Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida

Tingxiu Yang; Jia Li; Yuanyuan Zhang; Zhaohui Deng; Guzhen Cui; Jun Yuan; Jianchao Sun; Xiaojuan Wu; Dengxiong Hua; Song Xiang; Zhenghong Chen

doi:10.1371/journal.pone.0298442

. 2024 Feb 8;19(2):e0298442. doi: 10.1371/journal.pone.0298442

Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida

Tingxiu Yang ^1,^2,^3,^4,^#, Jia Li ^1,^5,^#, Yuanyuan Zhang ^1,^6,^‡, Zhaohui Deng ^1,^‡, Guzhen Cui ^1,^3,^‡, Jun Yuan ^3,^‡, Jianchao Sun ^1,^‡, Xiaojuan Wu ^1,^4,^‡, Dengxiong Hua ^1,^‡, Song Xiang ^1,^‡, Zhenghong Chen ^1,^3,^4,^*

Editor: António Machado⁷

¹Key Laboratory of Microbiology and Parasitology of Education Department of Guizhou, School of Basic Medical Science/Joint Laboratory of Helicobacter Pylori and Intestinal Microecology of Affiliated Hospital of Guizhou Medical University, Guizhou Medical University, Guiyang, China

²Department of Hospital Infection and Management, Guizhou Provincial People’s Hospital, Guiyang, China

³Key Laboratory of Endemic and Ethnic Diseases of Ministry of Education/Key Laboratory of Environmental Pollution Monitoring and Disease Control, Ministry of Education, Guizhou Medical University, Guiyang, China

⁴Scientific Research Center, School of Basic Medical Science, Guizhou Medical University Guiyang, Guiyang, China

⁵Department of Clinical Laboratory, Jinyang Affiliated Hospital of Guizhou Medical University, Guiyang, China

⁶Department of Gastroenterology, People’s Hospital of Qiannan Prefecture, Guizhou, China

⁷Universidad San Francisco de Quito, ECUADOR

Competing Interests: All authors declare no conflicts of interest.

‡ These authors also contributed equally to this work.

^✉

* E-mail: chenzhenghong@gmc.edu.cn

Contributed equally.

Roles

Tingxiu Yang: Conceptualization, Data curation, Formal analysis, Methodology, Project administration, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

Jia Li: Methodology, Resources, Writing – original draft, Writing – review & editing

Yuanyuan Zhang: Methodology, Resources, Writing – review & editing

Zhaohui Deng: Methodology, Resources

Guzhen Cui: Conceptualization, Software, Writing – review & editing

Jun Yuan: Resources

Jianchao Sun: Methodology, Writing – review & editing

Xiaojuan Wu: Methodology, Visualization, Writing – review & editing

Dengxiong Hua: Methodology, Writing – review & editing

Song Xiang: Visualization

Zhenghong Chen: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Supervision, Validation, Writing – review & editing

António Machado: Editor

PMCID: PMC10852334 PMID: 38329956

Abstract

Background

Helicobacter pylori infections are generally acquired during childhood and affect half of the global population, but its transmission route remains unclear. It is reported that H. pylori can be internalized into Candida, but more evidence is needed for the internalization of H. pylori in human gastrointestinal Candida and vaginal Candida.

Methods

Candida was isolated from vaginal discharge and gastric mucosa biopsies. We PCR-amplified and sequenced H. pylori-specific genes from Candida genomic DNA. Using optical and immunofluorescence microscopy, we identified and observed bacteria-like bodies (BLBs) in Candida isolates and subcultures. Intracellular H. pylori antigen were detected by immunofluorescence using Fluorescein isothiocyanate (FITC)-labeled anti-H. pylori IgG antibodies. Urease activity in H. pylori internalized by Candida was detected by inoculating with urea-based Sabouraud dextrose agar, which changed the agar color from yellow to pink, indicating urease activity.

Results

A total of 59 vaginal Candida and two gastric Candida strains were isolated from vaginal discharge and gastric mucosa. Twenty-three isolates were positive for H. pylori 16S rDNA, 12 were positive for cagA and 21 were positive for ureA. The BLBs could be observed in Candida cells, which were positive for H. pylori 16S rDNA, and were viable determined by the LIVE/DEAD BacLight Bacterial Viability kit. Fluorescein isothiocyanate (FITC)-conjugated antibodies could be reacted specifically with H. pylori antigen inside Candida cells by immunofluorescence. Finally, H. pylori-positive Candida remained positive for H. pylori 16S rDNA even after ten subcultures. Urease activity of H. pylori internalized by Candida was positive.

Conclusion

In the form of BLBs, H. pylori can internalize into gastric Candida and even vaginal Candida, which might have great significance in its transmission and pathogenicity.

Introduction

Discovered in 1983, Helicobacter pylori (originally Campylobacter pylori) is a spiral-shaped, gram-negative bacterium that often causes acute and chronic gastritis and peptic ulcer disease [1]. It is also closely associated with the development of gastric mucosa-associated lymphoid tissue lymphoma and gastric cancer [1]. In 1994, the International Agency for Research on Cancer of the World Health Organization classified H. pylori as a class I carcinogen [2]. H. pylori infection is a public health problem worldwide [3], and approximately half of the world’s population is infected with it [4]. H. pylori infection is especially higher in less developed countries such as Jordan, where 88.6% of people aged between 15 and 81 years are infected [5]. The infection is generally acquired during childhood and can remain asymptomatic, but H. pylori often exhibits a long-term and chronic infection process [6–8]. The child infection rates are typically around 30%: in Cairo, 33% of children under age of 6 years are infected [9]; in Poland, 32.01% of children between the ages of 6 months and 18 years are infected [10]; and in Changsha, China, 30.6% of infants and toddlers are infected [11].

The main transmission routes for H. pylori are thought to be fecal-oral [12] and oral-oral [13,14], and these routes occur through ingesting contaminated food or water [12,14], communal meals, sharing towels, receiving pre-chewed food from the mother and physical acts such as kissing [15,16]. From this discovery, questions arise about whether close contact, such as communal meals, sharing towels, or kissing can lead to the spread of H. pylori infection [17].

Some studies have suggested that mothers with H. pylori infection may be the main transmission source during childhood [8,18]. A subsequent study confirmed the mother-to-child transmission of H. pylori, a phenomenon that can be attributed to mothers being the primary caregivers and children having more opportunities for oral-oral and fecal-oral transmission [19]. However, H. pylori is extremely fragile and dies quickly after exposure to the air, and in our experiments, we failed to isolate viable isolates from saliva and feces of 50 patients infected with H. pylori (unpublished), most studies reporting on detection of H. pylori in saliva or dental plaque have been performed by polymerase chain reaction (PCR) methods [20–22]. Hamada et al. did not culture H. pylori from the oral cavity or fecal samples, and the ureA gene of H. pylori was positive by PCR amplification [23]. Mao et al. presented a critical discussion of previous studies investigating the potential colonization of the oral cavity by H. Pylori [17]. Therefore, the oral cavity is not a suitable host for H. pylori colonization.

As early as 2013, researchers have proposed that vaginal yeast is the primary reservoir of H. pylori, with the bacteria transmitted from H. pylori-positive mothers to newborns during vaginal delivery or contact with the hospital environment and healthcare workers [24]. However, there has been little focus on investigating alternate transmission routes for H. pylori beyond the commonly recognized oral-oral or fecal-oral routes. Therefore, this study aimed to determine whether H. pylori is present in Candida isolated from vaginal discharge of pregnant women, as well as vaginal discharge and gastric mucosa of patients with digestive diseases.

In this study, Candida was isolated from vaginal discharge in pregnant women and female patients with gastric disease and from gastric mucosa biopsies in the female patients. Using optical and fluorescence microscopy, we identified and observed the bacteria-like bodies (BLBs) in isolated Candida and subcultures. We then PCR-amplified and sequenced H. pylori specific 16S rDNA and cagA genes from Candida cells. Finally, we separately diagnosed H. pylori infection in pregnant women and female patients using the H. pylori antibody test and urea breath test (UBT). The aim of this study was to detect intracellular H. pylori in vaginal and gastric Candida isolates and to explore the potential for transmission of H. pylori from mother to newborn through vaginal Candida during delivery.

Material and methods

Ethics approval and consent to participate

This study was approved by the Human Medical Ethics Committee of Guizhou Medical University in April 2021, following the Ethics Review Document No. 141. All procedures complied with the Declaration of Helsinki. Verbal informed consent was obtained from all participants for their anonymized information to be published in this article.

Samples

This study included 50 pregnant women who underwent prenatal examination in the obstetrics department of Jinyang Affiliated Hospital at Guizhou Medical University from May to October 2021. Samples of vaginal discharge and serum were collected. In addition, 27 gastric biopsies and 22 vaginal discharges were collected from 42 female patients with gastric disease at the Department of Gastroenterology in the People’s Hospital of Qiannan Prefecture (Guizhou Province, China) from May to October 2021. Seven female patients provided samples of both gastric mucosa and vaginal discharge. However, only vaginal discharge samples were obtained from another 15 female patients who did not undergo gastroscopic examination. Finally, 20 individuals were outpatients; therefore, only gastric mucosa samples were collected.

Infection in pregnant women was diagnosed via a quantitative detection of serum H. pylori antibodies. An H. pylori antibody test kit (WAN TAI BRD, Beijing, China) for performing latex immunoturbidimetry (ARCHITECT c16000, Abbott, USA) was used to determine H. pylori IgG. Finally, H. pylori infection in female patients with gastric disease was diagnosed using the ¹⁴C-urea breath test (UBT).

Candida isolation and identification

Samples of vaginal discharge and homogenized gastric mucosa were inoculated directly on CHROMagar Candida medium (CHROMagar, Paris, France) following the manufacturer’s protocol and then incubated at 37°C for 24–48 h under aerobic conditions. Candida species were identified based on the color characteristics of different colonies, such as green-blue (C. albicans), metallic blue with pink halo (C. tropicalis), mauve (C. glabrata), pink and fuzzy (C. krusei), and white (other Candida species). Candida was passaged on Sabouraud dextrose agar (SDA, Basebio, Hangzhou, China) with 50 μg/mL chloramphenicol (Solarbio, Beijing, China) medium.

Detection of H. pylori-specific genes in Candida cells

Whole genomic DNA from Candida and control isolates was extracted using the UltraClean ^® Microbial DNA Isolation Kit (Qiagen, Germantown, USA). The negative control was C. albicans strain ATCC 10231; the positive control was H. pylori strain 26695, and the blank control was sterile deionised water. H. pylori-specific 16S rDNA, cagA and ureA were PCR-amplified in a 25 μL reaction volume containing 1 μL of forward primer (10 μM, Sangon Biotech Co., Ltd., Shanghai, China), 1 μL of reverse primer (10 μM, Sangon Biotech Co., Ltd.), 2 μL of genomic DNA, 12.5 μL of 2× Taq PCR master mix (Jiangsu CWBiotech Science and Technology Co., Ltd., Jiangsu, China), and sterile deionised water (8.5 μL). Primers’ sequences and thermocycling conditions are described in Table 1.

Table 1. Primers sequences and amplification conditions.

Primers	Primer sequence (5’-3’)	PCR Procedure	Reference
Hp 16S rDNA F	`GCAATCAGCGTCAGTAATGTTC`	94°C 45 s, 57°C 1 min, 72°C 1 min (33 cycles)	[25]
Hp 16S rDNA R	`GCTAAGAGATCAGCCTATGTCC`	94°C 45 s, 57°C 1 min, 72°C 1 min (33 cycles)	[25]
CagA F	`ATGACTAACGAAACTATTGATCAAACA`	94°C 30 s, 60°C 30 s, 72°C 30 s (35 cycles)	This study
CagA R	`CTGCAAAAGATTGTTTGGCAGA`	94°C 30 s, 60°C 30 s, 72°C 30 s (35 cycles)	This study
ureA F	`GCCAATGGTAAATTAGTT`	94°C 1 min, 45°C 1 min, 72°C 1 min (40 cycles)	[26]
ureA R	`CTCCTTAATTGTTTTTAC`	94°C 1 min, 45°C 1 min, 72°C 1 min (40 cycles)	[26]

Open in a new tab

Amplicons of H. pylori-specific 16S rDNA, cagA and ureA were sequenced at Sangon Biotech and aligned with GenBank sequences using the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/).

Alignment and phylogenetic analysis

The evolutionary history is inferred using the Neighbor-Joining method [27]. Alignment of multiple sequences was carried out using ClustalW with a penalty of 15 for gap opening and 6.66 for gap extension. Based on 1000 replicates, a bootstrap consensus tree was inferred to represent the evolutionary history of the taxa. Collapsed branches correspond to partitions that have been replicated less than 50% of the time in bootstrap replications. Next to each branch are the percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) [28]. Maximum Composite Likelihood was used to determine evolutionary distances and they are expressed in substitutions per site. Using MEGA X, evolutionary analyses were performed on all sequence pairs with ambiguous positions removed (pairwise deletion option).

Subculturing of H. pylori-positive Candida and detection of H. pylori- specific genes from Candida

Helicobacter pylori-positive Candida were passaged on SDA with chloramphenicol 10 times. To eliminate any possible bacterial contamination, yeast isolates were subcultured on SDA with chloramphenicol ten times. Whole genomic DNA was extracted from the 4th and 10th subcultures, and the H. pylori-specific genes were PCR-amplified. Amplicons were sequenced at Sangon Biotech, and genomic alignment was performed using BLAST.

Microscopic observation of BLBs in Candida

Six colonies from the primary culture were randomly selected and placed on slides containing 10 μL of 0.9% saline solution. Coverslips were placed on the samples to search for BLBs under an optical microscope (Nikon, Shanghai, China) equipped with a 100× oil immersion objective lens and camera [29]. Candida albicans strain ATCC10231 was used as a negative control.

Furthermore, Candida cells were stained using the LIVE/DEAD BacLight Bacterial Viability Kit L7012 (Thermo Fisher, Waltham, MA, USA), which uses a mixture of the SYTO 9 green-fluorescent nucleic acid stain and propidium iodide, a red-fluorescent nucleic acid stain. These stains differ in their spectral characteristics and in their ability to penetrate healthy bacterial cells. When used alone, the SYTO 9 stain generally labels all bacteria (with intact and damaged membranes) in a population. In contrast, propidium iodide penetrates only bacteria with damaged membranes, revealing the bacterial nature of BLBs and their viability. Briefly, fresh Candida cultures were suspended in a sterile saline solution, and the turbidity was adjusted to 0.5 McFarland standard. A 0.5 mL of each Candida suspension was mixed with 1.5 μL of fluorescent stain containing equal volumes of SYTO 9 and propidium iodide. After a quick vortex and incubation at 25°C in the dark for 15 min, 5 μL of each Candida suspension was placed on a glass slide and examined using the 100× lens of a fluorescent microscope equipped with an integrated camera (Nikon, Shanghai, China).

We selected one H. pylori 16S rDNA positive vaginal Candida strain, one H. pylori 16S rDNA positive gastric Candida strain, and C. albicans ATCC10231 to observe Candida cells using transmission electron microscopy (TEM). The fresh Candida cultures were collected in 1.5 mL Eppendorf tubes (Eppendorf GmbH, Hamburg, Germany), centrifuged at 10,000 × g for 1 min, and washed thrice with 1 mL phosphate-buffered saline (PBS). The precipitate was resuspended in 2.5% (v/v) glutaraldehyde fixative at 4°C for 24 h and subjected to TEM analysis by Shiyanjia Laboratory (http://www.shiyanjia.com).

Detection of intracellular H. pylori antigen by immunofluorescence

This assay was done using Fluorescein isothiocyanate (FITC)-labeled polyclonal anti-H. pylori IgG antibodies at a concentration of 5 mg/mL (Thermo Fisher, Cat # PA1-73161). Each Candida isolate was independently cultured in 10 mL of Brain Heart Infusion (BHI) medium (OXOID, Basingstoke, United Kingdom) at 37°C shaking at 120 r/min for 24 h, then Candida was treated with 32 μg/mL amphotericin B at 37°C shaking at 120 r/min for 24 h [30]. Amphotericin B increases the permeability of yeast cell walls, which then allows antibodies to enter yeast cells. The culture was then centrifuged for 1 min at 10000 r/min and washed three times with 1 mL of PBS (pH 7.2), the precipitation was resuspended in PBS solution and the turbidity was adjusted to 2 McFarland standard. A 100 μL of each Candida suspension was mixed with 1 μL of FITC- labeled anti-H. pylori IgG antibodies, and were incubated for 1 h at 25°C in darkness. A 5 μL volume of each suspension was spotted onto a glass slide and observed by fluorescence microscopy. Fresh cultures of H. pylori 26695 strain and C. albicans ATCC 10231 were used as positive and negative controls, respectively.

Detection of urease activity in H. pylori internalized by Candida

To demonstrate intracellular of H. pylori release from the Candida cells, H. pylori 16S rDNA positive Candida was inoculated into SDA agar medium (pH 7.2) containing 40% urea (Hai bo, Qingdao, China) and 0.01 g/L phenol red at 37°C for 3–5 days under aerobic conditions. In the presence of H. pylori, bacterial urease catalyzes the conversion of urea to ammonia and carbon dioxide, which can be detected by the characteristic red color change in solution [31]. By observing the medium, changing the agar color from yellow to pink is positive for urease and negative for no pink. The C. albicans ATCC 10231 was used as negative controls under aerobic conditions (C. albicans ATCC 10231 isolated from Man with bronchomycosis). The H. pylori 26695 strain was used as a positive control under microaerobic conditions.

Results

Helicobacter pylori infection

Of the 50 pregnant women, 13 tested positive for H. pylori IgG antibodies. Among the 42 female patients, 31 were ¹⁴C-urea breath test (UBT)-positive and 11 were UBT-negative. Thus, 13 pregnant women and 31 patients with gastric disease were H. pylori-positive (Fig 1 and S1 File).

Fig 1 — N, number of people; H. *pylori-*Ab (-), H. *pylori* antibody-negative; H. *pylori-*Ab (+), H. *pylori* antibody-positive.

Candida isolation, identification and subcultures

One Candida strain was isolated from each vaginal discharge sample to yield 50 isolates. Based on the color of colonies on CHROMagar Candida medium, we obtained 45 isolates of C. albicans, two isolates of C. glabrata, two isolates of C. tropicalis, and one isolate of the other Candida spp.

Nine vaginal Candida isolates and two gastric Candida isolates were obtained from female patients with gastric disease, including four C. albicans, four C. cruise, one C. glabrata, and two isolates of the other Candida spp. (Fig 1 and Table 2). The Candida colonies were sub-cultured on SDA medium for more than ten generations to remove extracellular bacterial contamination.

Table 2. Number of isolated Candida from vaginal discharge and gastric mucosa, along with the frequency of 16S rDNA and cagA of intracellular H. pylori in Candida.

Participants	Isolated Candida		Hp 16S rDNA (+)		Hp cagA (+)		Hp urea (+)
Participants	Vaginal	Gastric	Vaginal	Gastric	Vaginal	Gastric	Vaginal	Gastric
Pregnant women	50/50 (100.0%)	NS	13/50 (26.0%)	NS	5/13 (38.5%)	NS	13/13 (100.0%)	NS
Patients with GD	9/22 (40.9%)	2/27 (7.4%)	8/9 (88.9%)	2/2 (100.0%)	5/8 (62.5%)	2/2 (100.0%)	6/8(75.0%)	2/2 (100.0%)
Total	59/72 (81.9%)	2/27 (7.4%)	21/59 (35.6%)	2/2 (100.0%)	10/21 (47.6%)	2/2 (100.0%)	19/21(90.5%)	2/2 (100.0%)

Open in a new tab

Numbers in the tables are the numbers of cases; Hp, H. pylori; GD, gastric disease; NS, not present in any samples; +, positive.

Intracellular presence of H. pylori-specific genes within Candida subcultures

Thirteen vaginal Candida isolates from pregnant women, who were positive for H. pylori IgG antibody, were positive for intracellular H. pylori specific 16S rDNA (Figs 2A and S1) and ureA (Fig 2B and S1), and five were also positive for the cagA (Figs 3 and S1). In addition, 13 H. pylori 16S rDNA positive Candida isolates were isolated from pregnant women (Fig 1).

Fig 2 — Lane M: Molecular weight marker. Lane B: Blank control (sterile deionized water). Lane C-: Negative control, DNA extracted from C. *albicans* strain ATCC 10231. Lane C+: Positive control, DNA extracted from H. *pylori* strain 26695. **(a)** Lanes 1–5: DNA extracted from *Candida* harboring BLBs, obtained from vaginal discharge of pregnant women. Lanes 6–8: DNA extracted from *Candida* harboring BLBs, obtained from vaginal discharge of patients with gastric disease. Lanes 10–11: DNA extracted from *Candida* harboring BLBs, obtained from gastric mucosa of patients with gastric disease. **(b)** Lanes 1–11 and Lanes 14–22: DNA extracted from H. *pylori* 16S rDNA positive *Candida*. Lanes 12 and 13: DNA extracted from H. *pylori* 16S rDNA negative *Candida* (S1 Fig).

Fig 3 — Lane M: Molecular weight marker. Lanes 1–2: DNA extracted from *Candida* isolates in vaginal discharge of pregnant women. Lanes 3–4: DNA extracted from *Candida* isolates in vaginal discharge of female patients with gastric disease. Lanes 5–6: DNA extracted from *Candida* isolates in gastric mucosa of patients with gastric disease. Lane B: Blank control (sterile deionized water). Lane C-: Negative control, DNA extracted from C. *albicans* strain ATCC 10231. Lane C+: Positive control, DNA extracted from H. *pylori* strain 26695 (S1 Fig).

Eight vaginal Candida and two gastric Candida isolates from female patients with gastric disease, who were positive for UBT, were positive for intracellular H. pylori specific 16S rDNA (Fig 2A), five vaginal Candida and two gastric Candida were also positive for the ureA and cagA (Figs 2B and 3). Only one vaginal Candida isolate from patients who were negative for UBT was negative for H. pylori-specific 16S rDNA and ureA.

These PCR positive Candida isolates were sub-cultured for 10 generations, 16S rDNA and cagA genes of H. pylori were still positive for the tenth subcultures. Sequences of these amplicons showed > 99.8% identity with H. pylori sequences from GenBank. Some sequences of H. pylori 16S rDNA (accession no. ON545841, ON545842 and ON631242) and cagA had been submitted to GenBank (accession no. OM779116, OM779117 and OM812999).

Phylogenetic analyses

The H. pylori 16S rDNA sequences obtained from PCR assays were analyzed to determine the evolutionary history of H. pylori species within Candida cells (Fig 4). Based on BLAST results, the analyses included GenBank reference sequences. These sequences were confirmed to be those of Helicobacter pylori.

Fig 4 — This phylogenetic tree was constructed using the GenBank reference sequence (H. *pylori* SS1) and H. *pylori* 16S rRNA sequences obtained from *Candida*. SS1 is a standard strain of *Helicobacter pylori*. V1-V9 and OR226730 represent sequences of H. *pylori* 16S rRNA genes from vaginal *Candida*. ON545841, ON545842 and OQ259931 represent sequences of H. *pylori* 16S rRNA genes from gastric *Candida*.

Microscopic observations reveal the presence of live H. pylori in Candida cells

Optical microscopy observations revealed BLBs in 13 of 50 vaginal Candida isolates from pregnant women. We also found BLBs in 10 of 11 Candida isolates from patients with gastric disease, including eight vaginal isolates and two gastric mucosa isolates (Table 2 and Fig 5). No BLBs in C. albicans ATCC 10231. At the same time, BLBs were observed to move rapidly within the Candida vacuole (S1 Video).

Fig 5 — Photographs taken at 0, 6, 18, and 38 s (a, b, c and d, respectively) show fast-moving BLBs inside vacuoles. Red arrow indicates the *Candida* nucleus, and black arrows indicate BLBs. Refer to the attached video of fast-moving BLBs within vacuoles (S1 Video).

Fluorescence microscopy, using the BacLight Bacterial Viability kit, showed the BLBs within Candida cells were viable, as indicated by the green fluorescence (Fig 6). Intracellular H. pylori within Candida was observed by TEM (Fig 7).

Fig 6 — The SYTO 9 stain generally labels all bacteria (with intact and damaged membranes) in a population. In contrast, propidium iodide penetrates only bacteria with damaged membranes. (a) C. *albicans* ATCC10231 strain (negative control). (b) The live and green BLBs are demonstrated in the *candida* (white arrow), and (c) dead *Candida* (magnification × 1000).

Fig 7 — **(a)** C. *albicans* ATCC 10231(absence of high electron density body). **(b)** High electron density body (white arrow) in vaginal *Candida* cells. **(c)** High electron density bodies (white arrow) in gastric *Candida* cells. Scale bars = 1.0 μm.

Direct immunofluorescence assay confirmed the presence of H. pylori antigen in Candida

The FITC-labeled anti-H. pylori IgG antibodies reacted specifically with intracellular H. pylori within Candida cells as showed by the green fluorescence under fluorescence microscope (Fig 8).

Fig 8 — Immunofluorescence micrographs showing: (a) absence of fluorescence in the C. *albicans* ATCC 10231 (negative control); (b) presence of fluorescence emitted by H. *pylori* 26695 strain (positive control); (c) presence of fluorescence emitted by H. *pylori* (white arrows) inside *Candida* (magnification × 1000).

Detection of urease activity in H. pylori internalized by Candida

To demonstrate of intracellular H. pylori urease activity in Candida, Candida was inoculated with urea-based SDA agar, which changed the agar color from yellow to pink, indicating urease activity. H. pylori ureA positive Candida cells in urea-based SDA agar showed urease activity. C. albicans ATCC 10231 had no urease activity and H. pylori 26695 strain was urease positive.

Consistency between H. pylori infection, BLBs and intracellular H. pylori in Candida

Thirteen Candida isolates were isolated from pregnant women whose H. pylori IgG antibody was positive and H. pylori 16S rDNA was positive in all Candida isolates that harboured BLBs observed by optical microscopy. Interestingly, H. pylori 16S rDNA and BLBs were negative in all vaginal Candida isolates isolated from pregnant women whose H. pylori antibodies were negative (Fig 1). Furthermore, among H. pylori-negative patients, only one vaginal Candida isolate lacked BLBs and was negative for H. pylori 16S rDNA and ureA (Fig 1). These results indicate that H. pylori 16S rDNA was present in Candida isolates with BLBs. Individuals who provided such specimens were therefore infected with H. pylori.

Discussion

Many studies have reported that H. pylori infection exhibits household clustering, with the most likely routes of transmission being oral-oral, fecal-oral, and gastro-oral [8,18,32,33]. High-risk factors for intrafamily transmission include shared towels, mothers feeding pre-chewed food to children, and history of family members with gastrointestinal disease [15]. Despite improvements to social economy, housing, dietary hygiene, and feeding habits within the last 20 years, H. pylori infection remains prevalent in children and even infants. From 2009 to 2011 in China, the overall H. pylori infection rate in newborns was 0.6%, with some variation across major cities, e.g., 0.3% in Beijing, 3.8% in Chengdu [15]. As newborns rarely have the opportunity to eat contaminated foods, this reflects that their low likelihood of being infected with H. pylori through the fecal-oral route. In addition, H. pylori is an oxygen-sensitive bacterium that dies soon after leaving the human stomach [34]. Although in most families, mothers assume the responsibility of taking care of children, children and fathers also have close contact. However, in this study, in nine families where only fathers are positive, children are not infected with H. pylori [35]. Therefore, the infection route to these newborns’ oral cavity is probably directly from their mothers during birth.

Siavoshi et al. reported that vaginal Candida may be a host of H. pylori, sheltering the bacteria even outside the human body [24]. Subsequently, Sanchez-Alonzo et al. showed that 50% of isolated vaginal Candida were positive for H. pylori 16S rDNA, and 32% of such samples were also positive for cagA [29]. CagA is a virulence factor of H. pylori infection and is associated with H. pylori colonization [36]. Tohidpour reported that CagA wass the first bacterial oncolytic protein to rank the H. pylori-mediated adenocarcinoma as the second deadliest cancer type worldwide [37]. These findings corroborate our results. Few reports are available on the relationship between female vaginal Candida and H. pylori or the vertical transmission of H. pylori through the birth canal. Thus, more research is necessary to confirm the intracellular presence of H. pylori in Candida and its potential transmission from mothers to newborns.

We found that 26% of vaginal Candida in pregnant women contained H. pylori-specific nucleic acids, consistent with the H. pylori IgG positive rates (13/50) in pregnant women. Furthermore, H. pylori-specific nucleic acids and BLBs could still be detected even after 10 passages of vaginal Candida colonies. Sequences of H. pylori 16S rDNA alignments showed > 99.8% identity with H. pylori sequences from GenBank. Sequence alignments showed that the base of the H. pylori 16S rDNA and cagA fragments amplified from different Candida isolates had some differences, and no positive amplification from C. albicans control isolates, so sample or laboratory contamination with H. pylori can be excluded.

As with vaginal Candida, H. pylori-specific nucleic acids (16S rDNA and cagA) were present in Candida from the gastric mucosa of H. pylori-positive patients, even after ten passages. Researchers have reported that H. pylori-specific proteins and H. pylori could be detected in gastric yeast by immunofluorescence [38,39]. Amphotericin B increases the permeability of yeast cell walls, which then allows antibodies into yeast cells [30]. In this study, FITC-conjugated anti-H. pylori IgG antibodies could be recruited for localization of H. pylori inside both vaginal Candida and gastric Candida cells treated by amphotericin B using immunofluorescence. Therefore, through Candida, H. pylori could become a facultative intracellular bacterium in the gastrointestinal tract. Sequestration inside yeast vacuoles appears to enhance H. pylori survival in gastric acid [40], and an in vitro study co-incubating H. pylori and C. albicans revealed that H. pylori enters C. albicans vacuoles under unfavorable pH conditions [41]. Thus, H. pylori within Candida may travel from the stomach to the intestinal tract, and then to the vagina, given its closely proximity to the anus [42]. Several studies have confirmed that H. pylori or H. pylori-positive Candida can enter and colonize the vagina [24,43,44], again pointing to the possibility of H. pylori-positive Candida being transmitted to newborns during natural delivery.

We detected urease activity in H. pylori internalized by Candida, which turned the urea-based SDA pink, demonstrating the release of intracellular H. pylori urease from Candida cells, as well as the presence of the H. pylori ureA gene. Heydari et al. reported that Candida may release free H. pylori as a vesicle-encased or free bacterium [45]. While the elimination of numerous extracellular H. pylori isolates can relieve symptoms, Candida reservoirs of H. pylori may cause chronic infections, recurrence, or even carcinogenesis. The fact that H. pylori was found in Candida isolated from the stomach after several passages indicates that H. pylori remains in Candida progeny even after the Candida cells bud.

Additionally, under light microscopy, we observed rapid movement of bacteria within Candida vacuoles, similarly to previous reports on oral Candida [46]. This movement increases the probability that H. pylori can proliferate within Candida cells and use them as a vector for transmission. Although intracellular H. pylori in Candida cannot be isolated and cultured, Heydari et al. reported that the released H. pylori from Candida were detected by immunomagnetic separation [44].

As early as 2014, Siavoshi et al. considered vacuoles of Candida cell as a specialized niche for H. pylori [47]. However, this conclusion has not received much attention, and even was opposed by Alipour and Gaeini [48], who thought that the size of Candida cells was not large enough to accommodate several H. pylori cells. Additionally, the H. pylori isolates cannot be isolated from Candida, which would violate Koch’s postulates [48]. Then, Siavoshi et al. quickly made a reasonable response, insisted on the published research conclusions, and considered that the traditional Koch’s postulates are not applicable to the non-culturable H. pylori in Candida vesicles [49]. The size of a Candida cell is ~3–8 μm [50], the bacterial cell length of H. pylori is ~2–4 μm and its width is ~0.5–1 μm [51]. Although it is difficult for Candida to accommodate several H. pylori cells, under the exposure of antibiotics, H. pylori may lose its cell wall and become a coccoid form, which can be internalized into Candida cells. Therefore, under unfavorable conditions such as exposure to antibiotics and an aerobic environment, the vacuoles of Candida cells provided a special habitat for H. pylori and made it a shelter for H. pylori [39,47]. Candida albicans is an opportunistic fungal pathogen that can colonize host niches at varying pH [52]. In our study, Candida species carrying H. pylori showed detectable urease activity. It suggests a symbiotic relationship between H. pylori and Candida, allowing the yeast to survive in acidic environments.

Overall, our work provides a clue for further in-depth study on the interaction between H. pylori and C. albicans, routes of H. pylori transmission, and pathogenicity.

Conclusion

In conclusion, our results showed that H. pylori and its virulence-related genes were present in Candida from vaginal discharge of pregnant women. We also found H. pylori in vaginal Candida and gastric Candida from female patients with gastric disease, with H. pylori 16S rDNA was still detectable after 10 subcultures of Candida. As a result, Candida may act as a reservoir for H. pylori in women’s gastrointestinal tract, allowing the bacteria to migrate through the intestines to the vagina and eventually infect newborns during delivery.

Supporting information

S1 Fig

(PDF)

Click here for additional data file.^{(4.2MB, pdf)}

S1 File

(XLSX)

Click here for additional data file.^{(14.8KB, xlsx)}

S1 Video

(AVI)

Click here for additional data file.^{(921.4KB, avi)}

Acknowledgments

We thank the Department of Obstetrics in Jinyang Affiliated Hospital of Guizhou Medical University and the Department of Gastroenterology in the People’s Hospital of Qiannan Prefecture (Guizhou Province) for collecting specimens used in this study. We also acknowledge our colleagues for their valuable comments on this paper. We would also like to thank Editage [www.editage.cn] for their help with English-language editing.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by grants from the National Natural Science Foundation of China (No. 81860353), the Basic Research Program of Guizhou Science and Technology Plan (No. ZK [2022] 341), the Science and Technology Fund Project of Guizhou Health Commission (No. gzwkj2022-521) and the Scientific Foundation of Guizhou Medical University (No. 20NSP005), and the Foundation of Key Laboratory of Microbiology and Parasitology of Education Department, Guizhou (No. QJJ [2022] 019). These funding obtained from Zhenghong Chen, who had a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1983;1(8336):1273–5. Epub 1983/06/04. . [PubMed] [Google Scholar]
2.Cancer IAfRo. Infection with Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994;61:177–240. PubMed Central PMCID: PMC7681529. [PMC free article] [PubMed] [Google Scholar]
3.Peter S, Beglinger C. Helicobacter pylori and gastric cancer: the causal relationship. Digestion. 2007;75(1):25–35. Epub 2007/04/13. doi: 10.1159/000101564 . [DOI] [PubMed] [Google Scholar]
4.Wise MJ, Lamichhane B, Webberley KM. A Longitudinal, Population-Level, Big-Data Study of Helicobacter pylori-Related Disease across Western Australia. J Clin Med. 2019;8(11). Epub 2019/11/07. doi: 10.3390/jcm8111821 ; PubMed Central PMCID: PMC6912511. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Obaidat MM, Roess AA. First nationwide seroepidemiology and risk factors report of Helicobater pylori in Jordan. Helicobacter. 2019;24(3):e12572. Epub 2019/03/15. doi: 10.1111/hel.12572 . [DOI] [PubMed] [Google Scholar]
6.Malaty HM, Kumagai T, Tanaka E, Ota H, Kiyosawa K, Graham DY, et al. Evidence from a nine-year birth cohort study in Japan of transmission pathways of Helicobacter pylori infection. J Clin Microbiol. 2000;38(5):1971–3. Epub 2000/05/02. doi: 10.1128/JCM.38.5.1971-1973.2000 ; PubMed Central PMCID: PMC86638. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Rowland M, Daly L, Vaughan M, Higgins A, Bourke B, Drumm B. Age-specific incidence of Helicobacter pylori. Gastroenterology. 2006;130(1):65–72; quiz 211. Epub 2006/01/13. doi: 10.1053/j.gastro.2005.11.004 . [DOI] [PubMed] [Google Scholar]
8.Weyermann M, Rothenbacher D, Brenner H. Acquisition of Helicobacter pylori infection in early childhood: independent contributions of infected mothers, fathers, and siblings. Am J Gastroenterol. 2009;104(1):182–9. Epub 2008/12/23. doi: 10.1038/ajg.2008.61 . [DOI] [PubMed] [Google Scholar]
9.Frenck RW Jr, Fathy HM, Sherif M, Mohran Z, El Mohammedy H, Francis W, et al. Sensitivity and specificity of various tests for the diagnosis of Helicobacter pylori in Egyptian children. Pediatrics. 2006;118(4):e1195–202. Epub 2006/09/20. doi: 10.1542/peds.2005-2925 . [DOI] [PubMed] [Google Scholar]
10.Laszewicz W, Iwańczak F, Iwańczak B. Seroprevalence of Helicobacter pylori infection in Polish children and adults depending on socioeconomic status and living conditions. Advances In Medical Sciences. 2014;59(1):147–50. doi: 10.1016/j.advms.2014.01.003 . [DOI] [PubMed] [Google Scholar]
11.Gao T, Zhao M, Zhang C, Wang P, Zhou W, Tan S, et al. Association of Helicobacter pylori Infection with Vitamin D Deficiency in Infants and Toddlers. Am J Trop Med Hyg. 2020;102(3):541–6. Epub 2020/01/15. doi: 10.4269/ajtmh.19-0523 ; PubMed Central PMCID: PMC7056419. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Quaglia NC, Dambrosio A. Helicobacter pylori: A foodborne pathogen. World J Gastroenterol. 2018;24(31):3472–87. doi: 10.3748/wjg.v24.i31.3472 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Yahaghi E, Khamesipour F, Mashayekhi F, Safarpoor Dehkordi F, Sakhaei MH, Masoudimanesh M, et al. Helicobacter pylori in vegetables and salads: genotyping and antimicrobial resistance properties. Biomed Res Int. 2014;2014:757941. Epub 2014/09/04. doi: 10.1155/2014/757941 ; PubMed Central PMCID: PMC4145543. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Farhadkhani M, Nikaeen M, Hassanzadeh A, Nikmanesh B. Potential transmission sources of Helicobacter pylori infection: detection of H. pylori in various environmental samples. J Environ Health Sci Eng. 2019;17(1):129–34. Epub 2019/07/20. doi: 10.1007/s40201-018-00333-y ; PubMed Central PMCID: PMC6582085. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Ding Z, Zhao S, Gong S, Li Z, Mao M, Xu X, et al. Prevalence and risk factors of Helicobacter pylori infection in asymptomatic Chinese children: a prospective, cross-sectional, population-based study. Aliment Pharmacol Ther. 2015;42(8):1019–26. Epub 2015/08/15. doi: 10.1111/apt.13364 . [DOI] [PubMed] [Google Scholar]
16.Mezmale L, Coelho LG, Bordin D, Leja M. Review: Epidemiology of Helicobacter pylori. Helicobacter. 2020;25 Suppl 1:e12734. Epub 2020/09/13. doi: 10.1111/hel.12734 . [DOI] [PubMed] [Google Scholar]
17.Mao X, Jakubovics NS, Bachle M, Buchalla W, Hiller KA, Maisch T, et al. Colonization of Helicobacter pylori in the oral cavity—an endless controversy? Crit Rev Microbiol. 2021;47(5):612–29. Epub 2021/04/27. doi: 10.1080/1040841X.2021.1907740 . [DOI] [PubMed] [Google Scholar]
18.Weyermann M, Adler G, Brenner H, Rothenbacher D. The mother as source of Helicobacter pylori infection. Epidemiology. 2006;17(3):332–4. Epub 2006/02/03. doi: 10.1097/01.ede.0000201257.31155.a0 . [DOI] [PubMed] [Google Scholar]
19.Yokota S, Konno M, Fujiwara S, Toita N, Takahashi M, Yamamoto S, et al. Intrafamilial, Preferentially Mother-to-Child and Intraspousal, Helicobacter pylori Infection in Japan Determined by Mutilocus Sequence Typing and Random Amplified Polymorphic DNA Fingerprinting. Helicobacter. 2015;20(5):334–42. Epub 2015/02/11. doi: 10.1111/hel.12217 . [DOI] [PubMed] [Google Scholar]
20.Zhao Y, Gao X, Guo J, Yu D, Xiao Y, Wang H, et al. Helicobacter pylori infection alters gastric and tongue coating microbial communities. Helicobacter. 2019;24(2):e12567. Epub 2019/02/09. doi: 10.1111/hel.12567 ; PubMed Central PMCID: PMC6593728. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Flores-Trevino CE, Urrutia-Baca VH, Gomez-Flores R, De La Garza-Ramos MA, Sanchez-Chaparro MM, Garza-Elizondo MA. Molecular detection of Helicobacter pylori based on the presence of cagA and vacA virulence genes in dental plaque from patients with periodontitis. J Dent Sci. 2019;14(2):163–70. Epub 2019/06/19. doi: 10.1016/j.jds.2019.01.010 ; PubMed Central PMCID: PMC6562180. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Šeligová B, Lukáč Ľ, Bábelová M, Vávrová S, Sulo P. Diagnostic reliability of nested PCR depends on the primer design and threshold abundance of Helicobacter pylori in biopsy, stool, and saliva samples. Helicobacter. 2020;25(2):e12680. doi: 10.1111/hel.12680 . [DOI] [PubMed] [Google Scholar]
23.Hamada M, Nomura R, Ogaya Y, Matayoshi S, Kadota T, Morita Y, et al. Potential involvement of Helicobacter pylori from oral specimens in overweight body-mass index. Scientific Reports. 2019;9(1):4845. doi: 10.1038/s41598-019-41166-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Siavoshi F, Taghikhani A, Malekzadeh R, Sarrafnejad A. The role of mother’s oral and vaginal yeasts in transmission of Helicobacter pylori to neonates. European Journal of Gastroenterology & Hepatology. 2013;16(5):288–94. [PubMed] [Google Scholar]
25.Lu Y, Redlinger TE, Avitia R, Galindo A, Goodman K. Isolation and genotyping of Helicobacter pylori from untreated municipal wastewater. Applied and Environmental Microbiology. 2002;68(3):1436–9. doi: 10.1128/AEM.68.3.1436-1439.2002 . [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Ansari SA, Iqbal MUN, Khan TA, Kazmi SU. Association of oral Helicobacter pylori with gastric complications. Life Sci. 2018;205:125–30. Epub 2018/05/16. doi: 10.1016/j.lfs.2018.05.026 . [DOI] [PubMed] [Google Scholar]
27.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406–25. Epub 1987/07/01. doi: 10.1093/oxfordjournals.molbev.a040454 . [DOI] [PubMed] [Google Scholar]
28.Felsenstein J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution. 1985;39(4):783–91. Epub 1985/07/01. doi: 10.1111/j.1558-5646.1985.tb00420.x . [DOI] [PubMed] [Google Scholar]
29.Sanchez-Alonzo K, Matamala-Valdes L, Parra-Sepulveda C, Bernasconi H, Campos VL, Smith CT, et al. Intracellular Presence of Helicobacter pylori and Its Virulence-Associated Genotypes within the Vaginal Yeast of Term Pregnant Women. Microorganisms. 2021;9(1). Epub 2021/01/13. doi: 10.3390/microorganisms9010131 ; PubMed Central PMCID: PMC7827377. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Siavoshi F, Tavakolian A, Foroumadi A, Hosseini NM, Massarrat S, Pedramnia S, et al. Comparison of the effect of non-antifungal and antifungal agents on Candida isolates from the gastrointestinal tract. Arch Iran Med. 2012;15(1):27–31. Epub 2012/01/03. . [PubMed] [Google Scholar]
31.Deng Y, Ding X, Song Q, Zhao G, Han L, Ding B, et al. Alterations in mucosa-associated microbiota in the stomach of patients with gastric cancer. Cellular oncology (Dordrecht). 2021;44(3):701–14. Epub 2021/03/27. doi: 10.1007/s13402-021-00596-y ; PubMed Central PMCID: PMC8213677. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Mendoza-Cantu A, Urrutia-Baca VH, Urbina-Rios CS, De la Garza-Ramos MA, Garcia-Martinez ME, Torre-Martinez HHH. Prevalence of Helicobacter pylori vacA Genotypes and cagA Gene in Dental Plaque of Asymptomatic Mexican Children. Biomed Res Int. 2017;2017:4923640. Epub 2017/12/12. doi: 10.1155/2017/4923640 ; PubMed Central PMCID: PMC5687131. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Silva DG, Tinoco EM, Rocha GA, Rocha AMC, Guerra JB. Helicobacter pylori transiently in the mouth may participate in the transmission of infection. Mem Inst Oswaldo Cruz. 2010;105(5):657–60. doi: 10.1590/s0074-02762010000500009 [DOI] [PubMed] [Google Scholar]
34.Bury-Moné S, Kaakoush NO, Asencio C, Mégraud F, Thibonnier M, Reuse HD, et al. Is Helicobacter pylori a true microaerophile. Helicobacter. 2006;11(4):296–303. doi: 10.1111/j.1523-5378.2006.00413.x [DOI] [PubMed] [Google Scholar]
35.Yu X-C, Shao Q-Q, Ma J, Yu M, Zhang C, Lei L, et al. Family-based Helicobacter pylori infection status and transmission pattern in central China, and its clinical implications for related disease prevention. World Journal of Gastroenterology. 2022;28(28):3706–19. doi: 10.3748/wjg.v28.i28.3706 . [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Camilo V, Sugiyama T, Touati E. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2017;22 Suppl 1. Epub 2017/09/12. doi: 10.1111/hel.12405 . [DOI] [PubMed] [Google Scholar]
37.Tohidpour A. CagA-mediated pathogenesis of Helicobacter pylori. Microb Pathog. 2016;93:44–55. Epub 2016/01/23. doi: 10.1016/j.micpath.2016.01.005 . [DOI] [PubMed] [Google Scholar]
38.Saniee P, Siavoshi F, Nikbakht Broujeni G, Khormali M, Sarrafnejad A, Malekzadeh R. Immunodetection of Helicobacter pylori-specific proteins in oral and gastric Candida yeasts. Arch Iran Med. 2013;16(11):624–30. Epub 2013/11/12. 0131611/AIM.003 . [PubMed] [Google Scholar]
39.Saniee P, Siavoshi F. Endocytotic uptake of FITC-labeled anti-H. pylori egg yolk immunoglobulin Y in Candida yeast for detection of intracellular H. pylori. Front Microbiol. 2015;(6):113. Epub 2015/04/09. doi: 10.3389/fmicb.2015.00113 ; PubMed Central PMCID: PMC4362214. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Siavoshi F, Heydari S, Shafiee M, Ahmadi S, Saniee P, Sarrafnejad A, et al. Sequestration inside the yeast vacuole may enhance Helicobacter pylori survival against stressful condition. Infect Genet Evol. 2019;69:127–33. Epub 2019/01/27. doi: 10.1016/j.meegid.2019.01.029 . [DOI] [PubMed] [Google Scholar]
41.Sanchez-Alonzo K, Parra-Sepulveda C, Vega S, Bernasconi H, Campos VL, Smith CT, et al. In Vitro Incorporation of Helicobacter pylori into Candida albicans Caused by Acidic pH Stress. Pathogens. 2020;9(6). Epub 2020/06/25. doi: 10.3390/pathogens9060489 ; PubMed Central PMCID: PMC7350375. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Prince AL, Chu DM, Seferovic MD, Antony KM, Ma J, Aagaard KM. The perinatal microbiome and pregnancy: moving beyond the vaginal microbiome. Cold Spring Harb Perspect Med. 2015;5(6). Epub 2015/03/18. doi: 10.1101/cshperspect.a023051 ; PubMed Central PMCID: PMC4448707. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Burgers R, Schneider-Brachert W, Reischl U, Behr A, Hiller KA, Lehn N, et al. Helicobacter pylori in human oral cavity and stomach. Eur J Oral Sci. 2008;116(4):297–304. Epub 2008/08/19. doi: 10.1111/j.1600-0722.2008.00543.x . [DOI] [PubMed] [Google Scholar]
44.Salmanian AH, Siavoshi F, Akbari F, Afshari A, Malekzadeh R. Yeast of the oral cavity is the reservoir of Heliobacter pylori. J Oral Pathol Med. 2008;37(6):324–8. Epub 2008/02/13. doi: 10.1111/j.1600-0714.2007.00632.x . [DOI] [PubMed] [Google Scholar]
45.Heydari S, Siavoshi F, Jazayeri MH, Sarrafnejad A, Saniee P. Helicobacter pylori release from yeast as a vesicle-encased or free bacterium. Helicobacter. 2020;25(5):e12725. Epub 2020/07/16. doi: 10.1111/hel.12725 . [DOI] [PubMed] [Google Scholar]
46.Siavoshi F, Salmanian AH, Akbari F, Malekzadeh R, Massarrat S. Detection of Helicobacter pylori-specific genes in the oral yeast. Helicobacter. 2005;10(4):318–22. doi: 10.1111/j.1523-5378.2005.00319.x [DOI] [PubMed] [Google Scholar]
47.Siavoshi F, Saniee P. Vacuoles of Candida yeast as a specialized niche for Helicobacter pylori. World J Gastroenterol. 2014;20(18):5263–73. Epub 2014/05/17. doi: 10.3748/wjg.v20.i18.5263 ; PubMed Central PMCID: PMC4017041. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Alipour N, Gaeini N. Helicobacter is preserved in yeast vacuoles! Does Koch’s postulates confirm it? World J Gastroenterol. 2017;23(12):2266–8. Epub 2017/04/14. doi: 10.3748/wjg.v23.i12.2266 ; PubMed Central PMCID: PMC5374140. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Siavoshi F, Saniee P. Candida accommodates non-culturable Helicobacter pylori in its vacuole—Koch’s postulates aren’t applicable. World J Gastroenterol. 2018;24(2):310–4. Epub 2018/01/30. doi: 10.3748/wjg.v24.i2.310 ; PubMed Central PMCID: PMC5768950. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Wiles C.M., Mackenzie DWR. Fungal diseases of the central nervous system 1987. 93–117 p. [Google Scholar]
51.Jiang SJ, Liu WZ, Zhang DZ, Shi Y, Xiao SD, Zhang ZH, et al. Campylobacter-like organisms in chronic gastritis, peptic ulcer, and gastric carcinoma. Scand J Gastroenterol. 1987;22(5):553–8. doi: 10.3109/00365528708991897 . [DOI] [PubMed] [Google Scholar]
52.Vacca I. Fungal physiology: Acidic pH interferes with Candida persistence. Nature reviews Microbiology. 2017;15(7):382. Epub 2017/06/14. doi: 10.1038/nrmicro.2017.72 . [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0298442.r001

Decision Letter 0

António Machado

31 Jul 2023

PONE-D-23-17764Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal CandidaPLOS ONE

Dear Dr. Chen, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

I am pleased to say that most of the reviewers enjoyed the manuscript very much and we are excited about the possibility to publish your work. Nonetheless, all reviewers reported some concerns that must be addressed in your revised manuscript for publication endorsement. Please read carefully all reviewers’ reports. The main concerns are the following: 1) the power analysis should be done for the patient number; 2) The number of patients; 3) the pictures’ resolution is not good enough to publish; 4) the fact that authors should have submitted H pylori sequences to the GenBank with accession numbers and failed to add a phylogenetic tree that illustrates their findings; 5) the authors should also clarify their conclusions by been exact about the helicobacter genes they detected using PCR; 6) Discussion section includes many mistakes, wrong interpretations and misuse of references. 7) Convincing evidence of intracellular survival of H. pylori has been also published for some Entamoeba species (see, particularly, the work of Ferrus et al.). Probably this should be mentioned in the discussion, as it suggests that the capacity to survive in eukaryotic cells may not be limited to amebas or yeasts.

So, I kindly invite the authors to realize a thoughtful revision of the submitted manuscript to achieve publication endorsement by the reviewers. Please submit your revised manuscript by Sep 14 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Thank you and best regards,

António MachadoAcademic EditorPLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following financial disclosure:

“This work was supported by grants from the National Natural Science Foundation of China (No. 81860353), the Basic Research Program of Guizhou Science and Technology Plan (No. ZK [2022] 341), the Science and Technology Fund Project of Guizhou Health Commission (No. gzwkj2022-521) and the Scientific Foundation of Guizhou Medical University (No. 20NSP005), and the Foundation of Key Laboratory of Microbiology and Parasitology of Education Department, Guizhou (No. QJJ [2022] 019).”

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: All the data finding in the manuscript is too exciting. However, the power analysis should be done for the patient number. The number of patient that is mentioned as 50 is enough or not ? And the picture resolution is not good enough to publish

Reviewer #2: The authors have added to knowledge what we know about the presence of Helicobacter pylori (through bacteria like bodies) in Candida cells from the vagina.

The experiments are all well designed and are well described. However in the results, the authors though have submitted H pylori sequences to the GenBank with accession numbers, failed to add a phylogenetic tree that illustrates their findings. This would enhance the manuscript. They also try to discuss this without much proof in the results. I suggest they provide proof if they have the results as a figure in their results. In addition, the authors should also clarify their conclusions by been exact about the helicobacter genes they detected using PCR.

Reviewer #3: PONE-D-23-17764

Reviewer’s Comments

Intracellular presence of H. pylori antigen and genes within gastric and vaginal Candida

Abstract:

This section needs to be organized in 4 parts; Background (including the aim of study), Methods, Results and Conclusions. Results should be organized according to methods and both sections need more details. Authors should differentiate between the “presence” and “internalization” of H. pylori mentioned in the aim and conclusions of the study, respectively.

Introduction:

Lines 63-68 contradict the presence of H. pylori in gastrointestinal tract, including the oral cavity. According to several reports mentioned in the present study, occurrence of H. pylori has been demonstrated in the oral cavity by detection of H. pylori-specific genes. Furthermore, in the last line of conclusions in the discussion section, authors concluded that H. pylori transmission occurs during vaginal delivery and through the oral cavity of newborn. That means that even Candida yeast (as a shelter for H. pylori) has to enter the gastrointestinal tract of mother or child through the portal of oral cavity. Accordingly, in the present study, detection of H. pylori genes in Candida isolates from oral cavity of mothers and newborns could help to better clarify the results. However, a similar but more elaborated study has been performed and the results have been published in 2013 (reference # 24).

Line 68-69 is confusing and needs to be revised and supported by a reference. Line 73 is confusing. Line 77-78 must be clarified. Lines 76-84 must be included in one paragraph as the aim of study.

Above all these, this study lacks the literature review of previous studies about the intracellular life of H. pylori inside the vacuole of Candida yeast (isolated from different sources including oral cavity, stomach, vagina and a variety of foods) that have been published since 1998. According to these previously published reports, the story began when Candida yeast was isolated along with H. pylori from the cultures of gastric biopsies. Accordingly, if authors do not wish to acknowledge the previous studies, they need to explain how they came to the idea of studying the presence of H. pylori inside the yeast? Although they have used several of them in discussion section but mostly with wrong interpretations.

Methods:

This section needs major revisions due to inconsistency in the number of patients and type of samples. It is not clear why the number of samples in different groups is not equal. Use of 2 gastric yeasts as the representative of yeasts of gastrointestinal tract is not enough for conclusive results. Some methods like Live/Dead bacterial staining is too long and some like UBT has not been described. Patients’ information like age and type of gastric diseases is missing. Results of Candida identification and their correlation with other results were not considered in results and discussion sections. The relationship between type of Candida species and detection of intracellular H. pylori genes or observing BLBs has not been considered. What was the origin of the reference C. albicans (ATCC 10231)? The transmission electron microscopy section needs more details. This sentence is not clear and needs explanation: “Candida was treated with 32 μg/mL amphotericin B at 37°C shaking at 120 r/min for 24 h [28] ”. What was the purpose of using amphoterici B? For detection of urease activity in Candida: Did you detect this activity in all the yeasts positive for H. pylori? There is no description of recruited yeasts. A reference is needed for SDA+40% urea. Why 40% urea was used? What was the pH of the medium?

Results:

Every patient that carried yeast with or without positive result of H. pylori 16S rDNA detection must be classified according to: The type of sample from pregnant or non-pregnant women, the identity of isolated Candida (by CHROMagar), observation of intracellular bacteria (by light microscopy) and live bacteria (by Live/Dead stain), results of cagA and ureA detection, UBT and serology. Otherwise, inconsistency in the number and type of samples in the present study is totally confusing and will not allow reaching any conclusive results. Accordingly, information presented as figure 1 and Table 2 are confusing rather than being informative.

These two sentences need to be clarified:

1- “Furthermore, among H. pylori-negative patients, only one vaginal Candida isolate lacked BLBs and was negative for H. pylori 16S rDNA and ureA (Fig 1). These results indicate that H. pylori 16S rDNA was present in Candida isolates with BLBs. Individuals who provided such specimens were therefore infected with H.pylori”.

To correlate the detection of 16S rDNA or intracellular bacteria inside the vaginal yeast to H. pylori infection in the stomach or positive IgG antibody, strong explanations and supporting references are needed. Results of this study do not support this conclusion.

2- “Intracellular presence of H. pylori-specific genes within Candida subcultures”.

This must become clear in this study that why the authors subcultured yeast isolates more than 10 times. These subsequent subculturings (on SDA+ chloramphenicol) must have been performed at the beginning of isolation of yeasts and from then on, there is no need to subculture more than 10 times because the primary purpose should have been removing any probable extracellular bacterial contamination. According to previously published reports, persistent intracellular existence of H. pylori in yeast is an evolutionary phenomenon that cannot be changed by subcultures. This important issue has been totally ignored in this study.

- Results of electron microscopy are missing.

- What was the difference between BLB-positive and BLB-negative Candida yeasts?

Figure 4: Light microscopy: The images are so small and unclear that one cannot differentiate between bacterial cell and other intracellular entities. Arrows do not really point to any clear entity. These photographs do not show any convincing results.

Figure 5: Live/Dead stain: There is no need to describe the mechanism of staining in the legend. Arrows in B could point to yeast’s nucleus or mitochondria which generally stain green. There is no mention of killing yeast in method section, also no comment on the control yeast that stained green.

Figure 6: Micrographs show that yeasts’ specimens were not properly prepared. They show no details of intracellular structures. “High electron density body” is confusing and needs to be explained.

Fig 7: Photograph C must be replaced by a better one with higher magnification.

Figures in this section that are the main part of this study fail to show convincing results .

Discussion:

There are several major misunderstanding and misuse of references, also a wrong conclusion as the followings:

Line 249-250: Need a reference.

Line 252-253: Authors need to specify transmission to newborns’ oral cavity through vaginal delivery .

Line 256: The importance of cagA positivity has not been discussed.

Line 261-262: “H. pylori- specific nucleic acids” is not consistent with other parts of the manuscript.

Line 272-273: Use of amphotericin must be explained.

Line 278-279: References Burgers et al. 2008, Siavoshi &Taghikhani 2013 and Salmanian et al. 2008 are not related and have been misused.

Line 284-287: Are these related to your study or need a reference. In this study only two gastric yeasts were used that is not convincing and do not correlate with vaginal yeasts.

Line 288-292: Not included in the method and results of this manuscript. Furthermore, references are not relevant and have been misused.

Line 294-299: These lines are not related to the study and have been used by mistake.

Line 300-304: Totally misinterpreted and the references are not related.

Conclusion:

- There is no interpretation to show the importance of detection of cagA or ureA genes in H. pylori-positive yeasts. Also, no description for the repeating sentence of “H. pylori was detectable in Candida isolates at the end of 10th subculture”.

The last sentence in conclusion: “Candida can act as a reservoir of H. pylori in the gastrointestinal tract of women, allowing the bacteria to migrate through the intestine to the vagina, eventually infecting newborns during delivery”, does not correspond to the aim of study and the title of the manuscript. Gastrointestinal tract includes oral cavity, stomach and intestine. Therefore, this conclusion is not correct because there are no samples from the oral cavity and feces of mothers and oral cavity of newborns.

Reviewer’s overall comment: This manuscript is not acceptable.

This manuscript looks like a thesis that needs substantial corrections. Introduction and aim of study need to be organized according to an extensive literature review on the basic science of bacteria (prokaryote)-yeast (eukaryote) interactions. It needs more consistent and reliable methods, specially sampling. Results are disintegrated and non-coherent, photographs are the main weakness of the results. Discussion includes many mistakes, wrong interpretations and misuse of references. This manuscript is a weak version of the previously reported studies and thus is devoid of any novelty.

Reviewer #4: The article is well performed and well written. The number of patients is limited, but the evidence supporting the survival of viable H. pylori inside yeasts is solid and gives support to a few previous reports. This may help to explain how H. pylori manages to survive outside the human organism allowing a deeper knowledge of the the intriguing epidemiology of H. pylori infection.

I have only a minor suggestion regarding the discussion. Convincing evidence of intracellular survival of H. pylori has been also published for some Entamoeba species (see, particularly, the work of Ferrus et al.). Probably this should be mentioned in the discussion, as it suggests that the capacity to survive in eukaryotic cell may not be limited to amebas or yeasts.

Furthermore, I found very interesting that Candida species carrying H. pylori showed detectable urease activity. Might this fact suggest a symbiotic relationship between H. pylori and Candida allowing the yeast to survive in acidic environments?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Sinem Oktem Okullu

Reviewer #2: No

Reviewer #3: No

Reviewer #4: Yes: Xavier Calvet

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: PLOS- review July 2023.docx

Click here for additional data file.^{(17.4KB, docx)}

PLoS One. 2024 Feb 8;19(2):e0298442. doi: 10.1371/journal.pone.0298442.r002

Author response to Decision Letter 0

24 Dec 2023

Response to reviewers

Title: Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida

ID: PONE-D-23-17764

We wish to thank the editor and referee for their valuable and constructive comments, which have helped us to improve our manuscript. We have carefully addressed each of the comments and hope that our revised manuscript will meet with your approval. The revised text is shown in the manuscript. Our point-by-point responses to the comments are detailed below.

Response to the reviewer’s comments:

Reviewer #1:

1. The power analysis should be done for the patient number. The number of patients that is mentioned as 50 is enough or not? And the picture resolution is not good enough to publish.

Response: In this study, 42 female patients were included, in addition to 50 pregnant women.

One Candida strain was isolated from each vaginal discharge sample of a pregnant woman, yielding 50 isolates. It was statistically significant.

We are about to resubmit pictures that meet the journal's requirements.

Reviewer #2:

1. In the results, the authors though have submitted H. pylori sequences to the GenBank with accession numbers, failed to add a phylogenetic tree that illustrates their findings. They also try to discuss this without much proof in the results. I suggest they provide proof if they have the results as a figure in their results. The authors should also clarify their conclusions by been exact about the helicobacter genes they detected using PCR.

Response:

In this study, the specific genes of H. pylori (16S rDNA, cagA, ureA) were amplified from Candida by PCR, and the sequence was confirmed to be H. pylori by BLAST alignment. In addition, we had submitted H. pylori sequences to the GenBank. Some sequences of H. pylori 16S rDNA (accession no. ON545841, ON545842 and ON631242) and cagA had been submitted to GenBank (accession no. OM779116, OM779117 and OM812999).

Reviewer #3:

1. Abstract:

Response: The abstract is organized in four sections: background, methods, results, and conclusions. The results are organized according to method, with more details in both sections. The “presence” refers to the detection of H. pylori antigens and specific genes in Candida cells by various methods. The “presence” in the aim of the study has been changed to “internalization”.

2. Introduction:

Response: We believe that these contents are not contradictory and are intended to explain the fact that the oral cavity is not a suitable host for the colonization of Helicobacter pylori.

3. Line 68-69 is confusing and needs to be revised and supported by a reference. Line 73 is confusing. Line 77-78 must be clarified. Lines 76-84 must be included in one paragraph as the aim of study.

Response: Line 68-69 is confusing and needs to be revised and supported by a reference. Mao et al. presented a critical discussion of previous studies investigating the potential colonization of the oral cavity by H. pylori [1].

Line 73 is confusing. The original 73 lines are “However, little attention has been paid to transmission routes for H. pylori beyond the typical oral-oral routes or fecal-oral routes.” now modified as "However, there has been little focus on investigating alternate transmission routes for H. pylori beyond the commonly recognized oral-oral or fecal-oral routes." Line 77-78 must be clarified. Lines 76-84 must be included in one paragraph as the aim of study. Lines 77-78 can be explained by lines 79-84, thus lines 76-78 are placed after lines 84 and in a paragraph.

Response: The revised text of the above questions is shown in the manuscript.

4. Methods: It is not clear why the number of samples in different groups is not equal. Some methods like Live/Dead bacterial staining is too long and some like UBT has not been described. Patients’ information like age and type of gastric diseases is missing. Results of Candida identification and their correlation with other results were not considered in results and discussion sections. The relationship between type of Candida species and detection of intracellular H. pylori genes or observing BLBs has not been considered. What was the origin of the reference C. albicans (ATCC 10231)? The transmission electron microscopy section needs more details. This sentence is not clear and needs explanation: “Candida was treated with 32 μg/mL amphotericin B at 37°C shaking at 120 r/min for 24 h [28]”. What was the purpose of using amphoterici B? For detection of urease activity in Candida: Did you detect this activity in all the yeasts positive for H. pylori? There is no description of recruited yeasts. A reference is needed for SDA+40% urea. Why 40% urea was used? What was the pH of the medium?

It is not clear why the number of samples in different groups is not equal.

Response: The number of pregnant women and female patients with digestive disorders varied, as patients came from both outpatient and inpatient units and had relatively large mobility.

Patients’ information like age and type of gastric diseases is missing.

Response: Data are not available for public access due to patient privacy concerns, but datasets generated during the current study are available from the corresponding author upon reasonable request.

Some methods like Live/Dead bacterial staining is too long and some like UBT has not been described. Patients’ information like age and type of gastric diseases is missing. Results of Candida identification and their correlation with other results were not considered in results and discussion sections. The relationship between type of Candida species and detection of intracellular H. pylori genes or observing BLBs has not been considered. What was the origin of the reference C. albicans (ATCC 10231)? The transmission electron microscopy section needs more details.

Response: An activity assay staining time of 15 min was used to allow adequate staining of Candida cells and their intracellular structures. Candida albicans standard strain ATCC10231, a strain deposited in our laboratory. The revised text of the above questions is shown in the manuscript.

5. Results: 1- “Furthermore, among H. pylori-negative patients, only one vaginal Candida isolate lacked BLBs and was negative for H. pylori 16S rDNA and ureA (Fig 1). These results indicate that H. pylori 16S rDNA was present in Candida isolates with BLBs. Individuals who provided such specimens were therefore infected with H. pylori”.

Response: Although only one Candida isolate, the vaginal Candida isolate of H. pylori-negative patients, lacked BLBs and was negative for H. pylori 16S rDNA and urea, so we need to do a lot of research on it in the future. In addition, thirteen vaginal Candida isolates from pregnant women, who were positive for H. pylori IgG antibody, were positive for intracellular H. pylori specific 16S rDNA.

Results: 2-This must become clear in this study that why the authors subcultured yeast isolates more than 10 times. These subsequent subculturings (on SDA+ chloramphenicol) must have been performed at the beginning of isolation of yeasts and from then on, there is no need to subculture more than 10 times because the primary purpose should have been removing any probable extracellular bacterial contamination.

Response: To eliminate any possible bacterial contamination, yeast isolates were sub-cultured on SDA medium with chloramphenicol ten times starting from the sample inoculation.

Results: - What was the difference between BLB-positive and BLB-negative Candida yeasts?

Response: BLB-positive Candida refers to the presence of Helicobacter pylori genes and antigens in the Candida, and conversely, BLB-negative Candida refers to the absence of H. pylori.

Fig 7: Photograph C must be replaced by a better one with higher magnification.

Figures in this section that are the main part of this study fail to show convincing results.

Response: The figures and contents of Figs. 4–7 have been corrected for the review comments, see the corresponding sections in the manuscript.

6. Discussion:

Line 249-250: Need a reference. Line 252-253: Authors need to specify transmission to newborns’ oral cavity through vaginal delivery. Line 256: The importance of cagA positivity has not been discussed. Line 261-262: “H. pylori- specific nucleic acids” is not consistent with other parts of the manuscript. Line 272-273: Use of amphotericin must be explained. Line 278-279: References Burgers et al. 2008, Siavoshi &Taghikhani 2013 and Salmanian et al. 2008 are not related and have been misused.

Line 284-287: Are these related to your study or need a reference. In this study only two gastric yeasts were used that is not convincing and do not correlate with vaginal yeasts. Line 288-292: Not included in the method and results of this manuscript. Furthermore, references are not relevant and have been misused. Line 294-299: These lines are not related to the study and have been used by mistake. Line 300-304: Totally misinterpreted and the references are not related.

Response: References have been added to Line 249-250. The remaining modifications are shown in the manuscript.

Line 288-292: Not included in the method and results of this manuscript. Under light microscopy, we observed rapid movement of bacteria within Candida vacuoles, and we can provide the video as Supplementary Material.

Line 294-299: These lines are not related to the study and have been used by mistake. Line 300-304: Totally misinterpreted and the references are not related. For this part of the content, we stick to our point of view without making changes.

Response: The revised text of the above questions is shown in the manuscript.

Reviewer #4: I have only a minor suggestion regarding the discussion. Convincing evidence of intracellular survival of H. pylori has been also published for some Entamoeba species (see, particularly, the work of Ferrus et al.). Probably this should be mentioned in the discussion, as it suggests that the capacity to survive in eukaryotic cell may not be limited to amebas or yeasts.

Response: H. pylori is known to be present in amebas or yeasts, and probably in other eukaryotic cells.

Candida albicans is an opportunistic fungal pathogen that can colonize host niches at varying pH [2]. Candida species carrying H. pylori showed detectable urease activity. It suggests a symbiotic relationship between H. pylori and Candida, allowing the yeast to survive in acidic environments.

1. Mao X, Jakubovics NS, Bachle M, Buchalla W, Hiller KA, Maisch T, et al. Colonization of Helicobacter pylori in the oral cavity - an endless controversy? Crit Rev Microbiol. 2021;47(5):612-29. Epub 2021/04/27. doi: 10.1080/1040841X.2021.1907740. PubMed PMID: 33899666.

2. Vacca I. Fungal physiology: Acidic pH interferes with Candida persistence. Nature reviews Microbiology. 2017;15(7):382. Epub 2017/06/14. doi: 10.1038/nrmicro.2017.72. PubMed PMID: 28607379.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(23.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0298442.r003

Decision Letter 1

António Machado

24 Jan 2024

Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida

PONE-D-23-17764R1

Dear authors,

I am pleased to inform you that all three reviewers enjoyed the manuscript very much and endorsed the revised manuscript for publication.

Thank you for choosing Plos ONE journal to publish your study.

Best regards,

António Machado

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #4: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #4: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #4: Yes

**********

6. Review Comments to the Author

Reviewer #1: All comments have been addressed by the authors and this manuscript is suitable for the publication

Reviewer #2: The authors have answered all the comments on their work. I still think a phylogenetic tree of the sequenced amplified Helicobacter pylori genes would have strengthened your results section.

Reviewer #4: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Sinem Öktem Okullu, PhD Assist Prof

Reviewer #2: No

Reviewer #4: No

**********

PLoS One. doi: 10.1371/journal.pone.0298442.r004

Acceptance letter

António Machado

30 Jan 2024

PONE-D-23-17764R1

PLOS ONE

Dear Dr. Chen,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. António Machado

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig

(PDF)

Click here for additional data file.^{(4.2MB, pdf)}

S1 File

(XLSX)

Click here for additional data file.^{(14.8KB, xlsx)}

S1 Video

(AVI)

Click here for additional data file.^{(921.4KB, avi)}

Attachment

Submitted filename: PLOS- review July 2023.docx

Click here for additional data file.^{(17.4KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(23.4KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0298442.ref001] 1.Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1983;1(8336):1273–5. Epub 1983/06/04. . [PubMed] [Google Scholar]

[pone.0298442.ref002] 2.Cancer IAfRo. Infection with Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994;61:177–240. PubMed Central PMCID: PMC7681529. [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref003] 3.Peter S, Beglinger C. Helicobacter pylori and gastric cancer: the causal relationship. Digestion. 2007;75(1):25–35. Epub 2007/04/13. doi: 10.1159/000101564 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref004] 4.Wise MJ, Lamichhane B, Webberley KM. A Longitudinal, Population-Level, Big-Data Study of Helicobacter pylori-Related Disease across Western Australia. J Clin Med. 2019;8(11). Epub 2019/11/07. doi: 10.3390/jcm8111821 ; PubMed Central PMCID: PMC6912511. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref005] 5.Obaidat MM, Roess AA. First nationwide seroepidemiology and risk factors report of Helicobater pylori in Jordan. Helicobacter. 2019;24(3):e12572. Epub 2019/03/15. doi: 10.1111/hel.12572 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref006] 6.Malaty HM, Kumagai T, Tanaka E, Ota H, Kiyosawa K, Graham DY, et al. Evidence from a nine-year birth cohort study in Japan of transmission pathways of Helicobacter pylori infection. J Clin Microbiol. 2000;38(5):1971–3. Epub 2000/05/02. doi: 10.1128/JCM.38.5.1971-1973.2000 ; PubMed Central PMCID: PMC86638. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref007] 7.Rowland M, Daly L, Vaughan M, Higgins A, Bourke B, Drumm B. Age-specific incidence of Helicobacter pylori. Gastroenterology. 2006;130(1):65–72; quiz 211. Epub 2006/01/13. doi: 10.1053/j.gastro.2005.11.004 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref008] 8.Weyermann M, Rothenbacher D, Brenner H. Acquisition of Helicobacter pylori infection in early childhood: independent contributions of infected mothers, fathers, and siblings. Am J Gastroenterol. 2009;104(1):182–9. Epub 2008/12/23. doi: 10.1038/ajg.2008.61 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref009] 9.Frenck RW Jr, Fathy HM, Sherif M, Mohran Z, El Mohammedy H, Francis W, et al. Sensitivity and specificity of various tests for the diagnosis of Helicobacter pylori in Egyptian children. Pediatrics. 2006;118(4):e1195–202. Epub 2006/09/20. doi: 10.1542/peds.2005-2925 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref010] 10.Laszewicz W, Iwańczak F, Iwańczak B. Seroprevalence of Helicobacter pylori infection in Polish children and adults depending on socioeconomic status and living conditions. Advances In Medical Sciences. 2014;59(1):147–50. doi: 10.1016/j.advms.2014.01.003 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref011] 11.Gao T, Zhao M, Zhang C, Wang P, Zhou W, Tan S, et al. Association of Helicobacter pylori Infection with Vitamin D Deficiency in Infants and Toddlers. Am J Trop Med Hyg. 2020;102(3):541–6. Epub 2020/01/15. doi: 10.4269/ajtmh.19-0523 ; PubMed Central PMCID: PMC7056419. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref012] 12.Quaglia NC, Dambrosio A. Helicobacter pylori: A foodborne pathogen. World J Gastroenterol. 2018;24(31):3472–87. doi: 10.3748/wjg.v24.i31.3472 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref013] 13.Yahaghi E, Khamesipour F, Mashayekhi F, Safarpoor Dehkordi F, Sakhaei MH, Masoudimanesh M, et al. Helicobacter pylori in vegetables and salads: genotyping and antimicrobial resistance properties. Biomed Res Int. 2014;2014:757941. Epub 2014/09/04. doi: 10.1155/2014/757941 ; PubMed Central PMCID: PMC4145543. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref014] 14.Farhadkhani M, Nikaeen M, Hassanzadeh A, Nikmanesh B. Potential transmission sources of Helicobacter pylori infection: detection of H. pylori in various environmental samples. J Environ Health Sci Eng. 2019;17(1):129–34. Epub 2019/07/20. doi: 10.1007/s40201-018-00333-y ; PubMed Central PMCID: PMC6582085. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref015] 15.Ding Z, Zhao S, Gong S, Li Z, Mao M, Xu X, et al. Prevalence and risk factors of Helicobacter pylori infection in asymptomatic Chinese children: a prospective, cross-sectional, population-based study. Aliment Pharmacol Ther. 2015;42(8):1019–26. Epub 2015/08/15. doi: 10.1111/apt.13364 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref016] 16.Mezmale L, Coelho LG, Bordin D, Leja M. Review: Epidemiology of Helicobacter pylori. Helicobacter. 2020;25 Suppl 1:e12734. Epub 2020/09/13. doi: 10.1111/hel.12734 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref017] 17.Mao X, Jakubovics NS, Bachle M, Buchalla W, Hiller KA, Maisch T, et al. Colonization of Helicobacter pylori in the oral cavity—an endless controversy? Crit Rev Microbiol. 2021;47(5):612–29. Epub 2021/04/27. doi: 10.1080/1040841X.2021.1907740 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref018] 18.Weyermann M, Adler G, Brenner H, Rothenbacher D. The mother as source of Helicobacter pylori infection. Epidemiology. 2006;17(3):332–4. Epub 2006/02/03. doi: 10.1097/01.ede.0000201257.31155.a0 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref019] 19.Yokota S, Konno M, Fujiwara S, Toita N, Takahashi M, Yamamoto S, et al. Intrafamilial, Preferentially Mother-to-Child and Intraspousal, Helicobacter pylori Infection in Japan Determined by Mutilocus Sequence Typing and Random Amplified Polymorphic DNA Fingerprinting. Helicobacter. 2015;20(5):334–42. Epub 2015/02/11. doi: 10.1111/hel.12217 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref020] 20.Zhao Y, Gao X, Guo J, Yu D, Xiao Y, Wang H, et al. Helicobacter pylori infection alters gastric and tongue coating microbial communities. Helicobacter. 2019;24(2):e12567. Epub 2019/02/09. doi: 10.1111/hel.12567 ; PubMed Central PMCID: PMC6593728. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref021] 21.Flores-Trevino CE, Urrutia-Baca VH, Gomez-Flores R, De La Garza-Ramos MA, Sanchez-Chaparro MM, Garza-Elizondo MA. Molecular detection of Helicobacter pylori based on the presence of cagA and vacA virulence genes in dental plaque from patients with periodontitis. J Dent Sci. 2019;14(2):163–70. Epub 2019/06/19. doi: 10.1016/j.jds.2019.01.010 ; PubMed Central PMCID: PMC6562180. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref022] 22.Šeligová B, Lukáč Ľ, Bábelová M, Vávrová S, Sulo P. Diagnostic reliability of nested PCR depends on the primer design and threshold abundance of Helicobacter pylori in biopsy, stool, and saliva samples. Helicobacter. 2020;25(2):e12680. doi: 10.1111/hel.12680 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref023] 23.Hamada M, Nomura R, Ogaya Y, Matayoshi S, Kadota T, Morita Y, et al. Potential involvement of Helicobacter pylori from oral specimens in overweight body-mass index. Scientific Reports. 2019;9(1):4845. doi: 10.1038/s41598-019-41166-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref024] 24.Siavoshi F, Taghikhani A, Malekzadeh R, Sarrafnejad A. The role of mother’s oral and vaginal yeasts in transmission of Helicobacter pylori to neonates. European Journal of Gastroenterology & Hepatology. 2013;16(5):288–94. [PubMed] [Google Scholar]

[pone.0298442.ref025] 25.Lu Y, Redlinger TE, Avitia R, Galindo A, Goodman K. Isolation and genotyping of Helicobacter pylori from untreated municipal wastewater. Applied and Environmental Microbiology. 2002;68(3):1436–9. doi: 10.1128/AEM.68.3.1436-1439.2002 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref026] 26.Ansari SA, Iqbal MUN, Khan TA, Kazmi SU. Association of oral Helicobacter pylori with gastric complications. Life Sci. 2018;205:125–30. Epub 2018/05/16. doi: 10.1016/j.lfs.2018.05.026 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref027] 27.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406–25. Epub 1987/07/01. doi: 10.1093/oxfordjournals.molbev.a040454 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref028] 28.Felsenstein J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution. 1985;39(4):783–91. Epub 1985/07/01. doi: 10.1111/j.1558-5646.1985.tb00420.x . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref029] 29.Sanchez-Alonzo K, Matamala-Valdes L, Parra-Sepulveda C, Bernasconi H, Campos VL, Smith CT, et al. Intracellular Presence of Helicobacter pylori and Its Virulence-Associated Genotypes within the Vaginal Yeast of Term Pregnant Women. Microorganisms. 2021;9(1). Epub 2021/01/13. doi: 10.3390/microorganisms9010131 ; PubMed Central PMCID: PMC7827377. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref030] 30.Siavoshi F, Tavakolian A, Foroumadi A, Hosseini NM, Massarrat S, Pedramnia S, et al. Comparison of the effect of non-antifungal and antifungal agents on Candida isolates from the gastrointestinal tract. Arch Iran Med. 2012;15(1):27–31. Epub 2012/01/03. . [PubMed] [Google Scholar]

[pone.0298442.ref031] 31.Deng Y, Ding X, Song Q, Zhao G, Han L, Ding B, et al. Alterations in mucosa-associated microbiota in the stomach of patients with gastric cancer. Cellular oncology (Dordrecht). 2021;44(3):701–14. Epub 2021/03/27. doi: 10.1007/s13402-021-00596-y ; PubMed Central PMCID: PMC8213677. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref032] 32.Mendoza-Cantu A, Urrutia-Baca VH, Urbina-Rios CS, De la Garza-Ramos MA, Garcia-Martinez ME, Torre-Martinez HHH. Prevalence of Helicobacter pylori vacA Genotypes and cagA Gene in Dental Plaque of Asymptomatic Mexican Children. Biomed Res Int. 2017;2017:4923640. Epub 2017/12/12. doi: 10.1155/2017/4923640 ; PubMed Central PMCID: PMC5687131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref033] 33.Silva DG, Tinoco EM, Rocha GA, Rocha AMC, Guerra JB. Helicobacter pylori transiently in the mouth may participate in the transmission of infection. Mem Inst Oswaldo Cruz. 2010;105(5):657–60. doi: 10.1590/s0074-02762010000500009 [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref034] 34.Bury-Moné S, Kaakoush NO, Asencio C, Mégraud F, Thibonnier M, Reuse HD, et al. Is Helicobacter pylori a true microaerophile. Helicobacter. 2006;11(4):296–303. doi: 10.1111/j.1523-5378.2006.00413.x [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref035] 35.Yu X-C, Shao Q-Q, Ma J, Yu M, Zhang C, Lei L, et al. Family-based Helicobacter pylori infection status and transmission pattern in central China, and its clinical implications for related disease prevention. World Journal of Gastroenterology. 2022;28(28):3706–19. doi: 10.3748/wjg.v28.i28.3706 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref036] 36.Camilo V, Sugiyama T, Touati E. Pathogenesis of Helicobacter pylori infection. Helicobacter. 2017;22 Suppl 1. Epub 2017/09/12. doi: 10.1111/hel.12405 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref037] 37.Tohidpour A. CagA-mediated pathogenesis of Helicobacter pylori. Microb Pathog. 2016;93:44–55. Epub 2016/01/23. doi: 10.1016/j.micpath.2016.01.005 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref038] 38.Saniee P, Siavoshi F, Nikbakht Broujeni G, Khormali M, Sarrafnejad A, Malekzadeh R. Immunodetection of Helicobacter pylori-specific proteins in oral and gastric Candida yeasts. Arch Iran Med. 2013;16(11):624–30. Epub 2013/11/12. 0131611/AIM.003 . [PubMed] [Google Scholar]

[pone.0298442.ref039] 39.Saniee P, Siavoshi F. Endocytotic uptake of FITC-labeled anti-H. pylori egg yolk immunoglobulin Y in Candida yeast for detection of intracellular H. pylori. Front Microbiol. 2015;(6):113. Epub 2015/04/09. doi: 10.3389/fmicb.2015.00113 ; PubMed Central PMCID: PMC4362214. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref040] 40.Siavoshi F, Heydari S, Shafiee M, Ahmadi S, Saniee P, Sarrafnejad A, et al. Sequestration inside the yeast vacuole may enhance Helicobacter pylori survival against stressful condition. Infect Genet Evol. 2019;69:127–33. Epub 2019/01/27. doi: 10.1016/j.meegid.2019.01.029 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref041] 41.Sanchez-Alonzo K, Parra-Sepulveda C, Vega S, Bernasconi H, Campos VL, Smith CT, et al. In Vitro Incorporation of Helicobacter pylori into Candida albicans Caused by Acidic pH Stress. Pathogens. 2020;9(6). Epub 2020/06/25. doi: 10.3390/pathogens9060489 ; PubMed Central PMCID: PMC7350375. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref042] 42.Prince AL, Chu DM, Seferovic MD, Antony KM, Ma J, Aagaard KM. The perinatal microbiome and pregnancy: moving beyond the vaginal microbiome. Cold Spring Harb Perspect Med. 2015;5(6). Epub 2015/03/18. doi: 10.1101/cshperspect.a023051 ; PubMed Central PMCID: PMC4448707. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref043] 43.Burgers R, Schneider-Brachert W, Reischl U, Behr A, Hiller KA, Lehn N, et al. Helicobacter pylori in human oral cavity and stomach. Eur J Oral Sci. 2008;116(4):297–304. Epub 2008/08/19. doi: 10.1111/j.1600-0722.2008.00543.x . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref044] 44.Salmanian AH, Siavoshi F, Akbari F, Afshari A, Malekzadeh R. Yeast of the oral cavity is the reservoir of Heliobacter pylori. J Oral Pathol Med. 2008;37(6):324–8. Epub 2008/02/13. doi: 10.1111/j.1600-0714.2007.00632.x . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref045] 45.Heydari S, Siavoshi F, Jazayeri MH, Sarrafnejad A, Saniee P. Helicobacter pylori release from yeast as a vesicle-encased or free bacterium. Helicobacter. 2020;25(5):e12725. Epub 2020/07/16. doi: 10.1111/hel.12725 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref046] 46.Siavoshi F, Salmanian AH, Akbari F, Malekzadeh R, Massarrat S. Detection of Helicobacter pylori-specific genes in the oral yeast. Helicobacter. 2005;10(4):318–22. doi: 10.1111/j.1523-5378.2005.00319.x [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref047] 47.Siavoshi F, Saniee P. Vacuoles of Candida yeast as a specialized niche for Helicobacter pylori. World J Gastroenterol. 2014;20(18):5263–73. Epub 2014/05/17. doi: 10.3748/wjg.v20.i18.5263 ; PubMed Central PMCID: PMC4017041. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref048] 48.Alipour N, Gaeini N. Helicobacter is preserved in yeast vacuoles! Does Koch’s postulates confirm it? World J Gastroenterol. 2017;23(12):2266–8. Epub 2017/04/14. doi: 10.3748/wjg.v23.i12.2266 ; PubMed Central PMCID: PMC5374140. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref049] 49.Siavoshi F, Saniee P. Candida accommodates non-culturable Helicobacter pylori in its vacuole—Koch’s postulates aren’t applicable. World J Gastroenterol. 2018;24(2):310–4. Epub 2018/01/30. doi: 10.3748/wjg.v24.i2.310 ; PubMed Central PMCID: PMC5768950. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0298442.ref050] 50.Wiles C.M., Mackenzie DWR. Fungal diseases of the central nervous system 1987. 93–117 p. [Google Scholar]

[pone.0298442.ref051] 51.Jiang SJ, Liu WZ, Zhang DZ, Shi Y, Xiao SD, Zhang ZH, et al. Campylobacter-like organisms in chronic gastritis, peptic ulcer, and gastric carcinoma. Scand J Gastroenterol. 1987;22(5):553–8. doi: 10.3109/00365528708991897 . [DOI] [PubMed] [Google Scholar]

[pone.0298442.ref052] 52.Vacca I. Fungal physiology: Acidic pH interferes with Candida persistence. Nature reviews Microbiology. 2017;15(7):382. Epub 2017/06/14. doi: 10.1038/nrmicro.2017.72 . [DOI] [PubMed] [Google Scholar]

PERMALINK

Intracellular presence of Helicobacter pylori antigen and genes within gastric and vaginal Candida

Tingxiu Yang

Jia Li

Yuanyuan Zhang

Zhaohui Deng

Guzhen Cui

Jun Yuan

Jianchao Sun

Xiaojuan Wu

Dengxiong Hua

Song Xiang

Zhenghong Chen

Roles

Abstract

Background

Methods

Results

Conclusion

Introduction

Material and methods

Ethics approval and consent to participate

Samples

Candida isolation and identification

Detection of H. pylori-specific genes in Candida cells

Table 1. Primers sequences and amplification conditions.

Alignment and phylogenetic analysis

Subculturing of H. pylori-positive Candida and detection of H. pylori- specific genes from Candida

Microscopic observation of BLBs in Candida

Detection of intracellular H. pylori antigen by immunofluorescence

Detection of urease activity in H. pylori internalized by Candida

Results

Helicobacter pylori infection

Fig 1. Consistency of diagnosis across H. pylori infection and H. pylori within Candida cells.

Candida isolation, identification and subcultures

Table 2. Number of isolated Candida from vaginal discharge and gastric mucosa, along with the frequency of 16S rDNA and cagA of intracellular H. pylori in Candida.

Intracellular presence of H. pylori-specific genes within Candida subcultures

Fig 2. Agarose gel electrophoresis to visualize PCR-amplified H. pylori 16S rDNA and ureA from Candida.

Fig 3. Agarose gel electrophoresis to visualize PCR-amplified H. pylori cagA from Candida in patients with gastric disease.

Phylogenetic analyses

Fig 4. . An analysis of the H. pylori 16S rRNA gene sequences produced a neighbor-joining tree.

Microscopic observations reveal the presence of live H. pylori in Candida cells

Fig 5. Candida isolated from clinical specimens, under a 100× light microscope.

Fig 6. Fluorescence micrograph of Candida stained using a LIVE/DEAD-BacLight kit.

Fig 7. Transmission electron microscopy (TEM) images of Candida.

Direct immunofluorescence assay confirmed the presence of H. pylori antigen in Candida

Fig 8. Immunolabeling of H. pylori.

Detection of urease activity in H. pylori internalized by Candida

Consistency between H. pylori infection, BLBs and intracellular H. pylori in Candida

Discussion

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

António Machado

Roles

Author response to Decision Letter 0

Decision Letter 1

António Machado

Roles

Acceptance letter

António Machado

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases