First detection of Candidatus Rickettsia tarasevichiae in Hyalomma marginatum ticks

Abstract

Ticks are important vectors of zoonotic diseases and play a major role in the circulation and transmission of many rickettsial species. The aim of this study was to investigate the carriage of Candidatus Rickettsia tarasevichiae (CRT) in a total of 1168 ticks collected in Inner Mongolia to elucidate the potential public health risk of this pathogen, provide a basis for infectious disease prevention, control and prediction and contribute diagnostic ideas for clinical diseases that present with fever in populations exposed to ticks. A total of four tick species, Haemaphysalis concinna (n = 21), Dermacentor nuttalli (n = 122), Hyalomma marginatum (n = 148), and Ixodes persulcatus (n = 877), were collected at nine sampling sites in Inner Mongolia, China, and identified by morphological and molecular biological methods. Reverse transcription PCR targeting the 16S ribosomal RNA (rrs), gltA, groEL, ompB and Sca4 genes was used to detect CRT DNA. Sequencing was used for pathogen species confirmation. The molecular epidemiological analysis showed that three species of ticks were infected with CRT, and the overall positive rate was as high as 42%. The positive rate of I. persulcatus collected in Hinggan League city was up to 96%, and that of I. persulcatus collected in Hulun Buir city was 50%. The pool positive rates of D. nuttalli and H. marginatum collected in Bayan Nur city and H. concinna collected in Hulun Buir city were 0%, 28% and 40%, respectively. This study revealed the high prevalence of CRT infection in ticks from Inner Mongolia and the first confirmation of CRT detected in H. marginatum in China. The wide host range and high infection rate in Inner Mongolia may dramatically increase the exposure of CRT to humans and other vertebrates. The role of H. marginatum in the transmission of rickettsiosis and its potential risk to public health should be further considered.

Introduction

Rickettsia species are a group of important, obligate intracellular, vector-borne pathogens that cause rickettsioses through arthropod vectors such as fleas, ticks, mites or lice [1–3]. Rickettsial diseases constitute a significant public health concern and impose a substantial economic burden on a global scale [3]. Candidatus Rickettsia tarasevichiae (CRT), an emerging tick-borne human pathogen, was initially detected in Ixodes persulcatus collected from various regions of Russia, including western Siberia, eastern Siberia, and the southern Urals in 2003 [4]. Since then, it has been detected in I. persulcatus, Haemaphysalis japonica douglasi, Dermacentor silvarum, Ixodes pavlovskyi, Ixodes trianguliceps and Haemaphysalis concinna within the territory of Russia [5–9]. The presence of CRT has been further documented in I. persulcatus in Estonia [10], Japan [11, 12], Mongolia [13], Korea [14] and the Chinese-Russian border [6]. It has also been detected in rodents and ticks in the northeastern region of China [15–18]. Few cases have been reported in Inner Mongolia, probably due to misdiagnosis resulting from a lack of understanding of CRT. This means that there is a wide range of invertebrate hosts infected with CRT, which threatens human health in the context of increased human activity in wildlife habitats. Despite the limited reports on CRT in Inner Mongolia [19, 20], this region is of great importance due to its vast land area, ecological and environmental diversity, and rich tick species reserve. Inner Mongolia encompasses three distinct ecological zones, including forest, grassland, and Gobi and semi desertification steppe areas from east to west, which makes it a unique and complex environment for tick-borne diseases. Furthermore, the region spans three climatic zones, from east to west, including temperate semi humid, semi arid, and arid zones, which also contribute to the diversity of tick species and their distribution. Therefore, further research is needed to understand the distribution and prevalence of CRT in Inner Mongolia, which could provide valuable insights into the epidemiology and control of tick-borne diseases in China.

However, recent studies have shown that CRT is pathogenic to humans and can even cause death in humans [21–23]. Human infection with CRT was first reported in northeastern China in 2012 [24]. In 2014, eight patients in eastern central China who were infected with CRT and presented with symptoms resembling severe fever with thrombocytopenia syndrome (SFTS) died as a result of misdiagnosis [22]. In May 2017, a fatal case of tick-borne rickettsiosis caused by mixed Rickettsia sibirica subsp. sibirica and CRT infection was reported in Russia [23].

Ticks are considered second to mosquitoes as vectors of human diseases in the world and can carry and transmit hundreds of pathogens, including viruses, bacteria, protozoa and helminths [25, 26]. The prevalence and biodiversity of Rickettsia spp. in I. persulcatus, H. concinna, H. douglasi, Dermacentor nuttalli and D. silvarum ticks from different regions in Inner Mongolia were examined in our previous study [19, 27, 28]. However, there is a lack of research data on CRT, and it is necessary to investigate the status of CRT infection in Inner Mongolia. To this end, we conducted screening for CRT infection in ticks collected from regions where there have been previous reports of tick-borne pathogens (TBPs) [29].

Materials and methods

Ethics statement

The collection of ticks from the body surface of cattle, sheep and goats in this study was verbally approved by the animals’ owners and performed in strict accordance with the National Guidelines for Experimental Animal Welfare of China (2006–398). In addition, this study was reviewed and approved by the Medical Ethics Committee of Inner Mongolia Medical University (No. YKD202302084).

Sample collection and tick species identification

From May 2021 to May 2023, ticks were collected at nine sampling sites with relatively high tick population densities in three central cities, Hulun Buir, Hinggan League, and Bayan Nur, in Inner Mongolia, China (Fig 1 and Table 1). Ticks were collected directly from domestic animals (cattle, sheep and goats) and grasslands and then brought back to the laboratory alive. The tick species were initially identified based on their morphological characteristics, such as coxae, scutum, genital opening, anal aperture and spiracular plates, using stereomicroscopes [30–34]. The classification was further confirmed through gene sequencing of cytochrome c oxidase subunit 1 (COI) [35] or small subunit 16 S ribosomal RNA (rrs) [36]. Following morphological identification, ticks were stored at −80°C until nucleic acid extraction.

Fig 1. Map of tick collection sites in Inner Mongolia, China.

Map is created using the Software program ArcGIS. Map source: Xinliang Xu. Multi-year administrative division boundary data of Chinese cities and municipalities. Resource and Environmental Science Data Registration and Publication System. (http://www.resdc.cn/DOI), 2023. DOI:10.12078/2023010102.

Table 1. Tick sampling information.

Species of ticks	Group	Animal/Geomorphy	Region	Tick (n)	Coordinate
					Longitude	Latitude
Ixodes persulcatus	D	Forest shrub	HingganLeague	617	120°6’	47°3’
Dermacentor nuttalli	B	Goat/Sheep	BayanNur	118	109°36’	40°55’
				3	107°43’	41°7’
				1	107°59’	41°7’
Hyalomma marginatum	E	Goat	BayanNur	136	109°36’	40°55’
				3	107°43’	41°7’
				2	107°59’	41°7’
				1	106°24’	40°33’
				6	108°32’	41°19’
Ixodes persulcatus	K	Forest shrub	HulunBuir	176	121°51’	51°41’
				84	120°42’	49°17’
Haemaphysalis concinna	G	Cattle/Dog	HulunBuir	21	124°35’	49°45’
Total				1168

Nucleic acid extraction

To eliminate potential impurities and pathogens from the surface of ticks, each tick was immersed in 75% ethanol for three minutes, washed three times with phosphate-buffered saline (PBS), and finally air-dried on sterile filter paper. After being divided into 130 tick pools of 1–50 ticks depending on feeding status and collection location, the ticks were crushed in a mortar with a sterile pestle at a low temperature maintained by liquid nitrogen and placed in a 1.5 ml centrifuge tube. Total RNA was extracted from each tick pool sample using the TransZol Up Plus RNA Kit (TransGen Biotech, China), and cDNA was then obtained using TransScript® II One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China) according to the instructions provided by the manufacturer.

Detection of pathogens

cDNA extracted from ticks was examined using polymerase chain reaction (PCR) targeting the rrs gene, and the amplified gene fragments were sequenced to detect and identify Rickettsiales bacteria in the ticks. For further identification of CRT, the rrs-positive tick samples were further amplified by PCR targeting the gltA, groEL, ompB and Sca4 genes and sequenced. DNA samples were considered CRT-positive when at least two of these four genes were positive.

DNA was amplified using a system of 20 μl, including 11 μL PCR Master Mix (TianGen, China), 1 μl of DNA from each sample, and 0.5 μl each of reverse and forward primer, and filled to volume with double-distilled water. Negative and positive controls were included in each PCR. The amplified PCR products were separated on a 1.5% agarose gel and purified using the Gel DNA Recovery Kit (TianGen, China) according to the manufacturer’s instructions for sequencing. Oligo7 (https://www.oligo.net/downloads.html) was used to design specific primers. The synthesis of primers and sequencing were performed by Sangon Biotech (Shanghai, China). The primers used for amplification are listed in Table 2.

Table 2. Primer sequence list for Candidatus Rickettsia tarasevichiae detection.

Gene	Name	Primer sequence	Annealing temperature(°C)	Amplicon size(bp)
gltA	F	GTCGGTTCTCTTTCAGCATT	57	311
	R	CCGGCAATTCTTACTGTTGA	57
ompB	F	GCAACAACTACAGGAACCAC	56	254
	R	AACTGGCTACTTCCGATAGC	56
16S rRNA	F	TGATCCAGCAATACCGAGT	56	382
	R	TGATCCAGCAATACCGAGT	55
groEL	F	AGGTCCAAAAGGAAGAAACG	56	354
	R	GTACCGACCTGTGCTATTTC	56
sca4	F	CACTGCTCACTACGAAGAAG	56	358
	R	TGAAGATTCAGCTTGTTGCA	56

Phylogenetic analysis

The BLAST nucleotide collection database (nr/nt) was utilized to identify homologies in our gene sequences. The acquired nucleotide sequences from Rickettsiae target genes were edited and assembled using MEGA software version 7.0, while MAFFT v.7.266 was used for multiple nucleotide sequence alignment [37, 38]. Phylogenetic trees were constructed using the maximum likelihood (ML) approach of version 7.0 of the MEGA program, and bootstrap analysis with 1000 replicates was performed to evaluate branch reliability. Branches with values greater than 70% support were deemed significantly different for presentation. The phylogenetic trees were modified and visualized using FigTree v.1.4.3.

Statistical analysis

The gathered data were statistically analyzed using the Statistical Package for Social Sciences Version 21.0 software (SPSS, Chicago, IL, USA). To determine the differences in the positive rate of rickettsiae, the p value was calculated using the Chi-square test or Fisher’s exact test. The statistical significance level was set at p < 0.05.

Results

Species and distribution of the collected ticks

In Inner Mongolia, 1,168 adult ticks were collected from the nine sampling regions of Hulun Buir, Hinggan League, and Bayan Nur. The ticks were all classified as one of four species belonging to four different genera based on their morphological characteristics and gene sequencing data, including H. concinna 2% (21/1168), D. nuttalli 10% (122/1168), H. marginatum 13% (148/1168), and I. persulcatus 75% (877/1168) (Fig 1 and Table 1). Based on the sample point locations, only I. persulcatus 53% (617/1168) were found in Hinggan League. D. nuttalli (10%, 122/1168) and H. marginatum (13%, 148/1168) were discovered in Bayan Nur. I. persulcatus 22% (260/1168) and H. concinna 2% (21/1168) were collected in Hulun Buir (Fig 1 and Table 1). A total of 130 tick pools were created based on region, species, and feeding status for all ticks included in the study. Sequences were entered in GenBank with accession numbers OR272248-OR272253, OR294053-OR294057, OQ852069 and OQ852073.

The phylogenetic trees shown in Fig 2A and 2B are based on the sequences of the rrs and COI genes. The sequences acquired in the present study were clustered with their respective homologs, corresponding to the four species (Fig 2).

Fig 2. Identification of the ticks based on phylogenetic analysis with the rrs gene and COI gene.

The red font indicates the representative sequences from the ticks in the different sampling regions.

Rickettsia bacteria detected in ticks

rrs gene-positive samples were utilized for the identification of CRT-specific segments of the gltA, ompB, gloEL, and sca4 genes. The RT‒PCR results revealed a total positivity rate of 42% (55/130), with the highest pool positivity rate observed in the entire I. persulcatus tick population collected from Hinggan League at 96% (25/26). Additionally, the pool positivity rates for H. marginatum ticks collected from Bayan Nur and for both I. persulcatus and H. concinna ticks collected from Hulun Buir were 28% (14/50), 50% (7/14) and 40% (4/10), respectively. However, no simultaneous detection of two or more CRT-specific genes was observed in any pool of D. nuttalli ticks collected in Bayan Nur (Table 3).

Table 3. Prevalence of Candidatus Rickettsia tarasevichiae detected in tick samples collected in Inner Mongolia, China.

Parameters	NO.tested (n/ %)	The pool positivity rate (n/ %)	X2-value	P
Region
HingganLeague	26/ 20%	25/ 96%	51.965	<0.001
BayanNur	80/ 62%	14/ 18%
HulunBuir	24/ 18%	11/46%
Species of ticks
Dermacentor nuttalli	30/ 23%	0/ 0%	50.232	<0.001
Hyalomma marginatum	50/ 38%	14/ 28%
Ixodes persulcatus	40/ 31%	32/ 80%
Haemaphysalis concinna	10/ 8%	4/ 40%
Species / Region
Ixodes persulcatus/HingganLeague	26/ 20%	25/ 96%	58.422	<0.001
Dermacentor nuttalli/BayanNur	30/ 23%	0/ 0%
Hyalomma marginatum/BayanNur	50/ 38%	14/ 28%
Ixodes persulcatus/HulunBuir	14/ 11%	7/ 50%
Haemaphysalis/concinnaHulunBuir	10/ 8%	4/ 40%
Total(pools)	130	55/ 42%

Analyzing the regional distribution of positive samples, there were differences in the pool positivity rates among the sampling sites. The highest positive rate was found in Hinggan League (25/26, 96%), followed by Hulun Buir (11/24, 46%) and Bayan Nur (14/80, 18%). The analysis results of the collected tick species showed that there were also differences in infection rates among the four different tick species from the genus Ixodes. CRT was the most widely infected and had the highest pool positivity rate among the I. persulcatus ticks (32/40, 80%), followed by H. concinna ticks (4/10, 40%) and H. marginatum ticks (14/50, 28%), and was not detected among the D. nuttalli ticks collected in the present study.

Genetic and phylogenetic analysis

All CRT gene sequences obtained in this study have been deposited into GenBank under accessions OR454091-OR454142, OR449962-OR449989 and OR712487-OR712557. Sequence BLAST analysis showed that the nucleotide similarity between the gltA, groEL, ompB and sca4 genes that we obtained and the corresponding sequences of CRT available in GenBank were 99.55%-100%, 100%, 100%, and 100%, respectively. The nucleotide similarity of all sequences obtained in this investigation to the published sequences on NCBI exceeds 99%.

The ompB gene sequences in this study exhibited the highest similarity with Pr-7477 (OP722685.1) from I. persulcatus in the Far East, Primorsky Krai, Russia [39], while the gltA and groEL gene sequences showed the greatest resemblance to Bayan-68 (MN450397.2, MN450404.2) from I. persulcatus in Harbin, China [40]. Furthermore, the sca4 gene sequence of the Om-111 (OQ540735.1) isolate of I. persulcatus discovered in Western Siberia’s Omsk Province shared a high degree of similarity with the sca4 gene sequences identified in this study.

In the phylogenetic trees constructed in MEGA7 using maximum likelihood (ML) based on the gltA, groEL, ompB, and sca4 genes, the sequences representative of this study were clustered with the corresponding published CRT sequences obtained in NCBI (Fig 3).

Fig 3. Phylogeneic tree based on the gltA, groEL, ompB and sca4 genes of CRT.

The genetic identity among different Rickettsia species was inferred by the maximum-likelihood method implemented in MEGA7 and rooted by the midpoint method. The red font indicates the nucleotide sequences of the gltA, groEL, ompB and sca4 gene segments from CRT in the different sampling regions.

Discussion

In this study, the distribution and prevalence of CRT among four tick species collected from nine sampling sites in three leagues in Inner Mongolia were investigated. A total of 1168 ticks, including D. nuttalli, I. persulcatus, H. concinna, and H. marginatum, were collected for this purpose in northern China. Inner Mongolia covers an area of 1,183,000 square kilometers, accounting for 12.3% of China’s land area. The suitable climatic conditions and geographical advantages provide advantages for the development of animal husbandry as well as a good living environment for ticks. Furthermore, the borders of Inner Mongolia with Mongolia and Russia facilitate cross-regional transmission of tick-borne pathogens. Since CRT was first identified in I. persulcatus collected in Russia [4] and subsequently found to be widely distributed in this species, many I. persulcatus ticks were collected for this study. D. nuttalli, a dominant tick species in Inner Mongolia, is known to have a wide distribution and can carry various species of Rickettsia [28, 29]. In a survey of microbial diversity carried by D. nuttalli ticks collected in Hulun Buir, CRT was reported to be present [20, 27]. However, there is limited research on CRT in H. concinna and H. marginatum. CRT infection has been reported in H. concinna [41], but there have been no reports of CRT carriage and transmission by H. marginatum. The Sca family is one of the largest protein families in Rickettsia. Certain members of the family, such as ompB and sca4, are known to be antigenic determinants of Spotted Fever Group (SFG) or Typhus Group (TG) rickettsiae [42]. The gltA and groEL genes have also been proven to be useful for the molecular identification and characterization of Rickettsia [43, 44]. In this study, specific primers were used to screen the gltA, ompB, groEL, and sca4 genes of CRT in the samples. The presence of CRT infection was demonstrated in H. marginatum ticks collected from Bayan Nur in Inner Mongolia, marking the first detection of CRT in H. marginatum. This finding may have important implications for the prevention and control of tick-borne rickettsioses caused by CRT infection in the local population.

Different species of ticks and different sampling locations showed variations in the prevalence of CRT. Among the four tick species collected in this study, I. persulcatus had the highest infection rate of CRT (80%). Pathogens were detected in I. persulcatus samples collected from Hinggan League (96%) and Hulun Buir (46%) cities. The next highest infection rate was observed in H. concinna ticks collected from Hulun Buir (40%), followed by H. marginatum ticks collected from the Bayan Nur region (28%). No CRT infection was detected in D. nuttalli ticks collected from the same region. Previous reports have identified CRT in various tick species, including I. persulcatus, H. japonica douglasi, D. silvarum, I. pavlovskyi, I. trianguliceps, and H. concinna, within the territory of Russia [5–9]. In neighboring Mongolia, the infection rate of CRT in I. persulcatus ranged from 19.5% to 46.6% [13], which is consistent with our research findings. It has also been reported that CRT was detected in 5.42% of D. nuttalli ticks in Hulun Buir, Inner Mongolia [20]. However, we did not detect CRT infection in D. nuttalli ticks, possibly due to differences in climate and environment between the sampling sites. The Hulun Buir sampling site is located in the northwest, adjacent to Russia and Mongolia, while the southeastern region is adjacent to Heilongjiang Province. These areas share similar natural environments and habitats, which may facilitate the cross-regional transmission of the pathogen. The differences in CRT infection rates observed in H. marginatum ticks collected from the Bayan Nur region may be attributed to specific collection locations and differences in the host animals they inhabit. These results provide epidemiological data to support the prevention and control of ticks and tick-borne diseases in Inner Mongolia, China, and contribute to our understanding of the epidemiology of CRT.

The gltA and groEL genes obtained in this study showed the highest similarity to the gltA and groEL genes isolated from Bayan-68 of I. persulcatus in Harbin, China. Similarly, the ompB and sca4 gene sequences were most similar to the ompB and sca4 genes of CRT isolated from Russia. This similarity may be due to the proximity of Inner Mongolia to northeastern China and the Far East/Siberia region of Russia, which share similar natural environments and habitats. Additionally, there are limited genetic data available for the ompB and sca4 genes of CRT in northeastern China.

CRT has been confirmed as the pathogen causing human rickettsioses and belongs to spotted fever group rickettsiae (SFGR) [45]. The first five cases of human infection with CRT were reported in northeastern China in 2012 [21]. The patients were hospitalized with symptoms such as fever, asthenia, anorexia, nausea, headache, eschar, and lymphadenopathy. Initially, their conditions were misdiagnosed because none of the patients presented with the typical rash associated with spotted fever group rickettsiae infections in China. The results of this study demonstrate the exposure of cattle, goats, and humans in Inner Mongolia to CRT. Therefore, investigating the distribution of CRT may contribute to establishing an etiological diagnosis, facilitating appropriate treatment, and implementing public health measures. This study unveils the high prevalence of CRT infection in ticks from Inner Mongolia, and it offers valuable molecular epidemiological data regarding CRT infection not only in Inner Mongolia but also in certain regions of North China, Northwest China, and Northeast China. The detection of CRT infection in H. marginatum for the first time suggests a possible etiological diagnosis for tick-borne rickettsioses caused by H. marginatum bites and contributes to the surveillance of human rickettsioses in China.

Supporting information

S1 File

(ZIP)

Data Availability

All relevant sequences were entered in GenBank with accession numbers OR272248-OR272253, OR294053-OR294057, OQ852069, OQ852073, OR454091-OR454142, OR449962-OR449989 and OR712487-OR712557.

Funding Statement

This work received financial support from the Scientific Research Project of the Mongolian Medicine Collaborative Innovation Center of the Inner Mongolia Autonomous Region (No. MYYXTPY202206 to Jing-Feng Yu). Zhiyuan talent project of Inner Mongolia Medical University (No. ZY0201027 to Jing-Feng Yu). Health Science and Technology Plan of Inner Mongolia Autonomous Region in 2022 (No. 202201213 to Jing-Feng Yu). Natural Science Foundation of Inner Mongolia Autonomous Region (No. 2022LHMS08004 to Jing-Feng Yu). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.