Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2024 Jan 2;19(1):e0296312. doi: 10.1371/journal.pone.0296312

Characterization and biological applications of gonadal extract of Paracentrotus lividus collected along the Mediterranean coast of Alexandria, Egypt

Nehal Shawky Nagy 1,#, Amina Essawy Essawy 1,#, Soheir Salem Al-Sherif 1, Mohamad Moustafa Ali 2, Eman Sheta Alsawy 3, Mohamed Helal 4,*
Editor: Hamida Hamdi Mohammed Ismail5
PMCID: PMC10760885  PMID: 38166099

Abstract

Marine invertebrates represent a valuable reservoir of pharmaceutical bioactive compounds with potential relevance to various medical applications. These compounds exhibit notable advantages when compared to their terrestrial counterparts, in terms of their potency, activity, and mechanism of action. Within this context, the present work aimed to extract, chemically characterize, and investigate the bioactivity of the gonadal extract of the sea urchin Paracentrotus lividus (P. lividus) collected along the Mediterranean coast of Alexandria, Egypt. Fractions of the gonadal extract were characterized by Spectrophotometry and gas chromatography-mass spectrometry (GC-MS), and their bioactivities were investigated in vitro. The analysis supported the extract richness of carotenoids and bioactive compounds. The extract showed promising anticancer activity against three different breast cancer cell lines with different levels of aggressiveness and causative factors, namely MDA-MB-231, MDA-MB-453, and HCC-1954. Gene expression analysis using RT-qPCR showed that P. lividus extract inhibited the expression of crucial factors involved in cell cycle regulation and apoptosis. In addition, the extract significantly inhibited the lipo-polysaccharides (LPS) induced inflammation in the RAW264.7 macrophage cell line and exerted anti-bacterial activity against the Gram-negative bacteria Klebsiella pneumoniae and Pseudomonas aeruginosa. Collectively, these results demonstrated the chemical richness and the wide-scale applicability of P. lividus gonadal extract as an anti-cancer, anti-bacterial, and anti-inflammatory natural extract.

Introduction

The field of isolation and characterization of marine natural products is rapidly growing. It aims to isolate, detect, identify, and understand their structure and applications [1, 2]. It has been proven that these natural products have hundreds of leading bioactive compounds with high therapeutic potential. These compounds, such as carotenoids, phenolics, fatty acids, and proteins, are naturally produced from plants, animals, fungi, and microorganisms [3, 4]. These natural products possess several advantages over synthetic chemicals owing to their incomparable molecular diversity and biological functionality that enable a wide spectrum of interactions with proteins and other biological targets [5].

Sea urchins are a group of benthic echinoderms that belong to the class Echinoidea. Echinoderms are rich in bioactive metabolites, antioxidants, antimicrobial and anti-tumor compounds [6, 7]. Additionally, sea urchins are rich in minerals, proteins, vitamins, fatty acids, carotenoids, and polysaccharides that possess various biological functions [8, 9]. Of note, the hydrolysate extract of sea urchins is useful for various biomedical applications [10]. For instance, Ganglioside Hp-s1 isolated from Hemicentrotus pulcherrimus sperms possesses an anti-neuroinflammatory activity via NF-kB and JNK/p38 MAPK downregulation [11]. Bioactive compounds extracted from Stomopneustes variolaris showed antioxidant, anti-inflammatory, anti-diabetic, and anti-cancer properties [12]. Sea urchin-purified spinochromes and naphthoquinones exhibit antioxidant and cytotoxic anti-bacterial properties [13]. Interestingly, extracts from different sea urchin body parts showed different biological activities [14]. For example, extracts from the gonads, gut, spines, and mouth parts of the genus Tripneustes gratilla showed in vitro anti-microbial and hemolytic activities. Therefore, the diversity of bioactive molecules present within different organs of sea urchins could, in part, explain the vast reactivities among different extracts [15, 16]. Importantly, sea urchin gonads, which are half-moon-shaped and yellow to orange in color constitute only 10% of the total weight and are the edible portion. They are eaten because of their characteristic flavor, their richness of bioactive compounds (polysaccharides, fatty acids, etc.), and their medicinal properties [17, 18]. Research reports indicated that sea urchin gonads contain a high content of polyunsaturated fatty acids (PUFAs) [19], and carotenoids [2022].

Carotenoids are the most abundant pigment groups in nature. They also form the most important compounds detected in the sea urchin gonads. The major carotenoids in sea urchin gonads are echinenone, β-carotene, canthaxanthin, and astaxanthin [22, 23]. Generally, carotenoids have valuable anti-cancer, anti-obesity, anti-diabetic, anti-inflammatory, and cardioprotective activities [24]. Carotenoids of marine origin have an anti-proliferative effect on different cancer cell lines [25]. The GC-MS analysis of the gonadal extract of the Australian purple sea urchin Heliocidaris erythrogramma detected different classes of fatty acids such as saturated fatty acids (SFAs), mono-unsaturated fatty acids (MUFAs,) and PUFAs. Additionally, The extract displayed significant anti-inflammatory and anti-tumor activities [26]. Moreover, the anti-oxidant, anti-diabetic, and anti-inflammatory properties of the gonad methanolic extract of the purple sea urchin Echinometra mathaei were experimentally evident [14]. The gonadal extract of Diadema setosum was effective in regulating the immune response and could be utilized as a dietary supplement for acute and chronic inflammation [27]. Similarly, PUFAs and carotenoids were detected in the gonadal extract of the green sea urchin Strongylocentrotus droebachiensis, where the extract demonstrated anti-inflammatory and anti-diabetic activities [28]. Among different sea urchin species, P. lividus [Lamarck, 1816] is the most appreciated one, it grows in the Atlantic and is found on the Southeastern Mediterranean coast of Alexandria, Egypt [29]. Previous reports on P. lividus extract not only demonstrated its activity against oxidative stress and liver damage in type I and type II diabetes mellitus [30] but also showed the potential use of the extract as a source of valuable low-cost collagen for mechanically resistant biomedical devices [31]. Currently, there are almost twenty marine-derived bioactive compounds available in the market [32], including Histochrome which is a sodium salt of Echinochrome-A (sea urchin pigment) and it has been in the clinic since 1999 [33]. Reports on the biological activity of different sea urchin extracts are intensively reported, however, little is known about the biological activity of the gonadal extract. Therefore, the current study aims to isolate and characterize the chemical composition of the components of the gonadal extract of P. lividus and investigates their biological properties as anti-cancer, anti-inflammatory, and antimicrobial agents.

Material and methods

Sample collection and extraction of bioactive compounds from gonads

Mature individuals of Paracentrotus lividus (Lamarck, 1816) were procured through underwater collection by marine divers along the coast of Abou Quir, located in Alexandria, Egypt. Following their retrieval, these sea urchins were expeditiously transported to the laboratory while still alive. To obtain the gonadal extract, sea urchins were dissected, gonads were collected, washed in seawater to remove any debris then weighed. For each 3–4 gm of weighted gonads, 10 ml of HPLC grade acetone was added and gentle homogenization was carried out. The homogenate was collected and then centrifuged for 3 min at 1500 rpm under cooling conditions. An equal volume of methyl tertiary-butyl ether (MTBE) and 5 ml of distilled water were added to it and vigorously shaken. Then the organic layer (which contains the extract) was collected, filtered, and dried under nitrogen gas evaporation. Butylhydroxytoluene, BHT (0.1%), was added to the extraction solvent to prevent carotenoid oxidation [34]. All experimental procedures were followed according to ethical principles recommended by the Alexandria University guideline for animal care with an approval code (AU 04 21 09 23 2 01).

Gas Chromatography-Mass Spectroscopy (GC-MS) analysis of gonadal extract

The bioactive contents of the extracted gonadal extract were estimated according to gas chromatography mass-spectrometry analysis (GC2010 & GCMS-QP2010, respectively). The mass spectrometer was run at 70 eV and scanned fragments from 30 to 300 m/z. Peak identification of gonadal extract depended on comparing the gained mass spectra with NIST88 Library. Compounds were identified by comparing the retention times with those of authentic compounds and with the spectral data obtained from the data library of the corresponding compounds. Quantities of the compounds are represented as relative area percentages derived from the integrator. The injected sample volume was 1 μl.

Carotenoid detection by spectrophotometer

The absorbance of carotenoids was examined at three distinct wavelengths, yielding spectra featuring three distinct peaks [35]. To achieve this, an acetone-based gonadal extract was meticulously prepared, and the presence of carotenoids was ascertained across a wavelength range spanning from 380 to 520 nm. This assessment was carried out utilizing a spectrophotometer (T70, PG Instruments Limited, United Kingdom)

Anti-cancer activity of gonadal extract

Three breast cancer cell lines were used in this work (MDA-MB-231, MDA-MB-453, and HCC 1954) to investigate and study the anti-cancer properties of P. lividus gonadal extract. The MDA-MB-231 cell line was cultured in a Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, Thermo Fisher Scientific) while MDA-MB-453 and HCC-1954 were cultured in RPMI 1640 medium (Gibco, Thermo Fisher Scientific). All cell culture media were supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% Pen-Strep antibiotics (Gibco, Thermo Fisher Scientific). All cells were maintained at 37°C in a humified incubator with 5% CO2. Different concentrations of P. lividus gonadal extract was used for the cell viability experiment to determine the 50% inhibition concentration (IC50) in each cell line. For each concentration, 2000 cells per well were seeded in a 96-well plate for 24 hours. Then, the indicated concentrations of the extract were added and incubated for 48 hours. To assess the cell viability, Presto Blue™ Cell Viability Reagent (Thermo Fisher Scientific, Cat# A13262) was used according to the manufacturer’s protocol, and the fluorescence signal at an Excitation/Emission wavelength of 560/590 nm using a microplate reader (PerkinElmer) was measured.

Gene expression analysis

Total RNA was extracted from cells using Relia Prep™ RNA Cell Miniprep System (Promega, Cat# Z6012) according to the manufacturer’s instructions. One microgram of total RNA from each sample was subjected to cDNA synthesis utilizing a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, Cat# 4368814). The expression of different coding genes using quantitative real-time PCR assays performed on a Bio-Rad CFX96 cycler (Bio-Rad Laboratories Inc.) was investigated. The name and primer sequences of each tested gene and the housekeeping gene were tabulated in Table 1. For each gene, a master mix was prepared with the aid of qPCR BIO SyGreen 2× Master Mix (PCR Biosystems, Cat#PB20.14–50) following the manufacturer’s instructions. Gene fold change expression levels of different samples were calculated using the threshold cycles (CTs), also known as the 2-ΔΔCT method [36].

Table 1. Primer pair sets of target and housekeeping genes.

Gene name Forward primer Reverse primer
Bcl2 AGGCTGGGATGCCTTTGTGG TTTGTTTGGGGCAGGCATGT
ATM CAGGGTAGTTTAGTTGAGG CTATACTGGTGGTCAGTGC
ATR GTTGGGCCCACTTTATGCAG TGCTCTTTTGGTTCATGTCCAC
BRCA1 ACAGCTGTGTGGTGCTTCTGTG CATTGTCCTCTGTCCAGGCATC
CDK1 CGCCGCGGAATAATAAGCC AGGAACCCCTTCCTCTTCACT
CDK4 TGTTGTCCGGCTGATGGACG CCTTGATCGTTTCGGCTGGC
CYCB1 ACCTGTGTCAGGCTTTCTCTG TGGTCTGACTGCTTGCTCTTC
P21 CTGCCCAAGCTCTACCTTCC CAGGTCCACATGGTCTTCCT
HPRT1(housekeeping gene) CCCTGGCGTCGTGATTAGT CACCCTTTCCAAATCCTCAGC

Anti-inflammatory activity of gonadal extract

Murine macrophages RAW264.7 cells (ATCC®) were maintained in complete DMEM (Corning, USA), with 10% FBS, streptomycin sulphate (100 μg/mL), penicillin (100 U/mL), and 2 mM L-glutamine in a humidified 5% CO2 incubator. Cells were washed with phosphate-buffered saline and scrapped off the flasks using sterile scrappers (SPL, Spain). RAW 264.7 cells (0.1 × 106 cells/mL) were seeded into each well of 96-well microwell plates and incubated overnight. Three groups of triplicate wells were prepared. The sample vehicle group received (DMSO, 0.1% V/v) and culture media, the inflammation group received the inflammation inducer [lipopolysaccharide (LPS) as 100 ng/mL in complete culture media], and the sample groups received concentrations (10,100, 200 μg/ml) of the extract dissolved in DMSO and diluted in culture media which contain LPS (final concentration of DMSO = 0.1% V/v). As an established positive control for the anti-inflammatory effect, Indomethacin (Indo, 0.25mM, Sigma) was used [37, 38]. After 24 h of incubation, the Griess assay [39] was performed to determine the available nitrite to indicate the breakdown of nitric oxide (NO) in all wells. Equal volumes of culture supernatants and Griess reagent were mixed and incubated at room temperature for 10 min to form the colored diazonium salt, which was detected at an absorbance of 540 nm on a Tecan Sunrise™ microplate reader (Austria). NO inhibition (%) of the tested extract was calculated relative to the inflammation group, normalized to cell viability determined with Alamar Blue™ reduction assay [40, 41].

Anti-microbial activity of gonadal extract

The agar well diffusion assay [42, 43] was utilized to assess the antibacterial activity of the sea urchin gonadal extract. Five microbial species were screened including Gram-negative Bacteria: Klebsiella pneumoniae ATCC700603, E. coli ATCC25922 and Pseudomonas aeruginosa ATCC 27853, Gram-positive Bacteria: Streptococcus pyogenes EMCC1772 in addition to Candida albicans EMCC105. Briefly, the bacteria were grown in nutrient agar at 37°C for 24 hours and Candida albicans was grown in potato dextrose agar at 28°C for 24 hours. One hundred μl of the inoculums (1×108 CFU/ml) was inculcated on the surface of the agar media. Five different concentrations of the gonadal extract were prepared in five concentrations and 100 μl were applied in a 5 mm diameter well (wells were made using a sterilized cork borer). The zone of inhibition was calculated by measuring the diameter of the inhibition zone around the well (mm), including the well diameter. The readings were taken in three different directions in all triplicates and the average values were tabulated. Amoxicillin standard 0.01% (Pharco pharmaceuticals) was used as a positive control antibiotic, while Clotrimazole standard 0.01% (Pharco pharmaceuticals) was used as a positive control antifungal agent. The minimum inhibitory concentration (MIC) was determined using the agar dilution method [44, 45], the tested extract was firstly diluted to make a series of concentrations (200 mg/ml to 25 mg/ml), an appropriate volume of each dilution was added to the melted agar to make plates (agar diluted), then the tested microorganisms were added on the surface. The lowest concentration of the extract that inhibits the visible growth of the tested microorganisms was the MIC value.

Statistical analysis

Statistical analysis was performed using graph pad prism 7.00 software, the data were evaluated by T.test and presented as mean ± Standard deviation. Significance is marked for p-value ≤ 0.05.

Results

GC-MS characterization of the gonadal extract and carotenoid detection

As shown in Table 2, thirty compounds were identified by the Gas chromatography-mass spectrometry (GC-MS) analyses of the P. lividus gonadal extract (Fig 1 and S1 Fig). The prevalent compounds were alkane hydrocarbons (Tetradecane, Octadecane, Nonadecane), alkane (Eicosane), aldehydes (Octadecanal,), fatty acids (Octadecanoic acid “Stearic acid”, Hexadecanoic acid “palmitic acid”), fatty acid methyl esters (Octadecanoic acid-methyl ester, Hexadecanoic acid- methyl ester), 2-Undecenal, cis-9-Hexadecenoic acid (palmitoleic acid), 9-Octadecenoic acid, methyl ester, cis-Vaccenic acid, Oleyl Alcohol, cis-11-Eicosenoic acid, methyl ester, Hexadecenoic acid, 2-hydroxy-1-(hydroxymethyl) ethyl ester (2-Palmitoylglycerol), 2-(((2-Ethylhexyl)oxy)carbonyl)benzoic acid, 9-Octadecenoic acid (Z) and 2,3-hydroxypropyl ester (Glyceryl monooleate). The visible absorption data for the carotenoid compounds detected in the P. lividus gonadal extract using the spectrophotometer are shown in Table 3. All the identified compounds exhibited their maximum absorption at three specific wavelengths, whereas Astaxanthin and Echinenone displayed absorption at a single wavelength.

Table 2. List of detected compounds in the P. lividus gonadal extract using (GC–MS).

Constituent R. Time Area MF MW (g/mol)
2-Undecenal 10.789 139783 C11H20O 168
Tetradecane 11.965 73985 C14H30 198
Eicosane 13.572 134502 C20H42 282
Octadecanal 14.500 19683 C18H30O 268
Octadecane 15.018 136576 C18H36 254
Hexadecanoic acid, methyl ester 15.214 132442 C17H34O2 270
Cis-9-Hexadecenoic acid (palmitoleic acid) 15.386 45581 C16H30O2 254
Hexadecanoic acid (palmitic acid) 15.500 842680 C16H32O2 265
Nonadecane 15.707 123069 C19H40 268
9-Octadecenoic acid, methyl ester 16.565 122817 C19H36O2 296
Octadecanoic acid, methyl ester 16.748 54556 C19H38O2 298
Cis-Vaccenic acid 16.993 2127578 C18H34O2 282
Octadecanoic acid (Stearic acid) 17.142 341102 C18H36O2 284
Oleyl Alcohol 18.247 68322 C18H36O 268
Cis-11-Eicosenoic acid, methyl ester 18.692 148195 C21H40O2 324
Hexadecanoic acid, 2-hydroxy-1-(hydroxymethyl) ethyl ester (2-Palmitoylglycerol), 22.380 206289 C19H38O4 330
1,2-Benzenedicarboxylic acid, mono(2-ethylhexyl) ester 23.293 2664521 C16H22O4 278
9-Octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester (Glyceryl monooleate). 27.526 538150 C21H40O4 356

Fig 1. GC-MS chromatogram of P. lividus gonadal extract.

Fig 1

Briefly: P. lividus gonads were freshly dissected under cooling conditions and extracted with acetone and Methyl tertiary-butyl ether then the organic extract was concentrated under nitrogen gas and applied to GC-MS analysis (A). Examples of the anti-inflammatory B) palmitoleic acid, anti-bacterial C) Octadecanoic acid, D) palmitic acid, and, anticancer compound E) 1,2-Benzenedicarboxylic acid, mono(2-ethylhexyl) ester.

Table 3. Detection of carotenoid compounds in P. lividus gonadal extract dissolved in acetone.

Carotenoid Wavelength Absorbance (AU)
Lycopene 448 1.146
474 1.456
505 1.494
Neoxanthin 416 0.923
440 1.088
470 1.395
Zeaxanthin 430 1.019
452 1.153
479 1.466
Astaxanthin 480 1.460
Auroxanthin 381 0.585
402 0.696
427 0.987
α-carotene 424 0.964
448 1.105
476 1.300
β-carotene 429 0.972
452 1.103
478 1.397
γ-carotene 439 1.001
461 1.171
491 1.356
echinenone 460 1.140

Gonadal extract of P. lividus affects the viability and gene expression of breast cancer cells

To investigate the therapeutic potential of P. lividus gonadal extract, the present work assessed the viability of different breast cancer cell lines treated with an escalated extract dose. The triple-negative cell line MDA-MB-231, the androgen receptor-positive and triple-negative cell line MDA-MB-231, and the HER2-positive cell line HCC-1954 were utilized. The extract exerted concentration-dependent cytotoxic effects on the cell line tested; as shown in (Fig 2A–2D) Using non-linear regression analysis, The IC50 value of the extract in each cell line was estimated to be 360.8 μg/ml for MDA-MB-231, 379.8 μg/ml for MDA-MB-453 and 371.37 μg/ml for HCC 1954. Next, the effect of the gonadal extract on the expression patterns of a panel of genes involved in apoptosis and cell cycle regulation was investigated, as indicated in (Fig 2E and 2F), the investigated cells subjected to a sub-lethal extract dose exhibited a consistently significant downmodulation of the cyclin-dependent kinase 1 (CDK1) and its associated cyclin B1 (CYCB1). Concomitantly, the treated cells exhibited an upregulation of major cyclin-dependent kinase inhibitor p21. Taken together, the present data indicated a possible mode of action of the P. lividus gonadal extract by inhibiting cell proliferation and promoting cell cycle arrest.

Fig 2. Invitro anticancer activity of P. lividus gonad extract on different breast cancer cell lines.

Fig 2

A) P. lividus gonadal extract effect on different breast cancer cell lines MDA-MB-231, MDA-MB-453, and HCC-1954. B, C, D) The extract inhibits the proliferation of MDA-MB-231, MDA-MB-453, and HCC-1954 cells, the effect was dose-dependent, 400 μg/ml and 600 μg/ml were the most effective doses. E, F) Gene expression of Bcl2, ATM, ATR, BRCA1, CDK1, CDK4, CYCB1, and P21 in MDA-MB-231 and HCC-1954 breast cancer cell lines after treatment with P. lividus gonadal extract. Scale bar: 100 μm, invitro cell culture test, and RT-qPCR were performed in triplicates, significance: p ≤ 0.05.

P. lividus gonadal extract possesses antimicrobial activity

To examine the antimicrobial capacity of the extract, 5 pathogenic microbes with increasing concentrations of the extract were treated. Except for Candida albicans species, the extract demonstrated a potential antimicrobial effect assessed by measuring the inhibition zone diameter (Fig 3A & Table 4). Moreover, the minimum inhibitor concentrations (MIC) were calculated for the tested microorganisms where the gonadal extract possessed the lowest MIC against the Gram-negative bacteria Klebsiella pneumoniae and the highest MIC against Pseudomonas aeruginosa as shown in (Fig 3B).

Fig 3. Antimicrobial and anti-inflammatory effect of P. lividus gonad extract on different microbial species and NO production in RAW 264.7 macrophage cell line.

Fig 3

A) The inhibition zone of some Gram-positive, Gram-negative bacteria and Candida albicans to P. lividus gonadal extract. B) the minimum inhibition concentration of P. lividus gonadal extract for each microorganism. C) Anti-inflammatory activity of P. lividus gonadal extract different concentrations represented as NO% inhibition. Invitro antibacterial and anti-inflammatory tests were performed in triplicates, significance: p ≤ 0.05.

Table 4. Antimicrobial effect of P. lividus gonadal extract against different species.

Inhibition zone diameter (mm)**
Strain 25 mg/ ml 50 mg/ ml 100 mg/ ml 150 mg/ ml 200 mg/ ml Positive control MIC
Klebsiella pneumoniae 11 15 17 18 20 38 25
E. coli ND ND ND ND 19 40 100
Pseudomonas aeruginosa ND ND ND ND 14 36 200
Streptococcus pyogenes ND ND 15 19 20 28 100
Candida albicans ND ND ND ND ND 30 ND

**Diameters include 5 mm well diameter.

ND; Not detected.

MIC; Minimum inhibition concentration (mg/ml)

P. lividus extract attenuates nitric oxide production in response to inflammation

The present study utilized the established murine macrophage RAW264.7 cell model to determine the anti-inflammatory effect of the gonadal extract. In this context, an inflammatory signal of 100 ng/ml of lipopolysaccharide (LPS) was induced either in the presence or absence of different concentrations of the extract. As a readout of the inflammatory response, the produced nitrate ions that represent the stable form of nitric oxide (NO) utilizing the Griess assay were measured. As demonstrated in (Fig 3C), at lower concentrations of the extract, no significant changes in the measured nitrate were observed. Nevertheless, at a higher concentration (200 μg/ml), the gonadal extract exhibited >50% inhibition of the stable NO form. Thus, the data indicated the potent effect of P. lividus gonadal extract in suppressing inflammatory signals, at least in murine macrophages.

Discussion

In the present study, the GC-MS analysis of P. lividus gonadal extract showed a profile of different compounds with different bioactive properties. For instance, among the identified compounds, 1,2-Benzenedicarboxylic acid was reported earlier to inhibit the proliferation of hepatocellular carcinoma invitro cell line and arrest the cell cycle progression at the G1 phase [46]. Similarly, previous studies showed the ability of carotenoids to modulate the hallmarks of cancer mainly by inhibiting the cell cycle progression of actively dividing cancer cells [47]. Carotenoids were found to downmodulate cyclin D1, cyclin D2, CDK4, and CDK6 expression, and upregulate GADD45α, which prevents cell entry into the S phase [9]. Moreover, carotenoids induce the apoptotic potential of cancer cells and exhibit a synergetic effect when combined with conventional chemotherapeutic agents [48]. A previous study [49] attributed the broad inhibitory effect of carotenoids on cancer cells, including the anti-angiogenic and anti-metastasis effects, to the formation of retinoids from diverse carotenoids.

In a similar line, the gonadal extract of the P. lividus exhibited a significant reduction in cell proliferation of three different breast cancer cell lines. The gene expression analysis further reinforced the observed phenotype demonstrating a consistently significant downmodulation of crucial cell cycle regulators, namely CDK1 and CYCB1. On the other hand, gene expression analysis in the present study did not show any significant changes in CDK4 expression which regulates the entry to the G1 phase. Instead, the major regulators of the M-phase entry (CDK1/CYCB1) were significantly altered, pointing out a distinct mode of action. It is important to mention that the treated cells exhibited significantly elevated levels of the cyclin-dependent kinase inhibitor p21 compared to control cells. The p21 protein, also known as CDKN1A, was a direct target of p53 which was regulated at the transcriptional level upon genotoxic damage and stress conditions. Once stimulated, p21 induces a cell cycle arrest depending on the nature of the stimuli. Consistent with the present results, it is known that p21 inhibits the kinase activity of CDK1, causing a cell cycle arrest at the G2/M phase [5052].

Carotenoids induce a cytotoxic effect on cancer cells by ROS induction without affecting the redox status and the proliferation of normal breast cells through the activation of pro-apoptotic proteins p21, p27, p53, and Bax, causing ROS-triggered apoptosis [53]. In this context, the Bcl2 family of proteins is known for its crucial role in regulating cellular apoptosis. A subfamily of Bcl-2, namely Bcl-2-like survival factors, acts as scavengers of pro-apoptotic proteins, performing anti-apoptotic functions [54, 55], also Bcl-2 caused mild prevention for the inflammation-induced cancer [56]. Blocking Bcl-2 mRNA translation reduced its protein level in the cells leading to apoptosis [57]. Previous studies demonstrated the pro-apoptotic functions of carotenoids by changing the expression levels of different Bcl-2 family proteins [58]. Thus, targeting Bcl-2 represents a potential therapeutic option to initiate apoptosis and overcome acquired resistance to several drugs [59, 60]. Interestingly, the investigated cell lines in the present study, MDA-MB-231, and HCC-1954 showed relatively lower expression levels of BCL-2 following the gonadal extract treatment. Adding to the activation of CDKN1A and downregulation of CDK1/CYCB1, the present data suggest a direct transcriptional dysregulation of key cell cycle and survival modulators that inhibit the proliferation capacity of cancer cells.

The comprehensive spectrum of anti-cancer properties inherent in 1,2-benzene dicarboxylic acid, mono(2-Ethylhexyl) ester was systematically investigated through an empirical exploration. The compound, isolated from Streptomyces sp., inhibited HepG2 cell proliferation in-vitro [46] and exhibited cytotoxic activity also on the MCF-7 cancer cell line while it showed less cytotoxic activity on murine fibroblasts and immortalized human keratinocytes NIH 3T3 and HaCa T, respectively [61]. In a parallel vein, extracts derived from gonadal tissues of the edible sea urchin Heliocidaris erythrogramma exhibited the capacity to suppress the proliferation of the mouse leukemia lymphoblastic cell line P388 [26].

To further examine the potential biological activities of P. lividus gonadal extract, an in vitro anti-inflammatory assay using RAW264.7 macrophage cell line was performed. Results revealed more than 50% inhibition of nitric oxide (NO) production in macrophages at 200 μg/ml extract concentration. In line with these results, previous reports indicated the potential anti-inflammatory effects of a carotenoid-enriched gonadal extract of different sea urchin species such as Strongylocentrotus droebachiensis and Heliocidaris erythrogramma (causing inhibition of the two isomers of bovine COX) [26, 28], Stomopneustes variolaris, Echinometra mathaei (causing inhibition of the protein denaturation) [12, 14].

In reference to the GC-MS and spectrophotometry results, the anti-inflammatory activity of P. lividus gonadal extract can, in part, be attributed to the presence of several bioactive compounds and carotenoids, respectively. For example, astaxanthin possesses prominent anti-inflammatory activity in different in vivo and in vitro model systems [62]. Additionally, in LPS-stimulated BV2 microglial cell inflammation, authors found that NO, iNOS and COX-2 expression were inhibited by astaxanthin [24, 63]. β-Carotene, Zeaxanthin, and Neoxanthin, detected in the carotenoid extract of guajillo peppers, were found to possess significant anti-inflammatory activity [64]. Moreover, numerous studies have reported the potent anti-inflammatory properties of PUFAs and palmitoleic acid (isomers of hexadecenoic acid) [65, 66].

P. lividus gonadal extract also showed anti-bacterial activity against all tested microorganisms. Similar findings were reported in other sea urchin species, such as Diadema setosum against Klebsiella pneumoniae [67], E. mathaei against streptococcus species [68], Tripneustes gratilla against Escherichia coli and Pseudomonas aerogenes [15]. The mechanistic proposal of the reported anti-bacterial activity of P. lividus gonad extract can be traced back to its content of palmitic acid, stearic acid, palmitoleic acid, and 9-cis-hexadecenoic as revealed by GC-MS analysis. In general, Fatty acids (saturated and unsaturated) have anti-bacterial activity against Gram-positive and Gram-negative bacteria [69, 70]. Also, hexadecenoic acid and octadecanoic acid were found to disrupt cytoplasmic membranes and induce DNA damage to Staphylococcus aureus and Pseudomonas aeruginosa [71]. Additionally, hexadecenoic acid, methyl ester inhibited the growth of Escherichia coli, Pseudomonas aeruginosa and Klebsiella bacterial strains [72, 73], whereas Pentadecane, Octadecane, and Eicosane possess anti-bacterial activity against the tested bacteria [74, 75]. Certain carotenoids induced lysozyme accumulation in the cell that digests bacterial cell walls [76] whereas, β-carotene and Astaxanthin inhibited Pseudomonas aeruginosa bacterial growth [77, 78] and Neoxanthin caused growth inhibition in helicobacter pylori growth [79]. According to previously published studies, lycopene inhibited bacterial growth by inducing reactive oxygen species (ROS)-mediated DNA damage in Escherichia coli [80] and restrained Staphylococcus aureus-induced inflammation by inhibiting the expression of α-hemolysin [81]. The biological activity of different compounds detected by GC-MS as reported by different literature is provided in (S1 Table) for the antibacterial, anti-inflammatory, antioxidant, anticancer and other biological properties [46, 66, 82104].

In summary, the results of the current study provide preliminary experimental findings on the biological activity of P. lividus gonadal extract through a combination of in vitro anti-cancer, anti-inflammatory, and anti-bacterial assays. These findings support the integration of P. lividus gonadal extract into deeper biomedical investigations and to analytically isolate and identify promising marine natural lead compounds.

Supporting information

S1 Fig

P. lividus gonad extract compounds detected by GC-MS (A-R). Chemical structure, compound name, and reference library are provided for each compound.

(PPTX)

S1 Table. Bioactivity of compounds detected by the GC-MS.

(PPTX)

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Dias DA, Urban S, Roessner U. A Historical Overview of Natural Products in Drug Discovery. Metabolites. 2012;2(2):303–36. doi: 10.3390/metabo2020303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Atanasov AG, Zotchev SB, Dirsch VM, Orhan IE, Banach M, Rollinger JM, et al. Natural products in drug discovery: advances and opportunities. Nature Reviews Drug Discovery. 2021;20(3):200–16. doi: 10.1038/s41573-020-00114-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Essawy AE, El-Sayed SA, Tousson E, Abd El-gawad HS, Alhasani RH, Abd Elkader H- TAE. Anti-kindling effect of Ginkgo biloba leaf extract and L-carnitine in the pentylenetetrazol model of epilepsy. Environmental Science and Pollution Research. 2022;29(32):48573–87. doi: 10.1007/s11356-022-19251-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shrinet K, Singh RK, Chaurasia AK, Tripathi A, Kumar A. Chapter 17—Bioactive compounds and their future therapeutic applications. In: Rp Sinha, Häder D-P, editors. Natural Bioactive Compounds: Academic Press; 2021. p. 337–62. [Google Scholar]
  • 5.Yuliana ND, Khatib A, Choi YH, Verpoorte R. Metabolomics for bioactivity assessment of natural products. Phytotherapy Research. 2011;25(2):157–69. doi: 10.1002/ptr.3258 [DOI] [PubMed] [Google Scholar]
  • 6.Blunt JW, Copp BR, Keyzers RA, Munro MH, Prinsep MR. Marine natural products. Natural Product Reports. 2015;32(2):116–211. doi: 10.1039/c4np00144c [DOI] [PubMed] [Google Scholar]
  • 7.Carroll AR, Copp BR, Davis RA, Keyzers RA, Prinsep MR. Marine natural products. Natural Product Reports. 2022;39(6):1122–71. doi: 10.1039/d1np00076d [DOI] [PubMed] [Google Scholar]
  • 8.Hosokawa M, Okada T, Mikami N, Konishi I, Miyashita K. Bio-functions of marine carotenoids. Food Science and Biotechnology. 2009;18(1):1–11. [Google Scholar]
  • 9.Bhatt T, Patel K. Carotenoids: Potent to Prevent Diseases Review. Natural Products and Bioprospecting. 2020;10(3):109–17. doi: 10.1007/s13659-020-00244-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sibiya A, Jeyavani J, Sivakamavalli J, Ravi C, Divya M, Vaseeharan B. Bioactive compounds from various types of sea urchin and their therapeutic effects—A review. Regional Studies in Marine Science. 2021;44:101760. [Google Scholar]
  • 11.Shih J- H, Tsai Y- F, Li I- H, Chen M- H, Huang Y- S. Hp-s1 Ganglioside Suppresses Proinflammatory Responses by Inhibiting MyD88-Dependent NF-κB and JNK/p38 MAPK Pathways in Lipopolysaccharide-Stimulated Microglial Cells. Marine Drugs. 2020;18(10):496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chamika WAS, Ho TC, Roy VC, Kiddane AT, Park J- S, Kim G- D, et al. In vitro characterization of bioactive compounds extracted from sea urchin (Stomopneustes variolaris) using green and conventional techniques. Food Chemistry. 2021;361:129866. doi: 10.1016/j.foodchem.2021.129866 [DOI] [PubMed] [Google Scholar]
  • 13.Brasseur L, Hennebert E, Fievez L, Caulier G, Bureau F, Tafforeau L, et al. The Roles of Spinochromes in Four Shallow Water Tropical Sea Urchins and Their Potential as Bioactive Pharmacological Agents. Marine Drugs. 2017;15(6):179. doi: 10.3390/md15060179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Soleimani S, Moein S, Yousefzadi M, Amrollahi Bioki N. Determination of In Vitro Antioxidant Properties, Anti-inflammatory Effects and A-Amylase Inhibition of Purple Sea Urchin Extract of Echinometra mathaei from the Persian Gulf. Jundishapur Journal of Natural Pharmaceutical Products. 2016;12(3):e36547. [Google Scholar]
  • 15.Abubakar L, Mwangi C, Uku J, Ndirangu S. Antimicrobial activity of various extracts of the sea urchin Tripneustes gratilla (Echinoidea). African Journal of Pharmacology and Therapeutics. 2012;1(1):19–23. [Google Scholar]
  • 16.AbouElmaaty E E., Ghobashy A A., Hanafy M H., Yassien M H., Ahmed M I., Hamed M M. Preliminary bioassay on antibacterial effects of Tripneustes gratilla extracts from the Red Sea, Egypt. Egyptian Journal of Aquatic Biology and Fisheries. 2020;24(4):77–88. [Google Scholar]
  • 17.Moreno-García DM, Salas-Rojas M, Fernández-Martínez E, del Rocío López-Cuellar M, Sosa-Gutierrez CG, Peláez-Acero A, et al. Sea urchins: an update on their pharmacological properties. PeerJ. 2022;10:e13606. doi: 10.7717/peerj.13606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Strahsburger E, Pizarro J, Zúñiga A, Ocares S, Vallejos C, McClelland M. Chilean benthic species identified as a new source of antibiotic substances. Latin american journal of aquatic research. 2020;48(2):257–67. [Google Scholar]
  • 19.Salvatore MM, Ciaravolo M, Cirino P, Toscano A, Salvatore F, Gallo M, et al. Fatty acids from Paracentrotus lividus sea urchin shells obtained via Rapid Solid Liquid Dynamic Extraction (RSLDE). Separations. 2019;6(4):50. [Google Scholar]
  • 20.Rocha F, Baião LF, Moutinho S, Reis B, Oliveira A, Arenas F, et al. The effect of sex, season and gametogenic cycle on gonad yield, biochemical composition and quality traits of Paracentrotus lividus along the North Atlantic coast of Portugal. Scientific Reports. 2019;9(1):2994. doi: 10.1038/s41598-019-39912-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Suckling CC, Kelly MS, Symonds RC. Chapter 11—Carotenoids in sea urchins. In: Lawrence JM, editor. Developments in Aquaculture and Fisheries Science. 43: Elsevier; 2020. p. 209–17. [Google Scholar]
  • 22.Symonds RC, Kelly MS, Suckling CC, Young AJ. Carotenoids in the gonad and gut of the edible sea urchin Psammechinus miliaris. Aquaculture. 2009;288(1):120–5. [Google Scholar]
  • 23.Hagen NT, Jørgensen I, Egeland ES. Sex-specific seasonal variation in the carotenoid content of sea urchin gonads. Aquatic Biology. 2008;3(3):227–35. [Google Scholar]
  • 24.Chuyen HV, Eun J- B. Marine carotenoids: Bioactivities and potential benefits to human health. Critical Reviews in Food Science and Nutrition. 2017;57(12):2600–10. doi: 10.1080/10408398.2015.1063477 [DOI] [PubMed] [Google Scholar]
  • 25.Galasso C, Corinaldesi C, Sansone C. Carotenoids from Marine Organisms: Biological Functions and Industrial Applications. Antioxidants. 2017;6(4):96. doi: 10.3390/antiox6040096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sheean PD, Hodges LD, Kalafatis N, Wright PF, Wynne PM, Whitehouse MW, et al. Bioactivity of extracts from gonadal tissue of the edible Australian purple sea urchin Heliocidaris erythrogramma. The Journal of the Science of Food and Agriculture 2007;87(4):694–701. [Google Scholar]
  • 27.Wa Ode Salma Sitti Wahyuni, Kadir Nursin, Asad Suryani, Yusuf  I. Effects of sea urchin (Diadema setosum) gonad extracts on gene expression of FOXP3 and the production of cytokine on Salmonella typhi-induced mice. Journal of Applied Pharmaceutical Science. 2018;8(12):140–6. [Google Scholar]
  • 28.Pozharitskaya ON, Shikov AN, Laakso I, Seppänen-Laakso T, Makarenko IE, Faustova NM, et al. Bioactivity and chemical characterization of gonads of green sea urchin Strongylocentrotus droebachiensis from Barents Sea. Journal of Functional Foods. 2015;17:227–34. [Google Scholar]
  • 29.Elmasry E, Abdel Razek FA, El-Sayed A- FM, Omar H, Hamed ESAE. Abundance, size composition and benthic assemblages of two Mediterranean echinoids off the Egyptian coasts: Paracentrotus lividus and Arbacia lixula. The Egyptian Journal of Aquatic Research. 2015;41(4):367–74. [Google Scholar]
  • 30.Soliman AM. Potential impact of Paracentrotus lividus extract on diabetic rat models induced by high fat diet/streptozotocin. The Journal of Basic & Applied Zoology. 2016;77:8–20. [Google Scholar]
  • 31.Benedetto CD, Barbaglio A, Martinello T, Alongi V, Fassini D, Cullorà E, et al. Production, Characterization and Biocompatibility of Marine Collagen Matrices from an Alternative and Sustainable Source: The Sea Urchin Paracentrotus lividus. Marine Drugs. 2014;12(9):4912–33. doi: 10.3390/md12094912 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Haque N, Parveen S, Tang T, Wei J, Huang Z. Marine Natural Products in Clinical Use. Marine Drugs. 2022;20(8):528. doi: 10.3390/md20080528 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Mishchenko NP, Fedoreev SA, Bagirova VL. Histochrome: a New Original Domestic Drug. Pharmaceutical Chemistry Journal. 2003;37(1):48–52. [Google Scholar]
  • 34.Squillaci G, Parrella R, Carbone V, Minasi P, La Cara F, Morana A. Carotenoids from the extreme halophilic archaeon Haloterrigena turkmenica: identification and antioxidant activity. Extremophiles. 2017;21(5):933–45. doi: 10.1007/s00792-017-0954-y [DOI] [PubMed] [Google Scholar]
  • 35.Rodriguez-Amaya DB. A guide to carotenoid analysis in foods: ILSI press Washington; 2001. [Google Scholar]
  • 36.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 2008;3(6):1101–8. doi: 10.1038/nprot.2008.73 [DOI] [PubMed] [Google Scholar]
  • 37.Salinas-Sánchez DO, Herrera-Ruiz M, Pérez S, Jiménez-Ferrer E, Zamilpa A. Anti-inflammatory Activity of Hautriwaic Acid Isolated from Dodonaea viscosa Leaves. Molecules. 2012;17(4):4292–9. doi: 10.3390/molecules17044292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dzoyem JP, Nganteng DND, Melong R, Wafo P, Ngadjui B, Allémann E, et al. Bioguided identification of pentacyclic triterpenoids as anti-inflammatory bioactive constituents of Ocimum gratissimum extract. Journal of Ethnopharmacology. 2021;268:113637. doi: 10.1016/j.jep.2020.113637 [DOI] [PubMed] [Google Scholar]
  • 39.Yoo M- S, Shin J- S, Choi H- E, Cho Y- W, Bang M- H, Baek N- I, et al. Fucosterol isolated from Undaria pinnatifida inhibits lipopolysaccharide-induced production of nitric oxide and pro-inflammatory cytokines via the inactivation of nuclear factor-κB and p38 mitogen-activated protein kinase in RAW264.7 macrophages. Food Chemistry. 2012;135(3):967–75. [DOI] [PubMed] [Google Scholar]
  • 40.Oliveira T, Figueiredo CA, Brito C, Stavroullakis A, Prakki A, Da Silva Velozo E, et al. Effect of Allium cepa L. on Lipopolysaccharide-Stimulated Osteoclast Precursor Cell Viability, Count, and Morphology Using 4′,6-Diamidino-2-phenylindole-Staining. International journal of cell biology. 2014;2014:535789. doi: 10.1155/2014/535789 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lin Y- Y, Lin S- C, Feng C- W, Chen P- C, Su Y- D, Li C- M, et al. Anti-Inflammatory and Analgesic Effects of the Marine-Derived Compound Excavatolide B Isolated from the Culture-Type Formosan Gorgonian Briareum excavatum. Marine Drugs. 2015;13(5):2559–79. doi: 10.3390/md13052559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cooper KE. Theory of antibiotic inhibition zones in agar media. Nature. 1955;176(4480):510–1. doi: 10.1038/176510b0 [DOI] [PubMed] [Google Scholar]
  • 43.Attallah NGM, El-Sherbeni SA, El-Kadem AH, Elekhnawy E, El-Masry TA, Elmongy EI, et al. Elucidation of the Metabolite Profile of Yucca gigantea and Assessment of Its Cytotoxic, Antimicrobial, and Anti-Inflammatory Activities. Molecules. 2022;27(4):1329. doi: 10.3390/molecules27041329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wiegand I, Hilpert K, Hancock RE. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 2008;3(2):163–75. doi: 10.1038/nprot.2007.521 [DOI] [PubMed] [Google Scholar]
  • 45.Kowalska-Krochmal B, Dudek-Wicher R. The Minimum Inhibitory Concentration of Antibiotics: Methods, Interpretation, Clinical Relevance. Pathogens. 2021;10(2):165. doi: 10.3390/pathogens10020165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Selvakumar JN, Chandrasekaran SD, Doss GPC, Kumar TD. Inhibition of the ATPase domain of human topoisomerase IIa on HepG2 cells by 1, 2-benzenedicarboxylic acid, mono (2-ethylhexyl) ester: molecular docking and dynamics simulations. Current cancer drug targets. 2019;19(6):495–503. doi: 10.2174/1568009619666181127122230 [DOI] [PubMed] [Google Scholar]
  • 47.Saini RK, Keum Y- S, Daglia M, Rengasamy KRR. Dietary carotenoids in cancer chemoprevention and chemotherapy: A review of emerging evidence. Pharmacological Research. 2020;157:104830. doi: 10.1016/j.phrs.2020.104830 [DOI] [PubMed] [Google Scholar]
  • 48.Koklesova L, Liskova A, Samec M, Buhrmann C, Samuel SM, Varghese E, et al. Carotenoids in Cancer Apoptosis—The Road from Bench to Bedside and Back. Cancers. 2020;12(9):2425. doi: 10.3390/cancers12092425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Eggersdorfer M, Wyss A. Carotenoids in human nutrition and health. Archives of Biochemistry and Biophysics. 2018;652:18–26. doi: 10.1016/j.abb.2018.06.001 [DOI] [PubMed] [Google Scholar]
  • 50.Abbas T, Dutta A. p21 in cancer: intricate networks and multiple activities. Nature Reviews Cancer. 2009;9(6):400–14. doi: 10.1038/nrc2657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Xie B, Wang S, Jiang N, Li JJ. Cyclin B1/CDK1-regulated mitochondrial bioenergetics in cell cycle progression and tumor resistance. Cancer Letters. 2019;443:56–66. doi: 10.1016/j.canlet.2018.11.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lossaint G, Horvat A, Gire V, Bačević K, Mrouj K, Charrier-Savournin F, et al. Reciprocal regulation of p21 and Chk1 controls the cyclin D1-RB pathway to mediate senescence onset after G2 arrest. Journal of Cell Science. 2022;135(8):jcs259114. doi: 10.1242/jcs.259114 [DOI] [PubMed] [Google Scholar]
  • 53.Shin J, Song M- H, Oh J- W, Keum Y- S, Saini RK. Pro-oxidant Actions of Carotenoids in Triggering Apoptosis of Cancer Cells: A Review of Emerging Evidence. Antioxidants. 2020;9(6):532. doi: 10.3390/antiox9060532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kirkin V, Joos S, Zörnig M. The role of Bcl-2 family members in tumorigenesis. Biochimica et Biophysica Acta (BBA)—Molecular Cell Research. 2004;1644(2):229–49. doi: 10.1016/j.bbamcr.2003.08.009 [DOI] [PubMed] [Google Scholar]
  • 55.Qian S, Wei Z, Yang W, Huang J, Yang Y, Wang J. The role of BCL-2 family proteins in regulating apoptosis and cancer therapy. Frontiers in Oncology. 2022;12:985363. doi: 10.3389/fonc.2022.985363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Alotaibi B, Negm WA, Elekhnawy E, El-Masry TA, Elseady WS, Saleh A, et al. Antibacterial, Immunomodulatory, and Lung Protective Effects of Boswelliadalzielii Oleoresin Ethanol Extract in Pulmonary Diseases: In Vitro and In Vivo Studies. Antibiotics. 2021;10(12):1444. doi: 10.3390/antibiotics10121444 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zhang L, Lu Z, Zhao X. Targeting Bcl-2 for cancer therapy. Biochimica et Biophysica Acta (BBA)—Reviews on Cancer. 2021;1876(1):188569. doi: 10.1016/j.bbcan.2021.188569 [DOI] [PubMed] [Google Scholar]
  • 58.Palozza P, Serini S, Di Nicuolo F, Calviello G. Modulation of apoptotic signalling by carotenoids in cancer cells. Archives of Biochemistry and Biophysics. 2004;430(1):104–9. doi: 10.1016/j.abb.2004.02.038 [DOI] [PubMed] [Google Scholar]
  • 59.Edison N, Curtz Y, Paland N, Mamriev D, Chorubczyk N, Haviv-Reingewertz T, et al. Degradation of Bcl-2 by XIAP and ARTS Promotes Apoptosis. Cell Reports. 2017;21(2):442–54. doi: 10.1016/j.celrep.2017.09.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kapoor I, Bodo J, Hill BT, Hsi ED, Almasan A. Targeting BCL-2 in B-cell malignancies and overcoming therapeutic resistance. Cell Death & Disease. 2020;11(11):941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Krishnan K, Mani A, Jasmine S. Cytotoxic Activity of Bioactive Compound 1, 2- Benzene Dicarboxylic Acid, Mono 2- Ethylhexyl Ester Extracted from a Marine Derived Streptomyces sp. VITSJK8. International journal of molecular and cellular medicine. 2014;3(4):246–54. [PMC free article] [PubMed] [Google Scholar]
  • 62.Ávila-Román J, García-Gil S, Rodríguez-Luna A, Motilva V, Talero E. Anti-Inflammatory and Anticancer Effects of Microalgal Carotenoids. Marine Drugs. 2021;19(10):531. doi: 10.3390/md19100531 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Choi, Seok K, Young-Sam P, Dong-Kug C. Effects of Astaxanthin on the Production of NO and the Expression of COX-2 and iNOS in LPS-Stimulated BV2 Microglial Cells. Journal of Microbiology and Biotechnology. 2008;18(12):1990–6. [PubMed] [Google Scholar]
  • 64.Hernández-Ortega M, Ortiz-Moreno A, Hernández-Navarro MD, Chamorro-Cevallos G, Dorantes-Alvarez L, Necoechea-Mondragón H. Antioxidant, Antinociceptive, and Anti-Inflammatory Effects of Carotenoids Extracted from Dried Pepper (Capsicum annuum L.). Journal of Biomedicine and Biotechnology. 2012;2012:524019. doi: 10.1155/2012/524019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Astudillo AM, Meana C, Guijas C, Pereira L, Lebrero P, Balboa MA, et al. Occurrence and biological activity of palmitoleic acid isomers in phagocytic cells. Journal of Lipid Research. 2018;59(2):237–49. doi: 10.1194/jlr.M079145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Astudillo AM, Meana C, Bermúdez MA, Pérez-Encabo A, Balboa MA, Balsinde J. Release of Anti-Inflammatory Palmitoleic Acid and Its Positional Isomers by Mouse Peritoneal Macrophages. Biomedicines. 2020;8(11):480. doi: 10.3390/biomedicines8110480 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.El-Sayed W M.M., Elshaer M M., Ibrahim H A.H., El-Metwaly M E.A. Antimicrobial agents from sea urchin (Diadema setosum) collected from the Red Sea, Egypt. Egyptian Journal of Aquatic Biology and Fisheries. 2020;24(5):33–51. [Google Scholar]
  • 68.Kazemi S, Heidari B, Rassa M. Antibacterial and hemolytic effects of aqueous and organic extracts from different tissues of sea urchin Echinometra mathaei on pathogenic streptococci. International Aquatic Research. 2016;8(4):299–308. [Google Scholar]
  • 69.Casillas-Vargas G, Ocasio-Malavé C, Medina S, Morales-Guzmán C, Del Valle RG, Carballeira NM, et al. Antibacterial fatty acids: An update of possible mechanisms of action and implications in the development of the next-generation of antibacterial agents. Progress in Lipid Research. 2021;82:101093. doi: 10.1016/j.plipres.2021.101093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Sanabria-Ríos DJ, Morales-Guzmán C, Mooney J, Medina S, Pereles-De-León T, Rivera-Román A, et al. Antibacterial Activity of Hexadecynoic Acid Isomers toward Clinical Isolates of Multidrug-Resistant Staphylococcus aureus. Lipids. 2020;55(2):101–16. doi: 10.1002/lipd.12213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Pinteus S, Lemos MFL, Simões M, Alves C, Silva J, Gaspar H, et al. Marine invasive species for high-value products’ exploration–Unveiling the antimicrobial potential of Asparagopsis armata against human pathogens. Algal Research. 2020;52:102091. [Google Scholar]
  • 72.Sadiqi S, Hamza M, Ali F, Alam S, Shakeela Q, Ahmed S, et al. Molecular Characterization of Bacterial Isolates from Soil Samples and Evaluation of their Antibacterial Potential against MDRS. Molecules. 2022;27(19):6281. doi: 10.3390/molecules27196281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Nabi M, Zargar MI, Tabassum N, Ganai BA, Wani SUD, Alshehri S, et al. Phytochemical Profiling and Antibacterial Activity of Methanol Leaf Extract of Skimmia anquetilia. Plants. 2022;11(13):1667. doi: 10.3390/plants11131667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Rocha DS, Silva JMd, Navarro DMdAF, Camara CAG, Lira CSd, Ramos CS. Potential antimicrobial and chemical composition of essential oils from Piper caldense tissues. Journal of the Mexican Chemical Society. 2016;60(3):148–51. [Google Scholar]
  • 75.Njeru SN, Muema JM. Antimicrobial activity, phytochemical characterization and gas chromatography-mass spectrometry analysis of Aspilia pluriseta Schweinf. extracts. Heliyon. 2020;6(10):e05195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Pérez MJ, Falqué E, Domínguez H. Antimicrobial Action of Compounds from Marine Seaweed. Marine Drugs. 2016;14(3):52. doi: 10.3390/md14030052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Ibrahim HAH. Antibacterial carotenoids of three Holothuria species in Hurghada, Egypt. The Egyptian Journal of Aquatic Research. 2012;38(3):185–94. [Google Scholar]
  • 78.Ahmed A.E, et al. In vitro Antimicrobial Activity of Astaxanthin Crude Extract from Haematococcus pluvialis. Egyptian Journal of Aquatic Biology and Fisheries. 2022;26(2):95–106. [Google Scholar]
  • 79.Molnár P, Deli J, Tanaka T, Kann Y, Tani S, Gyémánt N, et al. Carotenoids with anti-Helicobacter pylori activity from Golden delicious apple. Phytotherapy Research. 2010;24(5):644–8. doi: 10.1002/ptr.2912 [DOI] [PubMed] [Google Scholar]
  • 80.Lee W, Lee DG. Lycopene-induced hydroxyl radical causes oxidative DNA damage in Escherichia coli. Journal of Microbiology and Biotechnology. 2014;24(9):1232–7. doi: 10.4014/jmb.1406.06009 [DOI] [PubMed] [Google Scholar]
  • 81.Tang C, Li Q, Lin T. Lycopene attenuates Staphylococcus aureus-induced inflammation via inhibiting α-hemolysin expression. Microbes and Infection. 2021;23(9):104853. [DOI] [PubMed] [Google Scholar]
  • 82.Villa‐Ruano N., et al., Volatile composition and biological activities of the leaf essential oil from Zanthoxylum limoncello grown in Oaxaca, México. 2019. 16(2): p. e1800498. [DOI] [PubMed] [Google Scholar]
  • 83.Caboni P., et al., Nematicidal activity of (E, E)-2, 4-decadienal and (E)-2-decenal from Ailanthus altissima against Meloidogyne javanica. 2012. 60(4): p. 1146–1151. [DOI] [PubMed] [Google Scholar]
  • 84.Sallam K.M. and Abed N.J.E.J.o.C, Evaluation of Antimicrobial Potential of Tetradecane Extracted from Pediococcus acidilactici DSM: 20284-CM Isolated from Curd Milk. 2022. 65(3): p. 1–2. [Google Scholar]
  • 85.Ahsan T., et al., Extraction and identification of bioactive compounds (eicosane and dibutyl phthalate) produced by Streptomyces strain KX852460 for the biological control of Rhizoctonia solani AG-3 strain KX852461 to control target spot disease in tobacco leaf. AMB Express, 2017. 7(1): p. 54. doi: 10.1186/s13568-017-0351-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.LATA, K.J.A.J.o.P. and C. Research, Gas chromatography-mass spectrometry analysis of bioactive constituents from the marine Streptomyces. 2015: p. 244–246. [Google Scholar]
  • 87.Garba S., et al., ANTIMICROBIAL ACTIVITY OF N-OCTADECANAL ISOLATED FROM THE SEEDS AND PODS OF Acacia nilotica Linn. 2016. 1(01): p. 14–21. [Google Scholar]
  • 88.Al-Marzoqi A.H., Hameed I.H., and S.A.J.A.J.o.B. Idan, Analysis of bioactive chemical components of two medicinal plants (Coriandrum sativum and Melia azedarach) leaves using gas chromatography-mass spectrometry (GC-MS). 2015. 14(40): p. 2812–2830. [Google Scholar]
  • 89.Banakar P. and Jayaraj M.J.I.J.P.S.R., GC–MS analysis of bioactive compounds from ethanolic leaf extract of Waltheria indica Linn. and their pharmacological activities. 2018. 9(5): p. 2005–2010. [Google Scholar]
  • 90.Abubacker M. and Deepalakshmi T.J.B.B.R.A., In vitro antifungal potential of bioactive compound methyl ester of hexadecanoic acid isolated from Annona muricata linn (annonaceae) leaves. 2013. 10(2): p. 879–884. [Google Scholar]
  • 91.Wei L.S., et al., Characterization of anticancer, antimicrobial, antioxidant properties and chemical compositions of Peperomia pellucida leaf extract. 2011: p. 670–674. [PubMed] [Google Scholar]
  • 92.Ghareeb M.A., et al., Chemical characterization, antibacterial, antibiofilm, and antioxidant activities of the methanolic extract of Paratapes undulatus clams (Born, 1778). 2022. 12(5): p. 219–228. [Google Scholar]
  • 93.Ravi L. and Krishnan K.J.A.J.C.B., Research article cytotoxic potential of N-hexadecanoic acid extracted from Kigelia pinnata leaves. 2017. 12: p. 20–27. [Google Scholar]
  • 94.Chandrasekaran M., Kannathasan K., and Venkatesalu V., Antimicrobial Activity of Fatty Acid Methyl Esters of Some Members of Chenopodiaceae %J Zeitschrift für Naturforschung C. 2008. 63(5–6): p. 331–336. [DOI] [PubMed] [Google Scholar]
  • 95.Ali A.I., et al., Composition and Bioactivities of the Essential oil of Ixora finlaysoniana Wall. ex G. Don. (Family Rubiaceae). Journal of Essential Oil Bearing Plants, 2015. 18(4): p. 754–766. [Google Scholar]
  • 96.Mahmoud A., et al., Antioxidant and anticancer efficacy of therapeutic bioactive compounds from fermented olive waste. 2018. 69(3): p. e266–e266. [Google Scholar]
  • 97.Othman A.R., et al., Elucidation of in-vitro anti-inflammatory bioactive compounds isolated from Jatropha curcas L. plant root. BMC Complementary and Alternative Medicine, 2015. 15(1): p. 11. doi: 10.1186/s12906-015-0528-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Mohy El-Din S.M. and El-Ahwany A.M.D., Bioactivity and phytochemical constituents of marine red seaweeds (Jania rubens, Corallina mediterranea and Pterocladia capillacea). Journal of Taibah University for Science, 2016. 10(4): p. 471–484. [Google Scholar]
  • 99.Orienti I., et al., Enhancement of oleyl alcohol anti tumor activity through complexation in polyvinylalcohol amphiphilic derivatives. 2007. 14(4): p. 209–217. [DOI] [PubMed] [Google Scholar]
  • 100.Moni S.S., et al., Bioactive constituents and in vitro antibacterial properties of Petroselinum crispum leaves, a common food herb in Saudi Arabia. 2021. 12(3): p. 445–450. [Google Scholar]
  • 101.Keshavarz M., et al., Chemical compositions and experimental and computational modeling activity of sea cucumber Holothuria parva ethanolic extract against herpes simplex virus type 1. Biomedicine & Pharmacotherapy, 2021. 141: p. 111936. doi: 10.1016/j.biopha.2021.111936 [DOI] [PubMed] [Google Scholar]
  • 102.Palaniappan N., et al., Anticancer, antioxidant, and antimicrobial properties of solvent extract of Lobophora variegata through in vitro and in silico studies with major phytoconstituents. Food Bioscience, 2022. 48: p. 101822. [Google Scholar]
  • 103.Abdel-Hady H., et al., Identification and evaluation of antimicrobial and cytotoxic activities of Penicillium islandicum and Aspergillus tamarii ethyle acetate extracts. 2016. 6(4). [Google Scholar]
  • 104.Amaechi N.C.J.A.F.S.T., GAS CHROMATOGRAPHY MASS SPECTROMETRY ANALYSIS OF BIOACTIVE COMPOUNDS IN MONDIA WHITEI (HOOK. F.) SKEELS FRUIT. 2018. 19(4): p. 731–738. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig

P. lividus gonad extract compounds detected by GC-MS (A-R). Chemical structure, compound name, and reference library are provided for each compound.

(PPTX)

S1 Table. Bioactivity of compounds detected by the GC-MS.

(PPTX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLOS ONE are provided here courtesy of PLOS

RESOURCES