAkaluc-KI strain, sense and antisense oligos were designed using flyCRISPR to prepare gRNA expression vectors. The annealed oligo sets were inserted into U6b plasmid digested by Bbs I using Ligation high Ver.2. The following primers were used: sense, CTTCGGTATCCTCCCCAGTCCTCG; antisense, AAACCGAGGACTGGGGAGGATACC (gRNA target-1); sense, CTTCGATCACGAAACTCAACCCAC; and antisense, AAACGTGGGTTGAGTTTCGTGATC (gRNA target-2).
The donor plasmid for IBINAkaluc-KI generation was constructed in two steps. First, a 1 kbp upstream sequence of IBIN containing the 5′ UTR was amplified by PCR from Drosophila genomic DNA (5′ homology arm (HA)), and the Venus-Akaluc-SV40 late terminator sequence was amplified by PCR from the UAS-Venus-Akaluc plasmid. These two fragments were inserted into the Not I-digested pHD-DsRed-attP plasmid using the NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs, Ipswich, MA, USA)(5′ HA-Venus-Akaluc-DsRed). Next, 1 kbp downstream of the 3′ UTR of IBIN was amplified by PCR from Drosophila genomic DNA, and this fragment was inserted into Spe I-digested 5′ HA-Venus-Akaluc-DsRed using NEBuilder.
In the preparation of the IBINp-Venus-Akaluc construct, a 319 bp region between IBIN and a gene 5′ upstream (CG30109) was amplified from fly genomic DNA as the promoter of IBIN. The UAS sequence was removed from the UAS-Venus-Akaluc plasmid using Hind III and EcoR I, and the IBIN promoter fragment was inserted into the cut vector using NEBuilder.
To prepare the IBINp-Venus-Akaluc-PEST construct, the sequences of Venus-Akaluc were amplified by PCR except for the stop codon at the Akaluc 3′ end from UAS-Venus-Akaluc plasmid. Next, the Venus-Akaluc sequence of IBINp-Venus-Akaluc was cleaved with EcoR I and Not I, and the PCR-amplified Venus- Akaluc and artificially synthesized PEST sequences were introduced using NEBuilder.
To generate the brpAkaluc-KI strain, sense, and antisense oligos were designed using flyCRISPR to prepare gRNA expression vectors. The annealed oligo sets were inserted into U6b plasmid digested with Bbs I using Ligation high Ver.2. The following oligo sets were used: sense, CTTCGCAATTGGTACAAATGTCGC and antisense, AAACGCGACATTTGTACCAATTGC (gRNA target-1); sense, CTTCGACAGAAGGACTCTCGAGTT, and antisense, AAACAACTCGAGAGTCCTTCTGTC (gRNA target-2).
To construct the donor plasmid to generate the brpAkaluc-KI strain, first, a portion of approximately 2.8 kbp of Brp sequence (2 R:9536078..9538942) was amplified by PCR from Drosophila genomic DNA and inserted into the EcoR I-digested pUC19 vector. To prevent re-cleavage by Cas9, mutations were introduced into the PAM of the target sequences of the two gRNAs of this Brp sequence. Next, the PCR-amplified Akaluc fragment from the UAS-Venus-Akaluc plasmid was introduced into the Aar I-digested pHD-ScarlessDsRed plasmid. From this plasmid, the Akaluc-DsRed fragment was PCR-amplified and then constructed using NEBuilder with linearly stranded pUC19-Brp, which was PCR-amplified, excluding the stop codon of Brp.
To generate the UAS-Xbp1-Venus-Akaluc construct, fragments of 5′ UTR-Xbp1, Venus-Akaluc and 3′ UTR (Xbp1) were inserted into the pUAST-attB vector. The 5′ UTR-Xbp1 fragment was amplified by PCR from UAS-Xbp1-EGFP fragment as a template which was PCR amplified from UAS-Xbp1-EGFP (HG indicator)26 fly genomic DNA. The Venus-Akaluc fragment was amplified by PCR from UAS-Venus-Akaluc plasmid. The 3′ UTR fragment of Xbp1 was amplified from the pUAST-Xbp1-EGFP (HG indicator) plasmid. These three fragments were inserted into EcoR I-digested pUAST-attB vector using NEBuilder.
Gene constructs were injected into Drosophila embryos by BestGene Inc. (Chino Hills, CA, USA) and GenetiVision Corporation (Houston, TX, USA).
AkaLumine and D-luciferin stocks
AkaLumine-HCl (FUJIFILM) was diluted to 60 mM in PBS and stored at −80 °C under light shielding. D-luciferin (FUJIFILM) was diluted to 100 mM in PBS and stored at −80 °C, shielded from light.
Luminescence measurement
To feed AkaLumine or D-luciferin to flies, normal fly food was heated and melted, and stock solutions of AkaLumine or D-luciferin were added to achieve the target concentration and administered orally. One female was placed in each well of a 24-well plate (PerkinElmer, Waltham, MA, USA) and covered with a gas-permeable seal (NIPPON Genetics, Tokyo, Japan). Fly food containing the substrate was added to the wall of the well so that the flies could ingest the substrate during measurements. Luminescence was measured using a highly sensitive bioluminescence measuring device (CHURITSU, Japan, CL-24W) at each predetermined time. Luminescence measurements using this device counted all the wavelengths that could be detected. To stop substrate administration, the flies were incubated on ice for 5 min and then transferred to a plate containing normal fly food. In all luminescence measurements, except in Fig. 4, the photometric time was 1 s, and the photons were counted using the top and bottom detectors.
Gene expression analysis using real-time PCR
In Fig. 2a, b, total RNA was extracted from 10 flies (w1118) administered AkaLumine (1.0 mM) for 24 h. In Fig. 5d, the dorsal thorax of IBINp-Venus-Akaluc virgin females was pierced with a glass needle tipped with E. coli (DH5α), and flies were collected to extract total RNA immediately after piercing, 1, 2, 8, 12, 18, and 24 h after piercing. The uninfected group was pierced with a glass needle without E. coli and samples were collected simultaneously. Flies were collected 0.5 h before they were pierced with the glass needle for total RNA extraction (not pierced with the glass needle). At each time point, total RNA was extracted from five flies.
After each sample was frozen in liquid nitrogen, total RNA was extracted by homogenization in TRIzol™ Reagent (Thermo Fisher Scientific, Waltham, MA, USA) using a BioMasher™ II (Nippi, Japan). A PrimeScriptTM RT reagent kit with gDNA Eraser (TaKaRa Bio, Kusatsu, Shiga, Japan) was used to remove genomic DNA and synthesize cDNA from total RNA (500 ng). For Real-time PCR, Luna Universal qPCR Master Mix (New England BioLabs) and CFX Connect (BIORAD, Hercules, CA, USA) were used. To calculate the relative expression levels of each gene, we used Gapdh2 (Fig. 2a), Actin 5 C (Fig. 2b), and RpL32 (Fig. 5d) as internal controls. Real-time PCR was performed using the following primers:
Gapdh2: 5′-CCCATAGAAAGCGCTCAAAA-3′ and 5′-CCAATCTTCGACATGGTTAACTT-3′,
Actin 5 C: 5′-TCCAGTCATTCCTTTCAAACC-3′ and 5′-CAGCAACTTCTTCGTCACACA-3′,
GstD1: 5′-GAGTTCCTGAACACCTTCCTG-3′ and 5′-ATTGGCGTACTTGCTGATCTC-3′,
Bip: 5′-GCTATTGCCTACGGTCTGGA-3′ and 5′-CATCACACGCTGATCGAAGT-3′,
Atg8a: 5′-TTCATTGCAATCATGAAGTTCC-3′ and 5′-GGGAGCCTTCTCGACGAT-3′,
Hid: 5′-TCGACCTCCACGCCGTTATC-3′ and 5′-CCTCATGATCGCTCTGGTACTC-3′,
RpL32: 5′-GGTTACGGATCGAACAAGCG-3′ and 5′- TTCTGCATGAGCAGGACCTC-3′,
IBIN: 5′- CAACTGCTGCCAATCCTCG-3′ and 5′- GCCTGGGATCGTAGTCACTT-3′.
Investigation of the effects of AkaLumine administration on Drosophila development
Eighty w1118 females and twenty males were placed in empty bottles covered with a grape juice plate. The bottles were inverted (so that the grape juice plate was on the bottom) and allowed the flies to lay eggs for 2 h in a 25 °C incubator. To prepare the grape juice plate, grape juice (45 ml), distilled water (27 ml), glucose (4.3 g), sucrose (2.1 g), Agar (1.6 g), and 5 N NaOH (600 µl) were mixed and autoclaved. Phosphoric acid (32 µl) and propionic acid (320 µl) were added to this mixture and dispensed into 35 mm Petri dishes. Eggs were gently picked using a platinum loop, 20 eggs were placed on fly food containing AkaLumine (1.0 mM) and control fly food. For the control fly food, an equal volume of PBS was added instead of AkaLumine. Fly eggs were developed in a 25 °C, 60% humidity, 12 h light and 12 h dark incubator, and the number of flies that eventually became pupae and adults was counted.
Bioluminescence imaging
Akaluc flies were administered AkaLumine (1.0 mM), and Luc flies were administered D-luciferin (5.0 mM) for 24 h before luminescence measurements were taken. The control group was fed food without substrate. These flies were attached with glue to 40 mm diameter plastic petri dishes (upper side: control group, lower side: substrate-treated group). A NightOWL II LB983 (BERTHOLD, Bad Wildbad, Germany) and IndiGo2 software were used for bioluminescence imaging and image processing. Luminescence measurements were taken under conditions of 20 s exposure time and measurement wavelengths of 650 nm for Akaluc flies and 570 nm for Luc flies. The same luminescence count pixel range was used for tubP-Gal4 > UAS-Venus-Akaluc and tubP-Gal4 > UAS-Luc image processing and elav-Gal4 > UAS-Venus-Akaluc and elav-Gal4 > UAS-Luc image processing.
Luminescence measurements using bacteria-infected flies
Female virgin flies were used to prevent bacterial infections caused by mating. IBINAkaluc-KI, IBINp-Venus-Akaluc, and IBINp-Venus-Akaluc-PEST were administered AkaLumine (1.0 mM) prior to the start of luminescence measurements and were measured for 24 h while being fed AkaLumine. The flies were then collected from the plate under cold anesthesia and the dorsal thorax was pierced with a glass needle tipped with E. coli (DH5α) under CO2 anesthesia. The uninfected group was pierced in the same manner using a glass needle without E. coli. The flies were returned to the plate, and luminescence was measured again for 24 h. Only the data from flies that were still alive after the end of the measurements were used for analysis.
Sleep deprivation
brpAkaluc-KI flies were collected in vials containing food with AkaLumine (1.0 mM). The sleep deprivation group was deprived of sleep for 24 h by vibrating the vials at random times at a rate of 5 s min−1 using a vortex mixer. The control group was fed AkaLumine without sleep deprivation. These flies were then transferred to a 24-well plate and luminescence measurements were performed for 6 h while administering AkaLumine (1.0 mM).
Western blotting
Adult fly brains were dissected in 1x PBS. 7–10 dissected brains were homogenized in 50 µl 1x PBS and sonicated after addition of 50 µl 2x Sample buffer (2%SDS、80 mM Tris-HCl pH6.8、15 % glycerol、0.0025 % Brilliant Blue FCF) followed by centrifugation (12,000 × g for 10 min at 4 °C). The supernatant was boiled for 3 min after addition of DTT the final concentration of which is 40 mM and loaded into 5% SDS-PAGE followed by immunoblot. The following primary antibodies were used: nc82 (mouse anti-BRP, Developmental Studies Hybridoma Bank, 1:1000), and DM1A (mouse anti-alpha-tubulin, Cedarlane Laboratories Ltd, CLT9002, 1:1000). Peroxidase AffiniPure Donkey Anti-Mouse IgG (Jackson ImmunoResearch, 715-035-151, 1:5000) was used as the secondary antibody. Pierce™ ECL Plus Western Blotting Substrate (thermos scientific, 32132) was used for the signal detection. Band intensities were quantified with ImageLab.
Heat shock
Flies administered AkaLumine (1.0 mM) for 24 h were placed in a 37 °C incubator and heat shocked for 1 h. Flies were allowed to ingest AkaLumine (1.0 mM) food during heat shock. Luminescence measurements were started immediately after the heat shock. Measurements were performed for 5 h while AkaLumine (1.0 mM) was administered to the flies.
Statistics and reproducibility
Prism9 software (GraphPad) was used to analyze the data. Data are shown as means ± s.e.m (error bars). Statistical tests, statistical significance, and number of trials are described in the legends of each graph. Luminescence measurement and imaging experiments were performed at least twice to make sure that similar results could be reproduced. Experiments for real-time PCR, Brp experiments and measurement of pupariation and eclosion rates were performed once. Statistical significance was set at p < 0.05.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Supplementary information
Acknowledgements
We are grateful to RIKEN DNA BANK for pcDNA3 Venus-Akaluc and Dr. Hyung Don Ryoo (NYU Grossman School of Medicine, New York, USA) for UAS-Xbp1-EGFP. HG plasmid and fly strains, and the Bloomington Drosophila Stock Center for the fly stocks used in this study. We are also grateful to Prof. Masaki Mizunuma (Hiroshima University, Hiroshima, Japan) for the research discussions, and Ms. Satoko Okazaki and Ms. Miwako Kitamura for their technical support. We thank Chihara Laboratory members for their helpful discussions. We would like to thank Editage (www.editage.com) for English language editing. This work was supported by the Frontier Development Program for Genome Editing, Astellas Foundation for Research on Metabolic Disorders, Naito Foundation, Takeda Science Foundation, JSPS KAKENHI (JP21H02479 and JP21K18236) to T.C., JSPS KAKENHI (JP20K15903) to M.O., and a JSPS Research Fellowship (JP21J22346) to A.I.
Author contributions
A.I. and T.C. conceived the study. A.I. performed all experiments except the IBINp-Venus-Akaluc-related and brp-related experiments. N.M. constructed IBINp-Venus-Akaluc plasmid and performed the related experiments. Y.U. constructed brpAkaluc-KI plasmid and performed the related experiments. T.C. and M.O. supervised the study. The manuscript was written by A.I. and T.C., with input from all authors.
Peer review
Peer review information
Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Chao Zhou and Christina Karlsson-Rosenthal. A peer review file is available.
Data availability
Numerical source data supporting the results of this study are provided as ‘Supplementary Data 1’. The Akaluc transgenic flies are available through the KYOTO Drosophila Stock Center. The plasmid vectors prepared in this study can also be provided via the RIKEN BRC DNA BANK.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
The online version contains supplementary material available at 10.1038/s42003-023-05628-x.
References
- 1.Inouye S. Firefly luciferase: an adenylate-forming enzyme for multicatalytic functions. Cell. Mol. Life Sci. 2010;67:387–404. doi: 10.1007/s00018-009-0170-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Contag CH, Bachmann MH. Advances in in vivo bioluminescence imaging of gene expression. Annu. Rev. Biomed. Eng. 2002;4:235–260. doi: 10.1146/annurev.bioeng.4.111901.093336. [DOI] [PubMed] [Google Scholar]
- 3.Yoo S-H, et al. PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues. Proc. Natl Acad. Sci. USA. 2004;101:5339–5346. doi: 10.1073/pnas.0308709101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kanno S, et al. Luciferase assay system to monitor fibroblast growth factor signal disruption in human iPSCs. STAR Protoc. 2022;3:101439. doi: 10.1016/j.xpro.2022.101439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Liu S, Su Y, Lin MZ, Ronald JA. Brightening up biology: advances in luciferase systems for in vivo imaging. ACS Chem. Biol. 2021;16:2707–2718. doi: 10.1021/acschembio.1c00549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Weissleder R, Ntziachristos V. Shedding light onto live molecular targets. Nat. Med. 2003;9:123–128. doi: 10.1038/nm0103-123. [DOI] [PubMed] [Google Scholar]
- 7.Lee K-H, et al. Cell uptake and tissue distribution of radioiodine labelled D-luciferin: implications for luciferase based gene imaging. Nucl. Med. Commun. 2003;24:1003–1009. doi: 10.1097/00006231-200309000-00009. [DOI] [PubMed] [Google Scholar]
- 8.Iwano S, et al. Development of simple firefly luciferin analogs emitting blue, green, red, and near-infrared biological window light. Tetrahedron. 2013;69:3847–3856. doi: 10.1016/j.tet.2013.03.050. [DOI] [Google Scholar]
- 9.Kuchimaru T, et al. A luciferin analogue generating near-infrared bioluminescence achieves highly sensitive deep-tissue imaging. Nat. Commun. 2016;7:11856. doi: 10.1038/ncomms11856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Iwano S, et al. Single-cell bioluminescence imaging of deep tissue in freely moving animals. Science (1979) 2018;359:935–939. doi: 10.1126/science.aaq1067. [DOI] [PubMed] [Google Scholar]
- 11.Pende M, et al. High-resolution ultramicroscopy of the developing and adult nervous system in optically cleared Drosophila melanogaster. Nat. Commun. 2018;9:4731. doi: 10.1038/s41467-018-07192-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Landis G, Shen J, Tower J. Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster. Aging. 2012;4:768–789. doi: 10.18632/aging.100499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ham H, et al. Unfolded protein response-regulated Drosophila Fic (dFic) protein reversibly AMPylates BiP chaperone during endoplasmic reticulum homeostasis. J. Biol. Chem. 2014;289:36059–36069. doi: 10.1074/jbc.M114.612515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bali A, Shravage BV. Characterization of the autophagy related gene-8a (Atg8a) promoter in Drosophila melanogaster. Int. J. Dev. Biol. 2017;61:551–555. doi: 10.1387/ijdb.170077bs. [DOI] [PubMed] [Google Scholar]
- 15.Bergmann A, Agapite J, Mccall K, Steller H. The drosophila gene hid is a direct molecular target of ras-dependent survival signaling. Cell. 1998;95:331–341. doi: 10.1016/S0092-8674(00)81765-1. [DOI] [PubMed] [Google Scholar]
- 16.Heisenberg M. Mushroom body memoir: from maps to models. Nat. Rev. Neurosci. 2003;4:266–275. doi: 10.1038/nrn1074. [DOI] [PubMed] [Google Scholar]
- 17.Chihara T, et al. Caspase inhibition in select olfactory neurons restores innate attraction behavior in aged Drosophila. PLoS Genet. 2014;10:e1004437. doi: 10.1371/journal.pgen.1004437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Valanne, S., Salminen, T. S., Järvelä-Stölting, M., Vesala, L. & Rämet, M. Immune-inducible non-coding RNA molecule lincRNA-IBIN connects immunity and metabolism in Drosophila melanogaster. PLoS Pathog.15, PMC6345493 (2019). [DOI] [PMC free article] [PubMed]
- 19.Rogers S, Wells R, Rechsteiner M. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science (1979) 1986;234:364–368. doi: 10.1126/science.2876518. [DOI] [PubMed] [Google Scholar]
- 20.Rechsteiner M, Rogers SW. PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 1996;21:267–271. doi: 10.1016/S0968-0004(96)10031-1. [DOI] [PubMed] [Google Scholar]
- 21.Leclerc M, et al. Development of a destabilized firefly luciferase enzyme for measurement of gene expression. Biotechniques. 2018;29:590–601. doi: 10.2144/00293rr02. [DOI] [PubMed] [Google Scholar]
- 22.Gilestro GF, Tononi G, Cirelli C. Widespread changes in synaptic markers as a function of sleep and wakefulness in Drosophila. Science (1979) 2009;324:109–112. doi: 10.1126/science.1166673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wagh DA, et al. Bruchpilot, a protein with homology to ELKS/CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron. 2006;49:833–844. doi: 10.1016/j.neuron.2006.02.008. [DOI] [PubMed] [Google Scholar]
- 24.Park SM, Kang T, II, So JS. Roles of XBP1s in transcriptional regulation of target genes. Biomedicines. 2021;9:791. doi: 10.3390/biomedicines9070791. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ryoo HD, Domingos PM, Kang MJ, Steller H. Unfolded protein response in a Drosophila model for retinal degeneration. EMBO J. 2007;26:242–252. doi: 10.1038/sj.emboj.7601477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sone M, Zeng X, Larese J, Ryoo HD. A modified UPR stress sensing system reveals a novel tissue distribution of IRE1/XBP1 activity during normal Drosophila development. Cell Stress Chaperones. 2013;18:307–319. doi: 10.1007/s12192-012-0383-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Chen MZ, et al. A thiol probe for measuring unfolded protein load and proteostasis in cells. Nat. Commun. 2017;8:474. doi: 10.1038/s41467-017-00203-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Park S, et al. Modulation of protein synthesis by eIF2α phosphorylation protects cell from heat stress-mediated apoptosis. Cells. 2018;7:254. doi: 10.3390/cells7120254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ribeiro C, Esteves Da Silva JCG. Kinetics of inhibition of firefly luciferase by oxyluciferin and dehydroluciferyl-adenylate. Photochem. Photobiol. Sci. 2008;7:1085–1090. doi: 10.1039/b809935a. [DOI] [PubMed] [Google Scholar]
- 30.Lee J, et al. P38 MAPK-mediated regulation of Xbp1s is crucial for glucose homeostasis. Nat. Med. 2011;17:1251–1260. doi: 10.1038/nm.2449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sun H, et al. Inhibition of XBP1s ubiquitination enhances its protein stability and improves glucose homeostasis. Metabolism. 2020;105:154046. doi: 10.1016/j.metabol.2019.154046. [DOI] [PubMed] [Google Scholar]
- 32.Bozec D, et al. Akaluc bioluminescence offers superior sensitivity to track in vivo glioma expansion. Neurooncol. Adv. 2020;2:vdaa134. doi: 10.1093/noajnl/vdaa134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Amadeo F, et al. Firefly luciferase offers superior performance to AkaLuc for tracking the fate of administered cell therapies. Eur. J. Nucl. Med. Mol. Imaging. 2022;49:796–808. doi: 10.1007/s00259-021-05439-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Nakayama J, et al. High sensitivity in vivo imaging of cancer metastasis using a near-infrared luciferin analogue seMpai. Int. J. Mol. Sci. 2020;21:1–8. doi: 10.3390/ijms21217896. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Deshpande SA, et al. Acidic food pH increases palatability and consumption and extends Drosophila lifespan. J. Nutr. 2015;145:2789–2796. doi: 10.3945/jn.115.222380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Hall MP, et al. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 2012;7:1848–1857. doi: 10.1021/cb3002478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Shakhmin A, et al. Coelenterazine analogues emit red-shifted bioluminescence with NanoLuc. Org. Biomol. Chem. 2017;15:8559–8567. doi: 10.1039/C7OB01985H. [DOI] [PubMed] [Google Scholar]
- 38.Gaspar N, et al. Evaluation of NanoLuc substrates for bioluminescence imaging of transferred cells in mice. J. Photochem. Photobiol. B. 2021;216:112128. doi: 10.1016/j.jphotobiol.2021.112128. [DOI] [PubMed] [Google Scholar]
- 39.Su Y, et al. An optimized bioluminescent substrate for non-invasive imaging in the brain. Nat. Chem. Biol. 2023;19:731–739. doi: 10.1038/s41589-023-01265-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sakuma C, et al. The strip-hippo pathway regulates synaptic terminal formation by modulating actin organization at the drosophila neuromuscular synapses. Cell Rep. 2016;16:2289–2297. doi: 10.1016/j.celrep.2016.07.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Numerical source data supporting the results of this study are provided as ‘Supplementary Data 1’. The Akaluc transgenic flies are available through the KYOTO Drosophila Stock Center. The plasmid vectors prepared in this study can also be provided via the RIKEN BRC DNA BANK.






