Abstract
The regulation of food intake occurs at multiple levels, and two of the components of this process are orexigenic and anorexigenic peptides, which stimulate or inhibit appetite, respectively. The study of the function of these compounds in domestic cattle is essential for production efficiency, animal welfare, and health, as well as for economic benefits, environmental protection, and the contribution to a better understanding of physiological aspects that can be applied to other species. In this study, the real-time PCR method was utilized to determine the expression levels of GHRL, GHSR, SMIM20, GPR173, LEP, LEPR, and NUCB2 (which encode ghrelin, its receptor, phoenixin-14, its receptor, leptin, its receptor, and nesfatin-1, respectively) in the gastrointestinal tract (GIT) of Polish Holstein–Friesian breed cattle. In all analyzed GIT segments, mRNA for all the genes was present in both age groups, confirming their significance in these tissues. Gene expression levels varied distinctly across different GIT segments and between young and mature subjects. The differences between calves and adults were particularly pronounced in areas such as the forestomachs, ileum, and jejunum, indicating potential changes in peptides regulating food intake based on the developmental phase. In mature individuals, the forestomachs predominantly displayed an increase in GHRL expression, while the intestines had elevated levels of GHSR, GPR173, LEP, and NUCB2. In contrast, the forestomachs in calves showed upregulated expressions of LEP, LEPR, and NUCB2, highlighting the potential importance of peptides from these genes in bovine forestomach development.
Keywords: food intake, gastrointestinal tract, orexigenic peptides, anorexigenic peptides, cattle, real-time PCR
1. Introduction
The regulation of food intake in mammals occurs through intricate processes encompassing multiple levels, intertwined with a cyclic pattern of hunger and satiety referred to as the food intake cycle [1]. The gastrointestinal tract (GIT) and the nervous systems, including the central nervous system (CNS) and the enteric nervous system (ENS), engage in a two-way communication facilitated by the parasympathetic and sympathetic inputs, both through efferent and afferent fibers [2,3]. The efferent neuronal pathways play a crucial role in regulating the activity of the gut during both interdigestive and digestive phases [2,4,5]. In contrast, the afferent pathway transmits signals from various sensors in the intestine to the CNS. These sensors are sensitive to mechanical and chemical stimuli, including hormones, nutrients, and peptides [2,6]. There are numerous endogenous peptides in the GIT that act as regulators of food intake. Depending on their specific actions, they can be classified as either orexigenic peptides, which stimulate appetite, or anorexigenic peptides, which suppress appetite. The best-known orexigenic peptide in the GIT is ghrelin, which stimulates hunger sensations and promotes food intake [7]. In contrast, the anorexigenic adipokine leptin acts locally to decrease appetite [8]. The intricate interplay between anorexigenic and orexigenic peptides is essential for maintaining appropriate energy balance, body weight, and overall nutritional status [3,9,10].
The roles and mechanisms of action of some of the aforementioned well-known peptides are fairly well understood. However, new substances with molecular mechanisms that are not fully explained are constantly being discovered. Newly discovered appetite-regulating peptides, nesfatin-1 and phoenixin-14, were found in the hypothalamus and coexist in the same neuronal population [11]. As the hypothalamus acts as a central hub for the integration of signals that determine food intake, the function of peptides discovered in this structure, particularly in areas responsible for the regulation of food intake, is relatively well understood. However, the precise peripheral functions of these peptides in the GIT organs, which are the first to come into contact with ingested food, are not yet fully understood. It is also unclear to what extent these peptides are present in the GIT of different animal species.
The lack of literature on nesfatin-1 and phoenixin-14 in the GIT of domestic cattle (Bos taurus taurus), crucial contributors to global economies through meat and dairy production [12], warrants investigation. While existing studies focus on leptin, leptin receptor, and ghrelin, key elements like the ghrelin receptor, phoenixin-14, and nesfatin-1 remain unexplored [13]. This study aims to bridge these gaps, analyzing mRNA expression of orexigenic peptides and their receptors (GHRL, GHSR, SMIM20, GPR173) and anorexigenic peptides and their receptors (LEP, LEPR, NUCB2) in the GIT of domestic cattle.
Considering the complex stomach subdivision (rumen, reticulum, omasum, abomasum) in ruminant cattle, this research also delves into GIT segment-related variations. Additionally, calves undergoing intensive growth, weight gain, and a transition from pre-ruminants to ruminants, offer a unique perspective. This transformation may influence the physiology and functions of the GIT, even in animals with relatively developed forestomachs such as the calves included in this study [14].
Therefore, this study aims to investigate the mRNA expression patterns of key orexigenic and anorexigenic peptides, including ghrelin, leptin, and newly discovered peptides such as nesfatin-1 and phoenixin-14, and their receptors, across different segments of the gastrointestinal tract in domestic cattle, with a focus on age-related differences to enhance our understanding of the complex feeding mechanisms in polygastric animals and their implications for livestock health.
Understanding mRNA expression in the GIT of polygastric animals, distinct from their monogastric counterparts, provides valuable insights into intricate feeding mechanisms. Imbalances in these peptides expression might disrupt appetite regulation and nutrient utilization, potentially impacting the health and growth performance of cattle. Ultimately, this research contributes essential knowledge to enhance livestock well-being and optimize agricultural practices.
2. Results
2.1. mRNA Expression Levels
The real-time PCR analysis revealed the presence of mRNA of all genes in all examined segments in both age groups (Figure 1). The expression levels of GHRL varied significantly among the segments, with the highest mRNA levels in both groups observed in the abomasum, significantly lower levels in the duodenum, and negligible expression in the remaining GIT sections (p < 0.01) (Figure 1a).
Figure 1.
Gene expression levels. The relative expression of genes (a) GHRL, (b) GHSR, (c) SMIM20, (d) GPR173, (e) LEP, (f) LEPR, and (g) NUCB2 in the examined bovine GIT segments, (h) Venn diagram summarizing the genes measured for which GIT segment, age, or their interaction had a significant impact on their relative mRNA expression levels as tested by the two-way ANOVA. Expression was normalized using the geometric mean of housekeeping genes RPS9 and ACTB and is presented relative to the levels observed in the adult abomasum. Different lowercase letters denote significant differences between GIT segments in calves, while different uppercase letters denote significant differences between GIT segments in adult individuals (p < 0.01). A hash (#) highlights significant differences in mRNA expression between calves and adults within a specific GIT segment (p < 0.01). Owing to the exponential characteristics of relative mRNA expression computed via the −ΔΔCT method, the geometric means along with SE (standard errors) are presented.
In adults, the highest expression level of GHSR was observed in the ileum, slightly lower (but insignificantly) in the reticulum and omasum, and lowest in the remaining tissues (p < 0.01). In calves, the highest expression level was noted in the omasum, while the lowest in the duodenum and jejunum (p < 0.01). Furthermore, the GHSR expression level in the jejunum and ileum of adult individuals was significantly higher compared to calves (p = 0.003, Cohen’s d Effect Size (ES): 1.74, Fold Change (FC): 1.89 for jejunum, and p = 0.003, ES: 0.96, FC: 1.90 for ileum) (Figure 1b).
The highest expression level of SMIM20 in adults was observed in the reticulum, followed by the rumen, and gradually decreased in other segments, with the jejunum exhibiting the lowest transcript level (p < 0.01). In calves, the highest expression was noted in the rumen, while the lowest in the jejunum (p < 0.01). There were no significant differences in SMIM20 expression levels between calves and adult individuals (Figure 1c).
In adults, the highest expression level of GPR173 was found in the omasum, followed by the ileum, while the lowest level was observed in the duodenum (p < 0.01). In calves, the highest transcript level was also observed in the omasum, and lowest in the duodenum (p < 0.01). In the ileum of adult individuals, GPR173 expression level was significantly higher compared to calves (p = 0.002, ES: 1.77, FC: 2.62). On the contrary, in the colon of calves, GPR173 expression levels were higher compared to those of adults (p < 0.001, ES: 0.60, FC: 2.88) (Figure 1d).
LEP expression level in the adult ileum was significantly higher than in other tissues (p < 0.01), and this segment, along with the jejunum, also showed significantly higher expression in adult individuals compared to calves (p < 0.001, ES: 3.67, FC: 1.41 for ileum, and p = 0.008, ES: 1.11, FC: 1.73 for jejunum). The lowest LEP expression level in adults was observed in the rumen. On the contrary, the transcript level in the omasum of calves was significantly higher compared to that of adults (p < 0.001, ES: 2.29, FC: 2.01) and it was the segment with the highest transcript level in calves (p < 0.01) (Figure 1e).
The highest level of LEPR was observed in the adult ileum, while the lowest expression was found in the rumen (p < 0.01). In calves, the highest mRNA expression was observed in the omasum, while significantly lower mRNA expression was observed in the remaining segments (p < 0.01). Significant differences in LEPR expression levels were observed between age groups, with higher expression in the omasum of calves compared to adults (p < 0.001, ES: 2.27, FC: 3.32), and higher expression in the jejunum of adults (p = 0.009, ES: 1.03, FC: 1.92) (Figure 1f).
The expression level of NUCB2 was relatively consistent among segments, with the lowest expression in the jejunum both in adults and calves (p < 0.01). Significant differences in NUCB2 expression were observed between age groups. In the rumen, the expression of NUCB2 was higher in calves compared to adult individuals (p = 0.008, ES: 2.41, FC: 1.73), while in the ileum NUCB2 expression was significantly higher in adult individuals (p < 0.001, ES: 2.59, FC: 2.05) (Figure 1g).
In summary, as shown in Figure 1h, the interaction between the GIT segment and age, as well as both the GIT segment and age alone, had a significant impact on the relative GPR173, GHSR, and LEP expression levels. In the case of LEPR and NUCB2, both GIT segment and GIT segment × age interaction had a significant impact on expression levels; finally, age was the only factor significantly affecting SMIM20 and GHRL expression levels.
2.2. Correlations between Expression Levels
Multiple significant positive correlations were found among the expression levels of the studied genes in both calves and adults. A thorough analysis is shown in Figure 2a–i. The highest number of positive correlations was observed between the expression levels of LEP and GHSR in adult individuals. These correlations were present in seven out of the nine examined segments but were not found in the first (rumen) and last (rectum) segments. In calves, the highest number of positive correlations was noted in the omasum, while in adults it was in the abomasum which presented the greatest number of positive correlations. Positive correlations between the ligand (LEP) and its receptor (LEPR) were identified in the stomach (omasum and abomasum) of both calves and adults, as well as in the reticulum and duodenum of calves. Ligand–receptor correlations were also observed between the remaining pairs: GHRL/GHSR in the omasum, jejunum, and rectum of calves, and in the abomasum and jejunum of adults; SMIM20/GPR173 in the rumen and omasum of calves and the rumen and omasum of adults; NUCB2/GHSR in the ileum of calves, and the reticulum and omasum of adults.
Figure 2.
Correlation plot analysis. The correlation among expression patterns for GHRL, GHSR, SMIM20, GPR173, LEP, LEPR, and NUCB2 in (a) rumen, (b) reticulum, (c) omasum, (d) abomasum, (e) duodenum, (f) jejunum, (g) ileum, (h) colon, and (i) rectum, for both calves and adult individuals. The correlation type is indicated by the color, with blue representing a positive correlation and red representing a negative correlation. The size of the dots reflects the magnitude of the correlation coefficient. Statistically significant correlations are marked with asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001). The total number of significant (j) positive and (k) negative correlations among the expression levels of the seven analyzed genes in the GIT segments for calves and adults is presented.
2.3. Heatmap Analysis
The heatmap analysis showed that, in most GIT segments, gene expression patterns were similar between calves and adults. However, a remarkable disparity in gene expression between the two groups was found in the ileum, as the pattern of genes expression in the adults’ ileum is clustered with genes expression pattern in the omasum of calves and adults. Generally, the highest levels of gene expression were found in the forestomachs and abomasum. No clustering was observed based on the peptide type (orexigenic/anorexigenic) (Figure 3).
Figure 3.
Heatmap and dendrogram of hierarchical clustering based on the z-score of gene expression. The heatmap illustrates the GIT segment-specific expression patterns of GHRL, GHSR, SMIM20, GPR173, LEP, LEPR, and NUCB2 genes in both calves and adult individuals. Expression levels are represented as z-scores calculated per row (per gene) to highlight variations in the average expression of each gene across the GIT segments in both calves and adults. The x-axis represents sampled tissues, using the prefix “c” for calves and “a” for adults.
3. Discussion
In livestock animals, such as domestic cattle, optimal nutrition and consistent weight gain are important factors. These not only impact production efficiency, but further influence the health, longevity, and quality of products such as meat and dairy [15,16]. With such implications, studies on feed intake regulation and related genes are highly valuable [17,18]. While all mammals have a natural mechanism to regulate food intake, it is not uniform across all species. Various factors such as dietary needs, lifestyle, and evolutionary changes explain some of these differences, but some shared mechanisms and communication pathways are present in different mammalian species. In most mammals, the hypothalamus is the main area for the regulation of food intake, with a focus on the arcuate nucleus (ARC) and nucleus tractus solitarus (NTS). These areas process and integrate signals of satiety and hunger from the body, leading to the secretion of various anorexigenic and orexigenic compounds. This then triggers either a catabolic pathway for anorexigenic peptides or an anabolic pathway for orexigenic peptides, which, in turn, involve other brain structures. Hypothalamic neurons in areas responsible for satiety and hunger can be activated by different factors, including regulatory proteins which were the main focus of this study [1,19].
One of the best-known orexigenic proteins is ghrelin, which was isolated from the rat stomach and identified in 1999 by Kojima et al. [20] as a result of their search for a ligand for the orphan receptor GHS-R [20]. It is derived from the precursor protein proghrelin [21]. The earliest known functions of ghrelin include stimulating food intake, influencing lipid metabolism, and regulating growth hormone release [22,23]. Ghrelin also acts locally at GIT to regulate motility and gastric acid secretion [24]. Considering its numerous functions, ghrelin is an important target for potential therapies addressing numerous conditions, including obesity. The initial study on ghrelin expression conducted by its discoverers suggested that the stomach might be its primary source [20]. This pattern of expression has remained consistent for over 20 years, and our results align with it, as the highest expression level was found in the abomasum, followed by the duodenum. However, literature data on the expression of ghrelin in the GIT of domestic cattle are very limited. In a 2020 study, Hayashi et al. [13] examined the level of ghrelin expression in the organs of the GIT of adult Holstein cows and 2-week-old male Holstein calves, simultaneously comparing expression levels between the two age groups. They detected the presence of ghrelin mRNA in all examined sections, namely the rumen, reticulum, omasum, abomasum, duodenum, jejunum, ileum, and colon. However, in both cows and calves, the level of ghrelin expression in the abomasum exceeded the expression levels found in the other organs [13]. Ding et al. [25] conducted an analysis of ghrelin expression in yaks, comparing it with the expression in domestic cattle. However, among the organs analyzed, only two, the abomasum and the duodenum, came from the GIT. The level of ghrelin in the abomasum exceeded the expression level in the duodenum for both cattle and yaks [25]. The level of ghrelin expression in the GIT was also analyzed in another large ruminant, the reindeer. Here, again, expression was observed throughout the entire GIT from the esophagus to the colon, with the highest level in the abomasum, followed by the esophagus and duodenum [26]. Moreover, studies involving sheep, an example of small ruminant, showed the presence of ghrelin mRNA in all chambers of the stomach and in the small intestine, with the highest expression in the abomasum [27,28]. These studies are consistent with similar research conducted on other mammalian species, such as humans [29], pigs [30], mice [31], and guinea pigs [32]. Ding et al. [25] indicated that ghrelin is a protein with significant conservation across species, and, when combined with consistent findings from diverse animal research, this might underscore its pivotal role. The predominant expression of ghrelin in the abomasum implies its potential involvement in managing food consumption in domestic cattle. Furthermore, in our study, GHRL expression level did not differ between groups, suggesting that the ghrelin production is not influenced by the developmental stage of the GIT. However, its activity could be modulated by the transcription of its receptor, as we observed that GHSR transcription in the small intestine was dependent on age.
Building upon what has been mentioned previously, ghrelin operates via the GHS-R receptor. It is noteworthy that ghrelin activity hinges on the receptor specific variant. The GHS-R splits into two subtypes, GHS-R1a and GHS-R1b, with ghrelin connecting through GHS-R1a [7]. In the available literature, there is a noticeable gap concerning the expression of GHSR in the GIT of cattle. However, with respect to human tissues, Ueberberg and his team [29] studied healthy human organs, including sections of the GIT, and found GHSR mRNA in the stomach and, to a lesser extent, in the ileum. This is in line with our research, but, in contrast to our study, no expression was found in the colon [29]. On the other hand, studies conducted on young Tibetan and Yorkshire pigs have revealed GHSR mRNA expression in all examined organs of the GIT, namely the stomach, small intestine, cecum, and colon. The highest expression levels have been found in the duodenum and jejunum [33]. The expression of GHSR has also been studied in rat and guinea pig GIT organs. Expression has been demonstrated in rats, i.e., in the stomach, all sections of the small intestine, colon, and cecum, with the highest level of expression found in the stomach. Interestingly, GHSR expression was not found in the same tissues in guinea pigs [34]. Results of our study may indicate that ghrelin, or other GHSR ligands, have a direct effect on the bovine GIT. Furthermore, GHSR expression level was higher in the jejunum and ileum of adults compared to those of calves, indicating the potential role of this receptor in nutrient absorption. While the calves we studied have a well-developed digestive tract, the latter is still undergoing growth and development and may differ physiologically from that of adult cattle. Our study suggests that the ghrelin receptor may be one of the factors that develop with age to regulate food absorption.
Anorexigenic nesfatin-1, in spite of its opposing action to ghrelin, shares many features with this peptide. Firstly, it is speculated that nesfatin-1 may act as a ligand for the ghrelin receptor GHS-R1a [35,36,37]. Secondly, both hormones are known to be colocalized in X/A-like cells in the oxyntic glands in the fundus of the stomach, as well as in the pancreas, hypothalamus, and intestine. Additionally, both peptides are formed by enzyme prohormone convertase (PC) 1/3, which converts pro-protein (in the case of nesfatin-1, NUCB2) to their final forms [37]. These similarities, along with their opposing effects on appetite, suggest the need for further research into the interaction between ghrelin and nesfatin-1. As noted in a previous review article, nesfatin-1 has been found to play a protective role in GIT disorders [38]. While its expression in the GIT of cattle has not yet been studied, research has found nesfatin-1 expression in the stomach and intestines of other species, such as rats, mice, and dogs, where the expression level of NUCB2 in the stomach consistently exceeds that found in the intestines [38,39]. This study is the first to examine NUCB2 expression across all segments of the digestive tract in domestic cattle, from the rumen to the rectum. The expression level remained relatively consistent and showed a decrease with age only in the rumen. It is worth noting that in calves the development of the forestomachs is concomitant to the initiation of solid food consumption [40]. Consequently, nesfatin-1 may play a supportive role in organ development. In the ileum, higher expression of nesfatin-1 was noted in adult individuals, a phenomenon which could indicate that nesfatin-1 has other or more complex roles in the mature intestine. One aspect that needs further investigation is whether nesfatin-1 affects the expression level of GHSR, as it is a possible ligand for GHSR. Our study suggests a potential relationship between the two, as both NUCB2 and GHSR expression levels were found to be higher in adults than in calves, possibly due to increased food absorption in adults. Additionally, given that nesfatin-1 can permeate the blood–brain barrier [41], it is plausible to infer that some of this expression facilitates its anorexigenic central action. However, as previously mentioned, there are indications pointing toward nesfatin local activity in the GIT. Therefore, the findings of this study suggest that nesfatin-1 may also exert its local influence on the GIT of domestic cattle and one of the mechanisms may be increased nutrient absorption.
Leptin is a key regulator of the body energy homeostasis, playing an important role in modulating hunger and energy consumption. Primarily produced by adipocytes or fat cells, leptin serves as an indicator to the brain regarding the body fat storage levels. As these levels increase, more leptin is generated, resulting in reduced hunger and increased energy use. On the other hand, when the body fat levels decrease, the production of leptin decreases, causing an increase in appetite and decrease in energy consumption [42]. Interestingly, available studies contrast with ours, as Chelikani et al. [43] noted the absence of LEP mRNA in the GIT of calves of domestic cattle [43]. However, it should be noted that in this research PCR products were analyzed semi-quantitatively on agarose gel after electrophoresis, while in the present study real-time PCR was used. Another research endeavor by Hayashi et al. [13] showed the expression of LEP mRNA in all sections of the GIT, but only in unweaned calves. In contrast, in adults, the expression was minimal and significantly lower compared to calves [13]. The difference between the present study and that of Hayashi et al. [13] was age and sex of the study subjects: 2-year-old males vs. 5-year-old females (adults) and 7-month-old males vs. 2-week-old males (calves). Furthermore, in a 2002 study, LEP expression in the rumen, abomasum, and duodenum was observed only in 3-week-old calves. In older calves and adults, LEP mRNA was found only in the duodenum. The same study also showed that, in older calves fed with replacement milk, LEP expression also appeared in the rumen and abomasum [44]. Additionally, another study showed a lack of LEP expression in the duodenum of dairy cows [45]. This suggests that there may be age, sex, or nutritional-status-related differences that affect the regulation of leptin production in the GIT of cattle. Further research in this area would help better understand these differences and their potential implications for cattle health and production, especially since leptin was present throughout the GIT in our study, including in adult individuals. However, the lack of LEP expression in the previous studies is intriguing, as leptin immunoexpression has been found in bovine GIT [13] and LEP mRNA has been confirmed to be present in the stomach of rats [46] and humans [47]. In the present study, LEP expression level in the omasum of calves was higher than that found in the omasum of adult cattle. As we mentioned earlier, the calves in our study had a relatively well-developed, yet still developing GIT. The forestomachs are the sections where a great deal of change takes place as the ruminant develops. Therefore, further research should investigate the potential function of leptin in the developing calf stomach, as it may play a different role than an anorexigenic peptide. Additionally, in the jejunum and ileum of adult cattle, LEP expression level was higher than in calves. Again, as mentioned above, these segments are heavily involved in nutrient absorption; therefore, leptin, along with the ghrelin receptor, may play a role in this process.
The leptin receptor, known as Lep-R or Ob-R, is part of the type I cytokine receptor group and has six different isoforms, specifically Lep-Ra-f [48]. Research in domestic cattle GIT has shown occurrence of the gene expression in sections such as the abomasum, duodenum, jejunum, and ileum [43]. Interestingly, Alam et al. [45] found no expression of the leptin receptor gene in the duodenum of dairy cows, similarly to findings regarding the leptin gene itself [45]. Studies on other species have revealed the presence of LEPR mRNA in the human stomach [47] and the stomach and intestines of mice [49]. The present research indicates that the expression pattern of the leptin gene closely matches that of its receptor, suggesting that the ligand might regulate the receptor expression and that leptin may have specific functions in the digestive tract. Studies have demonstrated that leptin may modulate the absorption of macronutrients and influence motility in other species [8]. This is in line with the fact that, in adults, levels of expression for both LEP and its receptor LEPR were elevated in sections responsible for nutrient absorption. Additionally, both LEP and LEPR expression levels were significantly higher in the omasum of calves, a phenomenon which may indicate a role played by leptin in the development of this forestomach.
Phoenixin-14, discovered in 2013, emerges from the precursor protein SMIM20 as one of its isoforms. It is known to function as an orexigenic peptide, but its role in the GIT is not well understood. While phoenixin-14 expression at the protein level in the GIT has been demonstrated, there is a lack of literature on its precursor SMIM20 mRNA expression [50]. Phoenixin-14, which shows considerable homology between species, acts as a ligand for GPR173, a receptor from the G-protein coupled receptor family. This is particularly intriguing, as these receptors are often responsible for relaying important signals [51]. The mRNA expression of GPR173 in the GIT has not been previously quantified. This study aims to provide the first description of SMIM20 and GPR173 expression in the GIT of bovines. The results suggest that SMIM20 mRNA expression is highest in the initial segments of the digestive tract and gradually decreases. In contrast, GPR173 expression is highest in the omasum. This could suggest that phoenixin-14, produced mainly in the rumen and reticulum, has a primary effect in the omasum, potentially playing a role in regulating muscular contractions in this segment. However, it is important to note that mRNA levels do not always match protein levels. Therefore, a further investigation is needed to fully understand the role of phoenixin-14 in the bovine digestive system. GPR173 expression level was higher in adults’ ileum and colon compared to those of calves. This suggests that phoenixin-14 or another unknown ligand for GPR173 may modulate nutrient and/or water absorption.
An interesting observation from the study is that the levels of genes encoding the only two orexigenic peptides examined in the study, ghrelin and phoenixin-14, were not age-dependent (Figure 1h). This could suggest that orexigenic mechanisms in GIT develop earlier in an animal’s life than anorexigenic ones. However, further research is needed to examine this matter, as no such conclusions can be drawn from the results of the two peptides. On the contrary, the expression levels of their receptors were age-dependent (Figure 1h).
In the correlation analysis, a large number of positive correlations in gene expression was noted, which may suggest close working and mutual regulation. Especially in the case of leptin and its receptor, recurring positive correlations were noted. It is worth mentioning that one of the Ob-R isoforms (Ob-Re) can regulate serum leptin concentrations [48], and further studies are needed to examine such relationships in the GIT. Other ligand–receptor correlations were found, as described in the Results sections; however, they differed between groups, while the correlations between leptin and its receptor were similar in both age groups. The most frequent positive correlations were found to occur between the GHSR and LEP expression levels. This may seem a coincidence, as the GHSR encodes a receptor for ghrelin, which in turn acts in opposition to leptin encoded by the LEP. However, a study previously cited by us showed a similar pattern of GHSR and LEP gene expression in pigs [33]. As similar results were obtained in studies with two different species, this aspect needs to be carefully examined in future studies.
The heatmap analysis suggests a potential outlier in the data from the ileum of adult cattle, mainly due to the upregulated expression of NUCB2, LEPR, and LEP. Further investigation is necessary, as mentioned previously in relation to LEP. This potential outlier may be related to the role of these proteins in water and nutrients absorption. A speculative hypothesis could be a connection between these peptides and the absorption of vitamin B12 and other fat-soluble vitamins. Given that the ileum plays a key role in this process [52], exploring this possibility could be worthwhile. Additionally, in the heatmap analysis, a clustering between GHRL and NUCB2 can be noted. This is an interesting observation considering the previously mentioned aspects, such as the colocalization of the two peptides encoded by these genes, the sharing of the enzyme, or the potential sharing of the receptor.
Understanding the regulation of food intake in livestock animals, such as cattle, is important for the optimization of meat and dairy production, promotion of sustainable farming, and improvement of animal welfare [53]. Therefore, this aspect is not only significant economically, but also ethically. Furthermore, dairy cows are proposed as a model for the study of food intake in humans, as they share more similarities with humans than the commonly used rodents, e.g., rats or mice. This is because humans and cattle both have a common circadian rhythm, which is significant in nutrition [54].
The limitation of our study is the sample size, which may be considered small. Despite setting a stricter-than-usual significance threshold, this might have influenced our statistical analysis. Nevertheless, a sample size of six or less per group has been previously used in the evaluation of mRNA expression of genes coding for GIT hormones in cattle [13,25], other ruminants [26,27,28,43,44], farm animals [30,33], and even laboratory animals [31,34]. Nonetheless, we believe that this limitation does not completely undermine the novelty of our study. This study, in fact, is the first to report mRNA expression of genes encoding phoenixin-14, nesfatin-1, and GPR173 in the GIT of cattle. We also validated previous reports about the absence of expression of some genes in specific GIT segments in cattle, such as GHSR in the colon [29] and LEP in the duodenum [45], which, however, were detected in our study. We are of the view that conducting experiments on tissues obtained from healthy cattle during standard culling, specifically from those without pre-existing gastrointestinal conditions and whose carcasses are designated for commercial purposes and consumption, holds significant value for veterinary science, sustainable farming, and human nutrition. Nevertheless, further studies with a larger sample size are recommended to more comprehensively clarify the expression patterns of these genes in domestic cattle of different ages, sexes, or breeds. The accumulation of such data over time can provide deeper insights into the roles of these orexigenic and anorexigenic peptides and their receptors in the GIT of these significant polygastric herbivores.
4. Materials and Methods
4.1. Animals
The study was conducted on healthy male domestic cattle from the Polish Holstein–Friesian breed aged 20–24 months and weighing 768 ± 46 kg (n = 6, adults) and aged 7–8 months weighing 218 ± 23 kg (n = 6, calves). All animals, both calves and adults, came from the same farm, lived in the same environment, followed the same feeding regimen, and were the only animals slaughtered that day. The cattle were fed in a semi-intensive system. This entailed a period of grazing on pasture, followed by the total mixed ration (TMR) feeding method [55]. Tissue samples for the study were collected at the local cattle slaughterhouse. The selected animals showed good health, and post-mortem analyses did not reveal any pathologies in the digestive tract. Therefore, the collected material was representative of healthy individuals. The animals were fasted for 18 h before slaughter. Sections of the GIT, namely the rumen, reticulum, omasum, abomasum, duodenum, jejunum, ileum, colon, and rectum, were taken, ensuring that all layers of the respective section were present in the excised fragment (total of 54 samples in each age group). The tissues were rinsed immediately after collection with a physiological saline solution and placed in liquid nitrogen, then frozen at −80 °C. All samples were taken within 15 min of slaughter. According to Polish law, since all tissue collection procedures were conducted post-mortem, ethical review and approval from the Ethics Committee for this study were not required.
4.2. Real-Time qPCR Gene Expression Measurement
Tissue fragments were excised from the collected samples, ensuring that they encompassed all layers of the respective section. Subsequently, total RNA was isolated using the PureLink RNA Mini Kit (Invitrogen, Waltham, MA, USA) and following the manufacturer’s provided protocol. The isolated material was further purified from genomic DNA by incubating it with DNase I (PureLink DNase Set; Invitrogen, Waltham, MA, USA). Next, the concentration and purity of the isolated RNA were measured using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), and its integrity was assessed via electrophoresis on a 2% agarose gel. Total RNA in the amount of 300 ng was reverse transcribed into cDNA using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Waltham, MA, USA). The resulting cDNA was subjected to real-time PCR analysis to measure the expression of mRNA genes GHRL, GHSR, SMIM20, GPR173, LEP, LEPR, and NUCB2, which encode ghrelin, GHS-R, phoenixin-14, GPR173, leptin, LEP-R, and nesfatin-1, respectively. ACTB and RPS9 were used as housekeeping genes [56]. The primer sequences (see Table 1) were designed in Primer3web [57] and obtained from Genomed (Genomed, Warszawa, Poland). The primers for each qPCR amplicon were designed to span introns and were ideally located in different exons to prevent DNA amplification. Real-time PCR analysis was performed on a QuantStudio 7 Flex (Applied Biosystems, Waltham, MA, USA), utilizing RT PCR Mix SYBR Green with HiROX, according to the protocol (A&A Biotechnology, Gdańsk, Poland). Each sample was subjected to three technical replicates for the reactions. The parameters were as follows: pre-run at 95 °C for 3 min, 45 cycles with a denaturation step at 95 °C for 15 s, annealing at 57 °C for 30 s and an extension step at 72 °C for 30 s. The amplicon efficiency was determined by analyzing the slope coefficient of the standard curve derived from serial dilutions of pooled cDNA (E = efficiency (10[−1/slope]). Using the −ΔΔCT method, the relative expression of GHRL, GHSR, SMIM20, GPR173, LEP, LEPR, and NUCB2 genes was calculated [58].
Table 1.
Primers used in the study.
| Gene | Primer Sequences (5′ to 3′) 1 | Product Length (bp) | GeneBank Accession Number | qPCR Efficiency |
|---|---|---|---|---|
| GHRL | F: 133 TCAGGCAGACTGAAGCCCCG R: 223 GGATTTCCAGCTCGTCCTCTGC |
91 | NM_174067.2 | 1.98 |
| GHSR | F: 622 CGCTCCGGACTGCTCACAGT R: 842 AAGGGCAGCCAGCAGAGGAT |
221 | NM_001143736.2 | 2.00 |
| SMIM20 | F: 229 GCCATAAATCGAGCTGGTAT R: 376 TGCTGCAGAACTGAAAGCAT |
148 | NM_001145428.1 | 1.96 |
| GPR173 | F: 843 GCAAGATTGTGGCCTTTATGGCTG R: 961 CATGCGCTTGGCATAGAAG |
119 | NM_001015604.1 | 1.83 |
| LEP | F: 46 AAATGCGCTGTGGACCCCTGT R: 245 GAGCCCAGGGATGAAGTCCAA |
200 | NM_173928.2 | 2.00 |
| LEPR | F: 1781 AATCTGCCAGTCTCCCAGTG R: 1897 CAACTGTGTGGGCTGGAGTA |
117 | NM_001012285.2 | 1.97 |
| NUCB2 | F: 276 AAAAGCTCCAGAAAGCAGACA R: 393 GCCACTTCTTGCCTTTTCAG |
118 | NM_001075381.1 | 1.98 |
| ACTB | F: 795 TCCCTGGAGAAGAGCTACGA R: 927 AGGTAGTTTCGTGAATGCCG |
133 | NM_173979.3 | 2.02 |
| RPS9 | F: 128 CCTCGACCAAGAGCTGAAG R: 191 CCTCCAGACCTCACGTTTGTTC |
64 | NM_001101152.2 | 2.00 |
1 The numbers indicate the position at which the respective primers bind to the target genes (bp in 5′ to 3′ direction).
4.3. Statistical Analysis
Statistical analyses were conducted using the Statistica software (v. 13.0, TIBCO Software Inc., Palo Alto, CA, USA), GraphPad Prism software (v. 10.1.0, GraphPad Software, San Diego, CA, USA), and R software, v. 4.3.1 [59]. To evaluate differences in mRNA expression across GIT sections, relative quantification data were log2 transformed for normalization, and the data normality was confirmed using the Shapiro–Wilk test. The data were analyzed using a two-way ANOVA, with the general linear model including each gene as a dependent variable and GIT segment, age, and their interaction as the independent effects. Model residuals were tested to validate the assumption of normality and homoscedasticity using QQ-plots, the Shapiro–Wilk test, and residual–fitted values plots. Tukey’s HSD post hoc test, as recommended by the GraphPad software, was applied for correction of multiple comparison tests using statistical hypothesis testing. A multiplicity-adjusted p-value < 0.01 was considered statistically significant, accounting for multiple comparisons against a family-wise alpha error threshold set to 0.01 (99% confidence interval). This stricter-than-usual threshold was chosen to limit the number of statistically significant findings. Additionally, Cohen’s d was used as an indicator of effect size of all significant differences in gene expression within specific GIT segments between calves and adults.
Correlation plots illustrating the expression patterns of the analyzed genes in GIT sections were generated using the corrplot package in R. Significant correlations are indicated by asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001). The heatmaps depicting gene expression data were produced using the pheatmap package in R, after scaling the fold change profiles of each gene individually using the z-score formula (z-score = (individual gene value − mean gene value)/SD).
5. Conclusions
This study revealed consistent mRNA presence for all examined genes across various GIT segments in both calves and adult cattle, emphasizing their importance in GIT organs. Notable expression differences were observed between the two age groups, particularly in the rumen, omasum, jejunum, ileum, and colon, suggesting that peptide activity regulating food intake varies with developmental stages. In adults, heightened expression of GHSR, GPR173, LEP, and NUCB2 in the small and large intestines implies they play a role in nutrient absorption. Conversely, elevated levels of LEP, LEPR, and NUCB2 in the omasum and rumen of calves underline their possible importance in the development of bovine forestomachs. The study also found that the expression of orexigenic peptides GHRL and SMIM20 is not dependent on age, suggesting more uniform mechanisms for orexigenic processes compared to anorexigenic ones.
Author Contributions
Conceptualization, K.K. and M.B.A.; methodology, K.K. and K.R.-M.; software, S.M.; validation, K.R.-M. and S.M.; formal analysis, K.K.; investigation, K.K.; resources, K.K.; writing—original draft preparation, K.K.; writing—review and editing, M.B.A., S.M., K.R.-M., and K.K.; visualization, K.K. and S.M.; supervision, M.B.A.; funding acquisition, K.K. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
Ethical approval from the Ethics Committee was not required for this study, as all procedures were conducted postmortem on carcasses from animals designated for commercial purposes and consumption and slaughtered using conventional methods in a slaughterhouse. The process of slaughter and all post-slaughter operations were carried out in accordance with Council Regulation (EC) No. 1099/2009 of 24 September 2009. The animals were immobilized, stunned with a mechanical device, and bled out by severing the jugular veins were waived for this study due to the post-mortem nature of material collection.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data will be made available on the request.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This research was supported by project no. WKN/MN-1/WET/22, provided by the University of Life Sciences in Lublin, Poland, for Katarzyna Kras.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Cifuentes L., Acosta A. Homeostatic regulation of food intake. Clin. Res. Hepatol. Gastroenterol. 2022;46:101794. doi: 10.1016/j.clinre.2021.101794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Konturek S.J., Konturek J.W., Pawlik T., Brzozowski T. Brain-gut axis and its role in the control of food intake. J. Physiol. Pharmacol. 2004;55:137–154. [PubMed] [Google Scholar]
- 3.Székely M., Soós S., Pétervári E., Balaskó M. Chapter 14—Nutritional Impact on Anabolic and Catabolic Signaling. In: Malavolta M., Mocchegiani E., editors. Molecular Basis of Nutrition and Aging. Academic Press; Cambridge, MA, USA: 2016. pp. 189–204. [Google Scholar]
- 4.Gershon M.D., Margolis K.G. The gut, its microbiome, and the brain: Connections and communications. J. Clin. Investig. 2021;131:e143768. doi: 10.1172/JCI143768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Gonkowski S. Aquaporins in the nervous structures supplying the digestive organs—A review. Ann. Anim. Sci. 2021;21:47–61. doi: 10.2478/aoas-2020-0060. [DOI] [Google Scholar]
- 6.Kentish S.J., Page A.J. The role of gastrointestinal vagal afferent fibres in obesity. J. Physiol. 2015;593:775–786. doi: 10.1113/jphysiol.2014.278226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Howick K., Griffin B.T., Cryan J.F., Schellekens H. From Belly to Brain: Targeting the Ghrelin Receptor in Appetite and Food Intake Regulation. Int. J. Mol. Sci. 2017;18:273. doi: 10.3390/ijms18020273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Yarandi S.S., Hebbar G., Sauer C.G., Cole C.R., Ziegler T.R. Diverse roles of leptin in the gastrointestinal tract: Modulation of motility, absorption, growth, and inflammation. Nutrition. 2011;27:269–275. doi: 10.1016/j.nut.2010.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wren A.M., Bloom S.R. Gut hormones and appetite control. Gastroenterology. 2007;132:2116–2130. doi: 10.1053/j.gastro.2007.03.048. [DOI] [PubMed] [Google Scholar]
- 10.Zac-Varghese S., Tan T., Bloom S.R. Hormonal interactions between gut and brain. Discov. Med. 2010;10:543–552. [PubMed] [Google Scholar]
- 11.Pałasz A., Rojczyk E., Bogus K., Worthington J.J., Wiaderkiewicz R. The novel neuropeptide phoenixin is highly co-expressed with nesfatin-1 in the rat hypothalamus, an immunohistochemical study. Neurosci. Lett. 2015;592:17–21. doi: 10.1016/j.neulet.2015.02.060. [DOI] [PubMed] [Google Scholar]
- 12.Herring A.D. Beef Cattle. In: Van Alfen N.K., editor. Encyclopedia of Agriculture and Food Systems. Academic Press; Cambridge, MA, USA: 2014. pp. 1–20. [DOI] [Google Scholar]
- 13.Hayashi H., Yamakado M., Yamaguchi M., Kozakai T. Leptin and ghrelin expressions in the gastrointestinal tracts of calves and cows. J. Vet. Med. Sci. 2020;82:475–478. doi: 10.1292/jvms.19-0680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.König H.E., Liebich H.-C. Veterinary Anatomy of Domestic Mammals. Textbook and Colour Atlas. Schattauer; Stuttgart, Germany: 2014. pp. 375–384. [Google Scholar]
- 15.Prodanović R., Nedić S., Simeunović P., Borozan S., Nedić S., Bojkovski J., Kirovski D., Vujanac I. Effects of chestnut tannins supplementation of prepartum moderate yielding dairy cows on metabolic health, antioxidant and colostrum indices. Ann. Anim. Sci. 2021;21:609–621. doi: 10.2478/aoas-2020-0077. [DOI] [Google Scholar]
- 16.Tirado-González D., Tirado-Estrada G., Miranda-Romero L., Ramírez-Valverde R., Medina-Cuéllar S., Salem A. Effects of Addition of Exogenous Fibrolytic Enzymes on Digestibility and Milk and Meat Production—A Systematic Review. Ann. Anim. Sci. 2021;21:1159–1192. doi: 10.2478/aoas-2021-0001. [DOI] [Google Scholar]
- 17.Mazinani M., Memili E., Rude B. Harnessing the Value of Rumen Protected Amino Acids to Enhance Animal Performance—A Review. Ann. Anim. Sci. 2022;22:43–62. doi: 10.2478/aoas-2021-0018. [DOI] [Google Scholar]
- 18.Tyra M., Ropka-Molik K., Piórkowska K., Szyndler-Nędza M., Małopolska M., Babicz M., Mucha A., Żak G., Eckert R. Association of ghrelin gene polymorphisms with slaughter traits in pig. Ann. Anim. Sci. 2023;23:431–437. doi: 10.2478/aoas-2022-0097. [DOI] [Google Scholar]
- 19.Valassi E., Scacchi M., Cavagnini F. Neuroendocrine control of food intake. Nutr. Metab. Cardiovasc. Dis. 2008;18:158–168. doi: 10.1016/j.numecd.2007.06.004. [DOI] [PubMed] [Google Scholar]
- 20.Kojima M., Hosoda H., Date Y., Nakazato M., Matsuo H., Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature. 1999;402:656–660. doi: 10.1038/45230. [DOI] [PubMed] [Google Scholar]
- 21.Zhu X., Cao Y., Voogd K., Steiner D.F. On the processing of proghrelin to ghrelin. J. Biol. Chem. 2006;281:38867–38870. doi: 10.1074/jbc.M607955200. [DOI] [PubMed] [Google Scholar]
- 22.Kojima M., Kangawa K. Ghrelin: Structure and function. Physiol. Rev. 2005;85:495–522. doi: 10.1152/physrev.00012.2004. [DOI] [PubMed] [Google Scholar]
- 23.Pradhan G., Samson S.L., Sun Y. Ghrelin: Much more than a hunger hormone. Curr. Opin. Clin. Nutr. Metab. Care. 2013;16:619–624. doi: 10.1097/MCO.0b013e328365b9be. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Cheung C.K., Wu J.C. Role of ghrelin in the pathophysiology of gastrointestinal disease. Gut and liver. 2013;7:505–512. doi: 10.5009/gnl.2013.7.5.505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ding Y., Zhang N., Li J., Jin Y., Shao B. Molecular cloning and expression of ghrelin in the hypothalamus-pituitary-gastrointestinal tract axis of the Yak (Bos grunniens) in the Qinghai-Tibetan Plateau. Anat. Histol. Embryol. 2018;47:583–590. doi: 10.1111/ahe.12400. [DOI] [PubMed] [Google Scholar]
- 26.Zhang M., Zhu X., Xu X., Jin X., Bao H., Dugeer S., Du C., Cao G., Yang Y. Molecular characterization and expression patterns of ghrelin in the reindeer (Rangifer tarandus) Pol. J. Vet. Sci. 2018;21:55–64. doi: 10.24425/119022. [DOI] [PubMed] [Google Scholar]
- 27.Huang Z.G., Xiong L., Liu Z.S., Qiao Y., Dai R., Xie Z., Liu S.R., Shi G.Q., Liu G.Q. The tissue distribution and developmental changes of ghrelin mRNA expression in sheep. Acta Genet. Sin. 2006;33:808–813. doi: 10.1016/S0379-4172(06)60114-5. [DOI] [PubMed] [Google Scholar]
- 28.Wang W., Cheng L., Guo J., Ma Y., Li F. Expression of Ghrelin in gastrointestinal tract and the effect of early weaning on Ghrelin expression in lambs. Mol. Biol. Rep. 2014;41:909–914. doi: 10.1007/s11033-013-2935-2. [DOI] [PubMed] [Google Scholar]
- 29.Ueberberg B., Unger N., Saeger W., Mann K., Petersenn S. Expression of ghrelin and its receptor in human tissues. Horm. Metab. Res. 2009;41:814–821. doi: 10.1055/s-0029-1233462. [DOI] [PubMed] [Google Scholar]
- 30.Dall’aglio C., Zannoni A., Forni M., Bacci M.L., Ceccarelli P., Boiti C. Orexin system expression in the gastrointestinal tract of pigs. Res. Vet Sci. 2013;95:8–14. doi: 10.1016/j.rvsc.2013.02.001. [DOI] [PubMed] [Google Scholar]
- 31.Morash M.G., Gagnon J., Nelson S., Anini Y. Tissue distribution and effects of fasting and obesity on the ghrelin axis in mice. Regul. Pept. 2010;163:62–73. doi: 10.1016/j.regpep.2010.03.010. [DOI] [PubMed] [Google Scholar]
- 32.Okuhara Y., Kaiya H., Teraoka H., Kitazawa T. Structural determination, distribution, and physiological actions of ghrelin in the guinea pig. Peptides. 2018;99:70–81. doi: 10.1016/j.peptides.2017.11.010. [DOI] [PubMed] [Google Scholar]
- 33.Sun W., Cheng C., Liu R., Chen Y., Zeng K., Chen X., Gu Y., Li J., Lv X., Gao R. Expression patterns of GHRL, GHSR, LEP, LEPR, SST and CCK genes in the gastrointestinal tissues of Tibetan and Yorkshire pigs. Czech J. Anim. Sci. 2019;64:239–247. doi: 10.17221/40/2018-CJAS. [DOI] [Google Scholar]
- 34.Kitazawa T., Nakamura T., Saeki A., Teraoka H., Hiraga T., Kaiya H. Molecular identification of ghrelin receptor (GHS-R1a) and its functional role in the gastrointestinal tract of the guinea-pig. Peptides. 2011;32:1876–1886. doi: 10.1016/j.peptides.2011.07.026. [DOI] [PubMed] [Google Scholar]
- 35.Fan X.T., Tian Z., Li S.Z., Zhai T., Liu J.L., Wang R., Zhang C.S., Wang L.X., Yuan J.H., Zhou Y., et al. Ghrelin Receptor Is Required for the Effect of Nesfatin-1 on Glucose Metabolism. Front Endocrinol. 2018;9:633. doi: 10.3389/fendo.2018.00633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rupp S.K., Wölk E., Stengel A. Nesfatin-1 Receptor: Distribution, Signaling and Increasing Evidence for a G Protein-Coupled Receptor—A Systematic Review. Front. Endocrinol. 2021;12:740174. doi: 10.3389/fendo.2021.740174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Chen X., Dong J., Jiao Q., Du X., Bi M., Jiang H. “Sibling” battle or harmony: Crosstalk between nesfatin-1 and ghrelin. Cell Mol. Life Sci. 2022;79:169. doi: 10.1007/s00018-022-04193-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Kras K., Muszyński S., Tomaszewska E., Arciszewski M.B. Minireview: Peripheral Nesfatin-1 in Regulation of the Gut Activity—15 Years since the Discovery. Animals. 2022;12:101. doi: 10.3390/ani12010101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Prinz P., Stengel A. Expression and regulation of peripheral NUCB2/nesfatin-1. Curr. Opin. Pharmacol. 2016;31:25–30. doi: 10.1016/j.coph.2016.08.012. [DOI] [PubMed] [Google Scholar]
- 40.Diao Q., Zhang R., Fu T. Review of Strategies to Promote Rumen Development in Calves. Animals. 2019;9:490. doi: 10.3390/ani9080490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Pan W., Hsuchou H., Kastin A.J. Nesfatin-1 crosses the blood-brain barrier without saturation. Peptides. 2007;28:2223–2228. doi: 10.1016/j.peptides.2007.09.005. [DOI] [PubMed] [Google Scholar]
- 42.Zhang F., Chen Y., Heiman M., Dimarchi R. Leptin: Structure, function and biology. Vitam. Horm. 2005;71:345–372. doi: 10.1016/S0083-6729(05)71012-8. [DOI] [PubMed] [Google Scholar]
- 43.Chelikani P.K., Glimm D.R., Kennelly J.J. Short communication: Tissue distribution of leptin and leptin receptor mRNA in the bovine. J. Dairy Sci. 2003;86:2369–2372. doi: 10.3168/jds.S0022-0302(03)73830-2. [DOI] [PubMed] [Google Scholar]
- 44.Yonekura S., Kitade K., Furukawa G., Takahashi K., Katsumata N., Katoh K., Obara Y. Effects of aging and weaning on mRNA expression of leptin and CCK receptors in the calf rumen and abomasum. Domest. Anim. Endocrinol. 2002;22:25–35. doi: 10.1016/S0739-7240(01)00114-X. [DOI] [PubMed] [Google Scholar]
- 45.Alam T., Kenny D.A., Sweeney T., Buckley F., Prendiville R., McGee M., Waters S.M. Expression of genes involved in energy homeostasis in the duodenum and liver of Holstein-Friesian and Jersey cows and their F(1) hybrid. Physiol. Genomics. 2012;44:198–209. doi: 10.1152/physiolgenomics.00102.2011. [DOI] [PubMed] [Google Scholar]
- 46.Bado A., Levasseur S., Attoub S., Kermorgant S., Laigneau J.P., Bortoluzzi M.N., Moizo L., Lehy T., Guerre-Millo M., Le Marchand-Brustel Y., et al. The stomach is a source of leptin. Nature. 1998;394:790–793. doi: 10.1038/29547. [DOI] [PubMed] [Google Scholar]
- 47.Mix H., Widjaja A., Jandl O., Cornberg M., Kaul A., Göke M., Beil W., Kuske M., Brabant G., Manns M.P., et al. Expression of leptin and leptin receptor isoforms in the human stomach. Gut. 2000;47:481–486. doi: 10.1136/gut.47.4.481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Gorska E., Popko K., Stelmaszczyk-Emmel A., Ciepiela O., Kucharska A., Wasik M. Leptin receptors. Eur. J. Med. Res. 2010;15((Suppl. S2)):50–54. doi: 10.1186/2047-783X-15-S2-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Morton N.M., Emilsson V., Liu Y.L., Cawthorne M.A. Leptin action in intestinal cells. J. Biol. Chem. 1998;273:26194–26201. doi: 10.1074/jbc.273.40.26194. [DOI] [PubMed] [Google Scholar]
- 50.Schalla M.A., Stengel A. Phoenixin—A Pleiotropic Gut-Brain Peptide. Int. J. Mol. Sci. 2018;19:1726. doi: 10.3390/ijms19061726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Rosenbaum D.M., Rasmussen S.G., Kobilka B.K. The structure and function of G-protein-coupled receptors. Nature. 2009;459:356–363. doi: 10.1038/nature08144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.González-Montaña J.R., Escalera-Valente F., Alonso A.J., Lomillos J.M., Robles R., Alonso M.E. Relationship between Vitamin B12 and Cobalt Metabolism in Domestic Ruminant: An Update. Animals. 2020;10:1855. doi: 10.3390/ani10101855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Kizilaslan M., Arzik Y., Cinar M., Konca Y. Genome-wise engineering of ruminant nutrition—Nutrigenomics: Applications, challenges, and future perspectives—A review. Ann. Anim. Sci. 2022;22:511–521. doi: 10.2478/aoas-2021-0057. [DOI] [Google Scholar]
- 54.Allen M.S., Bradford B.J., Harvatine K.J. The cow as a model to study food intake regulation. Annu. Rev. Nutr. 2005;25:523–547. doi: 10.1146/annurev.nutr.25.050304.092704. [DOI] [PubMed] [Google Scholar]
- 55.Włodarczyk R., Budvytis M. Proper nutrition for high yielding cows - how to fully utilize their production potential. [ Życie Weter. 2011;86:771–776. (In Polish) [Google Scholar]
- 56.Janovick-Guretzky N.A., Dann H.N., Carlson D.B., Murphy M.R., Loor J.J., Drackley J.K. Housekeeping gene expression in bovine liver is affected by physiological state, feed intake, and dietary treatment. J. Dairy Sci. 2007;90:2246–2252. doi: 10.3168/jds.2006-640. [DOI] [PubMed] [Google Scholar]
- 57.Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Pfaffl M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.R Core Team . R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing; Vienna, Austria: 2023. [(accessed on 30 December 2023)]. Available online: https://www.R-project.org. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on the request.



