Skip to main content
Springer logoLink to Springer
. 2024 Jan 22;38(2):177–203. doi: 10.1007/s40259-024-00644-7

Splice-Modulating Antisense Oligonucleotides as Therapeutics for Inherited Metabolic Diseases

Suxiang Chen 1,2,#, Saumya Nishanga Heendeniya 1,2,#, Bao T Le 1,2,3, Kamal Rahimizadeh 1,2, Navid Rabiee 1,2, Qurat ul ain Zahra 1,2, Rakesh N Veedu 1,2,3,✉
PMCID: PMC10912209  PMID: 38252341

Abstract

The last decade (2013–2023) has seen unprecedented successes in the clinical translation of therapeutic antisense oligonucleotides (ASOs). Eight such molecules have been granted marketing approval by the United States Food and Drug Administration (US FDA) during the decade, after the first ASO drug, fomivirsen, was approved much earlier, in 1998. Splice-modulating ASOs have also been developed for the therapy of inborn errors of metabolism (IEMs), due to their ability to redirect aberrant splicing caused by mutations, thus recovering the expression of normal transcripts, and correcting the deficiency of functional proteins. The feasibility of treating IEM patients with splice-switching ASOs has been supported by FDA permission (2018) of the first “N-of-1” study of milasen, an investigational ASO drug for Batten disease. Although for IEM, owing to the rarity of individual disease and/or pathogenic mutation, only a low number of patients may be treated by ASOs that specifically suppress the aberrant splicing pattern of mutant precursor mRNA (pre-mRNA), splice-switching ASOs represent superior individualized molecular therapeutics for IEM. In this work, we first summarize the ASO technology with respect to its mechanisms of action, chemical modifications of nucleotides, and rational design of modified oligonucleotides; following that, we precisely provide a review of the current understanding of developing splice-modulating ASO-based therapeutics for IEM. In the concluding section, we suggest potential ways to improve and/or optimize the development of ASOs targeting IEM.

Key Points

Despite significant efforts to date, most inborn errors of metabolism still lack an effective therapeutic approach.
Splice-modulating antisense oligonucleotides (ASOs) have offered a promising strategy to develop precision treatments for inborn defects of metabolism, such as lysosomal storage diseases, organic acidemias, and congenital disorder of glycosylation.
Chemical modifications of ASOs can further improve their therapeutic properties such as efficacy, stability, and specificity. Phosphorodiamidate morpholino oligomer (PMO), 2′-O-methoxyethyl (2′-MOE), 2′-O-methyl (2′-OMe), locked nucleic acid (LNA), 2′-O,4′-C-ethylene-bridged nucleic acid (ENA), and phosphorothioate have been utilized in constructing ASOs targeting inborn errors of metabolism.

Introduction

Antisense oligonucleotides (ASOs) are synthetic single-stranded oligonucleotides that can bind to precursor mRNA (pre-mRNA) and/or mRNA through Watson-Crick base pairing [1]. Upon specifically binding to their target RNAs, ASOs can modulate the function of RNA, thereby regulating gene expression [2–5]. ASO-based therapeutics originate from Zamecnik and Stephenson’s seminal observations published in 1978, in which they discovered that a 13-deoxynucleotide ASO sequence complementary to the RNA of Rous sarcoma virus could inhibit viral RNA translation and virus production [6, 7]. One year later, a major post-RNA binding pathway, degradation of RNA by ribonuclease H (RNase H) was demonstrated [8], while modification of pre-mRNA splicing by steric blockage, another main mechanism of ASO action, was reported after 15 years, in 1993 [9]. Examples of more ASO mechanisms are provided in Sect. 2.1 of this article. Up to now, nine ASO drugs have been granted marketing approval by the United States Food and Drug Administration (US FDA) for treating several diseases, including cytomegalovirus retinitis (fomivirsen) [10–12], homozygous familial hypercholesterolemia (mipomersen) [13, 14], Duchenne muscular dystrophy (eteplirsen, golodirsen, viltolarsen, and casimersen) [15–27], spinal muscular atrophy (nusinersen) [28–30], hereditary transthyretin amyloidosis (inotersen) [31, 32], and amyotrophic lateral sclerosis (tofersen) [33] (Fig. 1). Although volanesorsen, developed for treating familial chylomicronemia syndrome, familial partial lipodystrophy, and hypertriglyceridemia, was rejected by the FDA because of safety concerns, as platelet declines were observed during clinical trials [34], the drug was approved by the European Medicines Agency (EMA) for market entry [35]. Individualized ASOs such as milasen, jacifusen, and atipeksen have been evaluated for treating Batten disease, amyotrophic lateral sclerosis, and ataxia-telangiectasia, respectively [36–38]. ASOs have also been developed as potential therapeutics for other human maladies [2, 5, 39–50], such as neurodegenerative diseases [51–53], cancers [54, 55], chronic kidney disease [56, 57], and a variety of other metabolic disorders [58–63].

Fig. 1.

Fig. 1

Historical developments of antisense oligonucleotide therapeutics. To date, ten ASO drugs have been approved by US FDA or EMA for market entry. EMA European Medicines Agency, FDA Food and Drug Administration

Metabolism covers a range of intricate biochemical processes that are structured into various pathways to sustain everyday physiological functions. Each metabolic pathway is dependent on the catalytic activity of certain enzymes to facilitate efficient functioning [64]. Inborn errors of metabolism (IEMs), often known as inherited metabolic diseases, have been known for more than a century after the first IEM was reported by Sir Archibald Garrod in 1902 [65]. IEMs are due to a deficiency or abnormality in a protein (enzyme, receptor, or transporter) caused by genetic defects, for example, point mutations, deletions, or insertions [66–70]. The defects in genes hamper the normal functioning of the metabolic pathways in which they are involved [64, 71], leading to varying consequences: excessive accumulation of a substrate (intermediary metabolite) that cannot be processed further (which may show toxicity directly, or indirectly through the diversion of the metabolic flux to an alternative pathway) and deficiency of a specific end product [64, 67, 71]. Both of these consequences result in significant mortality and morbidity [64, 70]. Nowadays, more than 1450 IEMs have been discovered [72]. Although each individual disorder is rare, the estimated overall prevalence of IEMs is one in 4000 newborns [73, 74]. In some regions, IEMs even represent somewhat common diseases [75]; for instance, they affect one in 784 individuals in the West Midlands of the United Kingdom (UK) [76]. Most IEMs are inherited as autosomal recessive diseases, although X-linked, autosomal dominant, and maternal inheritance (due to mutations in mitochondrial DNA) are also possible [70, 77, 78].

Significant efforts have been undertaken in managing IEMs to extend patients' life expectancy and improve their quality of life. Dietary manipulations and cofactor administrations are used for many IEMs affecting the metabolism of sugars, lipids, and amino acids [79]. This therapeutic strategy is aimed at reducing the intake of certain substrates or providing deficient products [79]. However, the specialized medical foods and supplements on which patients are relying are expensive [80], and might also affect their diet diversity and satisfaction. For lysosomal storage diseases (LSDs), a large class of IEM, enzyme replacement therapies based on intravenous or intrathecal administration of a deficient enzyme have been developed [81]. Although the clinical benefits of these therapies have been proven, there are limitations related to immune reactions and difficulties in the absorption of exogenous enzymes by refractory tissues [82]. In addition, transplantation of organs, tissues, or cells is also available for some IEMs. This approach enables the replacement of a whole organ or cells where a defective gene is expressed causing enzyme deficiency. Nevertheless, problems such as sequelae of immunosuppression, limited donor availability, high graft failure rates, and treatment-related morbidity and mortality continue to be an issue [67, 83].

Despite the abovementioned treatments, most IEMs still lack an effective therapeutic approach [60, 67]. Early diagnosis of IEMs resulting from expanded newborn screening has offered an opportunity for early therapy [84, 85], thereby increasing the urgent demand for developing more effective treatments [67]. To date, splice-modulating ASOs have been developed as, to some extent, an individualized molecular therapeutic option for IEM, due to both the ability of these ASOs to specifically suppress the aberrant splicing pattern of mutant pre-mRNA and the rarity of a certain disease and/or a certain pathogenic mutation in the disease. Very recently, Goga and Stoffel comprehensively reviewed the RNA-silencing oligonucleotides, including RNase H-dependent ASOs and small interfering RNAs (siRNAs), as therapeutic molecules for metabolic disorders [62]. Herein, we present a comprehensive analysis of advancements in the domain of splice-switching ASO-based therapeutics in inherited metabolic diseases, that is, the ASOs designed to target specific human pathogenic mutations in IEMs. Prior to this, we will comprehensively outline the ASO approach in terms of its mechanisms of action, chemical modifications, and rational design of modified ASO.

Antisense Oligonucleotide (ASO)-Based Therapeutics

Mechanisms of ASO Action

ASOs are short nucleic acid oligomers (18–30 nucleotides) usually employed to modulate gene expression through specific binding to the complementary region of their target RNA [86]. The specificity is ensured by Watson-Crick base pairing, and the entire ASO sequence is used to identify the target RNA, while, theoretically, merely 13–15 contiguous nucleotides are sufficient to achieve single-RNA specificity [41]. Several post-RNA-binding mechanisms of ASO action have been reported, and some are widely applied, and novel mechanisms are continuously being validated, enhancing the versatility of antisense technology [2]. ASO mechanisms have been categorized into two major types: RNA degradation mediated by RNase H and RNA modulation simply via steric hindrance [41, 86–89] (Fig. 2).

Fig. 2.

Fig. 2

Examples of mechanisms of ASO action in modulating gene expression. A Normal gene expression without interference from ASOs; B downregulation of gene expression by RNase H-dependent ASOs; C up- or downregulation of gene expression by steric-blocking ASOs targeting the 5'UTR region; D up- or downregulation of gene expression by steric-blocking ASOs targeting the 3'UTR region; E up- or downregulation of gene expression by splice-switching steric-blocking ASOs. ASO antisense oligonucleotide, ORF open reading frame, poly-A polyadenylic acid tail, pre-mRNA precursor mRNA, RNase H ribonuclease H, uORF upstream open reading frame, UTR untranslated region

In mammalian cells, the RNase H family of enzymes mediate the RNA cleavage in an RNA–DNA heteroduplex [90]. Human cells contain both RNase H1 and 2, the former being responsible for the cleavage of RNA [91]. At least five, ideally eight to ten, consecutive deoxynucleotide units in an ASO are needed for an RNA–ASO duplex to become a substrate of RNase H [2, 50, 91]. Upon formation of the hybrid, RNase H is recruited and cleaves the phosphodiester (PO) bonds of the RNA strand, releasing the intact ASO strand [39, 87]. The RNA fragments that have been cleaved are then subjected to degradation by the XRN family of 5’→3’ exoribonucleases and exosome complex, resulting in target RNA destruction and therefore downregulation of the target gene expression [92–94]. Since RNase H exists both in nucleus and cytoplasm, RNA cleavage by the enzyme is a robust pharmacological mechanism that enables the targeting of both nuclear pre-mRNA and cytoplasmic mRNA [92] (Fig. 2B). RNase H-dependent ASOs have been widely explored and developed as therapeutics for downregulating the expression of disease-causing genes. To date, four such oligonucleotides (fomivirsen, mipomersen, inotersen, and tofersen) have been FDA approved [10–13, 31–33, 95] (Fig. 1).

In contrast to the RNase H competent oligonucleotides, steric-blocking ASOs do not promote target RNA degradation [43, 50, 86]; instead, they function using different mechanisms that either downregulate or upregulate the expression of target genes [2], via masking specific sequences within a target transcript, thus interfering with interactions of the transcript with other biomolecules and/or complexes [86]. Selected examples of the steric hindrance mechanisms are shown in Fig. 2. Firstly, ASOs binding to the cap site within the 5′-untranslated region (5'UTR) of the target mRNA can repress protein synthesis by interfering with the formation of the translation initiation complex [96, 97], while ASOs targeted to the start codon of the upstream open reading frame (uORF) in the 5'UTR redirect the translational machinery to the primary open reading frame (pORF), thereby increasing protein expression, as a result of uORF blockage [98, 99] (Fig. 2C). Secondly, ASOs can alter the stability of mRNA by modulating the selection of polyadenylation sites in the 3′UTR [100]. To be more specific, ASOs targeted to the pre-mRNA 3′-most polyadenylation site can redirect polyadenylation to upstream cryptic sites, leading to the production of shorter but more stable mRNA variants, as they contain fewer destabilizing elements, thus upregulating gene expression. Conversely, ASOs that hybridize to the upstream polyadenylation sites enhance the selection of the 3′-most site, resulting in an increased level of longer (having more destabilization sequences) but less stable transcripts, thereby downregulating expression [100] (Fig. 2D). Finally, and most importantly, in addition to affecting alternative polyadenylation, steric-blocking ASOs are capable of triggering alternative splicing [9, 101–104]. ASOs that are designed to be complementary to specific pre-mRNA sites including 5′ or 3′ splice junctions, or exonic splicing enhancers (ESEs) or silencers (ESSs) can block the access of spliceosome or splice factors to those sequences, thereby altering the splicing decisions, leading to exclusion (skipping) or inclusion of an exon in mature mRNA [105]. Splice switching by ASOs can be used to either rescue or disrupt gene expression. Taking exon skipping as an example, an exon containing mutation-induced premature termination codon (PTC) can be excluded by ASO treatment, thereby correcting the open reading frame (ORF) and restoring production of therapeutic protein (internally truncated but partly functional protein isoforms) [106]. On the other hand, skipping of a normal exon by ASO may result in reading frame shift and induce PTC(s) in its adjacent exon, causing ORF corruption and nonsense-mediated mRNA decay (NMD) activation [88], eventually silencing protein translation (Fig. 2E). In summary, steric-blocking ASOs are very flexible approaches and are increasingly used for therapeutic purposes. To date, five splice-switching ASOs (eteplirsen, nusinersen, golodirsen, casimersen, and viltolarsen) have been approved by the FDA for market entry [15, 17, 19, 22, 25, 28, 29].

In addition, siRNAs are usually included as antisense molecules in the literature, since their antisense (or guide) strand functions as ASO binding to target mRNA. siRNAs and ASOs share common properties regarding chemical modifications as well as delivery issues [107–111]. To date, five siRNAs (patisiran, givosiran, lumasiran, inclisiran, and vutrisiran) have been approved by the FDA for clinical use.

Chemical Modifications of ASO

DNA-based ASOs composed of natural (unmodified) deoxyribonucleotide monomers were used in the earliest studies in this field [6, 7, 112]. However, DNA exhibits a lower binding affinity for a complementary RNA target than RNA does for itself [39]. Furthermore, both unmodified single-strand DNA and RNA-based oligonucleotides have unfavorable properties that make them unacceptable systemic therapeutics [50]. The primary drawbacks include:

  1. Insufficiency in intrinsic affinity for complementary RNA: Unmodified ASOs may not be able to disturb the secondary structure of intracellular RNA targets [39] or to compete with RNA binding proteins, leading to off-target effects and poor target specificity [48].

  2. Susceptibility to attack by endonucleases and exonucleases: Unmodified ASOs lack stability in biological systems in which their PO linkages are cleaved by nucleases [39, 47, 113], leading to their degradation before having a chance to reach target RNAs [39].

  3. Poor protein binding capability: Unmodified ASOs are weakly bound to proteins in plasma and thereby filtered rapidly by the kidneys and excreted in the urine [39, 114], leading to inefficient tissue uptake of the ASOs [49].

  4. Poor cellular uptake: Due to their large size and charge, unmodified ASOs are not able to permeate plasma membranes through passive diffusion [47, 50, 115].

To overcome these problems, ASOs must be chemically modified. In fact, natural ASOs are amenable to extensive modification, and advances in ASO-based therapy have been heavily dependent on the evolution of medicinal chemistry [39, 41, 116]. To date, a large panel of modified nucleotides (analogs) have been synthesized [117]. Most of them have been explored to achieve desired pharmacokinetic and pharmacodynamic profiles, improved endocytic uptake (controlled by cell surface proteins), and reduced pro-inflammatory effects and off-target toxicity [43, 45, 114, 117–121]. Improvement of pharmacokinetics is achieved by enhancing the nuclease resistance and protein binding ability of ASOs, thus extending their half-lives and facilitating their distribution to tissues [39]. Pharmacodynamic characteristics are optimized by increasing the binding affinity of ASOs to their complementary sequences in RNA, which can be measured by the melting temperature (Tm). Based on the structure of the nucleotide, its components (phosphate group, pentose sugar, and nitrogenous base) can be modified either individually or in a combined manner.

Phosphate Linkage Modifications

Obviously, the phosphate group is the first target for chemical modification, owing to the inherent nuclease instability of the PO linkage [39]. Modifications to this region predominantly assist in reducing an ASO’s nuclease susceptibility [49]. Some examples, such as phosphorothioate (PS) [122], phosphorodithioate (PS2) [123], N3′→P5′ phosphoramidate (NP) [124], methylphosphonate (MP) [125], boranophosphate (PB) [126], phosphonoacetate (PACE) [127], and mesyl phosphoramidate (MsPA) [128] are shown in Fig. 3.

Fig. 3.

Fig. 3

Examples of chemically modified nucleotide analogs. 2'-F 2'-fluoro, 2'-MOE 2'-O-methoxyethyl, 2'-OMe 2'-O-methyl, 7',5'-α-bc-DNA 7',5'-alpha-bicyclo-DNA, ANA altritol nucleic acid, bc-DNA bicyclo-DNA, CeNA cyclohexenyl nucleic acid, cEt 2',4'-constrained 2'-O-ethyl, cMOE 2',4'-constrained 2'-O-methoxyethyl, ENA 2'-O,4'-C-ethylene-bridged nucleic acid, FANA 2'-deoxy-2'-fluoro-arabinonucleic acid, HNA anhydrohexitol nucleic acid, LNA locked nucleic acid, MNA morpholino nucleic acid, MP methylphosphonate, MsPA mesyl phosphoramidate, NP N3′→P5′ phosphoramidate, PACE phosphonoacetate, PB boranophosphate, PMO phosphorodiamidate morpholino oligomer, PNA peptide nucleic acid, PS phosphorothioate, PS2 phosphorodithioate, tc-DNA tricyclo-DNA, TMO thiophosphoramidate morpholino oligomer, TNA threose nucleic acid

Among these analogs, PS stands out as the most effective, extensively utilized, and earliest single modification for ASO development [47, 116, 122], being present in six (fomivirsen, mipomersen, nusinersen, inotersen, tofersen, and milasen) out of the ten FDA-permitted ASO drugs (Fig. 4). PS-modified ASOs differ from their natural counterparts in that a non-bridging oxygen atom inside the phosphate group is substituted with a sulfur atom [122, 129], which alters the physicochemical properties of the phosphate group [40]. Firstly, the sulfur substitution confers ASOs sufficient metabolic stability in cells and tissues, avoiding rapid digestion by a broad spectrum of nucleases [50, 122, 129, 130]. Secondly, since the sulfur atom is twice the size of the oxygen atom, the negative charge within PS is broadly distributed compared to that in PO, which increases the lipophilicity of the modified phosphate group, thus promoting its protein binding ability [131–133]. More specifically, enhanced binding to plasma proteins, e.g., albumin preserves ASOs in circulation, retards renal excretion, improves bioavailability, and finally facilitates their uptake by organs and tissues [50, 86, 134]. In addition, increased binding to cell-surface proteins (for example, scavenger receptors) facilitates internalization of ASOs into cells, and interactions of ASOs with intracellular proteins such as nucleolin may promote their accumulation in the nucleus, which is beneficial for the action of splice-modulating ASOs, since their targets, the pre-mRNAs, are located in the nucleus [135–143]. In an ASO sequence, at least ten PS linkages are required to support efficient protein binding [40]. Synthesis of P-stereo-defined PS oligonucleotides was developed by Professor Takeshi Wada and his team [144–146], allowing production of diastereopure PS-modified ASOs for research and therapeutic applications.

Fig. 4.

Fig. 4

Rational design of chemically modified ASOs. Among the FDA-permitted ASO drugs, fomivirsen is the only uniformly PS-modified DNA molecule, nusinersen and milasen are uniformly 2′-MOE-PS ASOs, eteplirsen, golodirsen, viltolarsen, and casimersen are PMOs, mipomersen and inotersen are 5-10-5 2′-MOE-PS gapmers, and tofersen is a 5-10-5 2′-MOE gapmer with mixed PO/PS phosphate linkages. Methylated uracil is identical to thymine. 2'-MOE 2′-O-methoxyethyl, 2'-OMe 2′-O-methyl, ASO antisense oligonucleotide, FDA Food and Drug Administration, LNA locked nucleic acid, PMO phosphorodiamidate morpholino oligomer, PO phosphodiester, PS phosphorothioate

As a result of both the improved nuclease resistance and protein binding ability, PS modification extends the half-life from minutes (natural ASO) to days (PS-modified ASO) [47, 50, 147]. However, the PS moiety also has two disadvantages: reduction in binding affinity of ASO to its target (~ 0.2–0.5 °C per modification) [121] and pro-inflammatory toxicity resulting from nonspecific protein binding [122]. These shortcomings can be compensated for or counteracted by additional modifications on the pentose sugar moiety [2, 86]. This is supported by the fact that only fomivirsen (the earliest ASO drug) is modified by PS alone, whereas all the later approved molecules (mipomersen, nusinersen, inotersen, tofersen, and milasen) contain both PS and ribose modifications. Alternatively, researchers have been developing novel modifications to the phosphate group that are more specific and/or less toxic. For instance, the PS2 substitution increases the binding affinity of ASO to its target for 1000-fold [148], and the MsPA modification shows better target binding affinity and nuclease stability than PS [128].

Sugar Moiety Modifications

The sugar moiety of nucleotides is the hotspot of chemical modification. A large number of nucleotide analogs with changed sugar moiety have been used for constructing ASOs, such as 2′-O-methyl (2′-OMe) [149], 2′-O-methoxyethyl (2′-MOE) [100], 2′-fluoro (2′-F) [150, 151], 2′-deoxy-2′-fluoro-arabinonucleic acid (FANA) [152], locked nucleic acid (LNA) [153, 154], 2′-O,4′-C-ethylene-bridged nucleic acid (ENA) [155], 2′,4′-constrained 2′-O-ethyl (cEt) [156], 2′,4′-constrained 2′-O-methoxyethyl (cMOE) [156], threose nucleic acid (TNA) [157], anhydrohexitol nucleic acid (HNA) [158], altritol nucleic acid (ANA) [158], cyclohexenyl nucleic acid (CeNA) [158], tricyclo-DNA (tc-DNA) [159], bicyclo-DNA (bc-DNA) [160], and 7′,5′-alpha-bicyclo-DNA (7′,5′-α-bc-DNA) [161] (Fig. 3).

Among these modifications, replacement of the hydrogen atom or hydroxyl group on the 2′-position of the deoxyribose/ribose moiety by other groups, most commonly 2′-OMe and 2′-MOE, provides the most value in improving an ASO’s drug-like properties. Both modifications increase the nuclease resistance of ASOs by replacing the nucleophilic 2′-hydroxyl moiety [86, 116], as well as via the proximity of the 2′-substituent to the 3′-phosphate moiety [39], leading to prolonged tissue half-life and drug effects. Furthermore, 2′-OMe and 2′-MOE increase the binding affinity of ASOs to their RNA targets (ΔTm ∼ 2 °C per modification, relative to DNA) by promoting an RNA-like northern conformation (A-form 3′-endo sugar pucker) [162–164]. In addition, 2′-OMe and 2′-MOE can abrogate the immune reactions induced by oligonucleotides, reduce nonspecific protein binding, and are thus less toxic than PS modification [47, 86]. 2′-MOE is even considerably less toxic than 2′-OMe [49]. Additional modifications (such as 2′-OMe and 2′-MOE) to the sugar moiety not only increase the affinity of ASOs with PS backbone modification to target RNAs, but also decrease the toxicity induced by the PS linkages [45]. 2′-MOE is currently the most advanced and the only 2′-substituent that has been employed in the ASO drugs clinically approved by the FDA (mipomersen, nusinersen, inotersen, tofersen, and milasen).

The electronegative 2′-subsititute 2′-F also increases the thermal stability of ASO–RNA heteroduplex by ∼ 2 °C per modification [121]. However, this analog imparts enhanced binding affinity to drosophila behavior/human splicing (DBHS) proteins, leading to hepatotoxicity [165]. Therefore, 2′-F is not as competitive as 2′-MOE in ASO construction.

Bridged nucleic acids (BNAs) are a class of nucleotide analogs in which the 2′-oxygen atom of the furanose sugar is linked to the 4′-carbon via a bridge, which effectively locks the pucker of the parent sugar into the RNA-like 3′-endo conformation, constraining the flexibility of the sugar and preventing the DNA-like conformation [48, 50, 166–169]. Owing to the 2′,4′-constraint, BNAs are especially useful for increasing the strength of hybridization with complementary RNA sequences [170]. Compared to unmodified deoxynucleotide, the presence of a single BNA substitution can increase the Tm by ∼ 5–11 °C [48, 170]. ASOs with BNA modifications are more potent than the 2′-MOE analogs [171–173]. The most used BNAs are LNA and, to a lesser degree, ENA. LNA is characterized by a 2′,4′-methylene bridge and is also considered as a constrained analog of 2′-OMe [168, 169]. ENA contains a constrained ethylene bridge and exhibits better nuclease resistance than LNA [155]. Despite their superior thermal stability, LNA-modified ASOs are associated with hepatotoxicity [173, 174], which can be dependent on either the ASO sequence or its chemistry. It has been demonstrated that such liver toxicity can be reduced by avoidance of choosing “toxic” sequences based on bioinformatic prediction [48, 175]. Alternatively, more advanced BNA analogs such as cEt and cMOE have been developed, which are less toxic and more nuclease resistant than LNA [49, 171].

DNA analogs such as tc-DNA and bc-DNA have also been devised and investigated. ASOs composed of tc-DNA monomers are distinguished from other modified oligonucleotides by their capacity to cross the blood–brain barrier and reach the central nervous system [176].

Sugar-Phosphate Backbone Modifications

Finally, although the majority of nucleotide analogs are derived from DNA or RNA monomer, more heterogeneous chemistries involving modification on both the phosphate and sugar moiety have been developed [47, 86]. Such analogs show little resemblance to the natural archetypes [45]. The most common representatives are phosphorodiamidate morpholino oligomers (PMOs) [177] and peptide nucleic acid (PNA) (Fig. 3) [178]. In PMOs, the five-membered furanose ring is replaced by a six-membered morpholine heterocycle, and each morpholino subunit is connected by a phosphorodiamidate linkage instead of a PO bond [179, 180]. PNA is a more radically different type of nucleotide mimic, in which the whole sugar-phosphate backbone is substituted by a pseudo peptide polymer backbone. In other words, a PNA ASO is a chain of N-(2-aminoethyl) glycine subunits, to which the nucleobases are connected via methyl carbonyl linker [181]. While PMOs and PNA are substantially different from natural nucleic acids, they maintain and even enhance binding ability to complementary RNA in a Watson-Crick manner, compared to unmodified ASOs [45, 182, 183]. Moreover, due to their unnatural backbone, PMOs and PNA are almost fully resistant to nucleases and proteases, conferring them tremendous stability in biological systems [2, 175, 184]. Both modifications are neutral. The fact that four PMO-based ASO therapeutics (eteplirsen, casimersen, viltolarsen, and golodirsen) were approved by the FDA during 2016–2021 is testimony to their excellent drug-like properties [87]. Nevertheless, a disadvantage of PMOs and PNA is that they bind to plasma proteins with minimal affinity, meaning that they are rapidly eliminated by urinary excretion [86]. As a result, high doses or frequent administration are needed for in vivo activity, which may increase the risk of side effects [48].

Other Modifications

Modifications on the nucleobase moiety are not as common as those on the sugar and/or phosphate moiety. The main objective of base modification is to enhance binding affinity of ASOs to their complementary RNA targets [185, 186]. For instance, substitution of the 5′-hydrogen atom on cytosine with a methyl group can increase the Tm by ∼ 0.5 °C per modification [121]. 5′-Methylcytidine is present in several FDA-permitted ASOs, including mipomersen, inotersen, tofersen, nusinersen, and milasen. Interesting double-headed nucleotides (nucleotides containing two nucleobases) have been reviewed elsewhere [187].

In addition to changing the structure of one or more moieties (sugar, phosphate, base) in a nucleotide, which creates nucleotide analogs, modifications can also be made through conjugation of ASOs to different biomolecules, such as cholesterol [188], peptides [189], antibodies [190], aptamers [191], and N-acetylgalactosamine (GalNAc) [192], thus directing the ASO drugs to target tissues and improving cellular uptake. In vivo delivery and cellular uptake of therapeutic ASOs have been discussed comprehensively in useful recent or classical reviews [55, 86, 87, 114, 116, 193–202].

ASO Rational Design

As discussed in the previous section, a number of analogs (chemically modified nucleotides) have been synthesized and evaluated (Fig. 3); however, with the exceptions of only a few phosphate modifications (PS, PS2, PB, PACE, and MsPA), heteroduplexes formed between uniformly modified ASOs and their target RNA sequences are poor substrates for RNase H [50]. Therefore, uniformly modified oligomers usually do not induce the degradation of their target RNAs except, for example, the fully DNA-PS ASO fomivirsen. In order to retain the RNase H activity, “gapmer” design was devised by Inoue et al. in 1987 [203]. Since RNase H only recognizes DNA–RNA duplexes with the DNA strand containing at least five continuous deoxynucleotides [48], in a gapmer-like ASO, a stretch of unmodified DNA or DNA-PS central “gap” (at least 5mer) is flanked by two “wings,” which can be composed of non-RNase H-sensitive analogs (e.g., 2′-OMe, 2′-MOE, PNA, or LNA) [47, 204, 205] (Fig. 4). The “gap” induces RNase H-mediated cleavage of the complementary RNA target, while the “wings” enhance the ASO’s nuclease stability and target binding affinity [39]. To date, mipomersen, inotersen, and tofersen are the three gapmer-like ASO drugs that have been approved by the FDA for clinical use (Fig. 4).

Although uniformly modified ASOs do not support an RNase H-based mechanism, they have been primarily used as steric blockers, and, in fact, considerably more flexibility is afforded for their action, due to the avoidance of RNase H-mediated cleavage (Fig. 2) [39, 50]. Furthermore, it is obvious that the absence of an unmodified gap region in these ASOs maximizes their thermal stability (i.e., target binding affinity) and nuclease resistance, as they are fully modified. The most employed non-terminating mechanism is splice modulation. To date, six ASO drugs that are uniformly modified (PMO: eteplirsen, golodirsen, viltolarsen, and casimersen; 2′-MOE-PS: nusinersen and milasen) have been permitted by FDA for use in patients (Fig. 4).

In fact, the drug-like properties of uniformly modified ASOs can be further improved by “mixmer” design (Fig. 4), that is, two or more modifications exist in one ASO sequence. Screening of different mixmer-like ASOs (different positioning of modifications in a given sequence) can lead to the identification of the best-performing design. Herein, we suggest three strategies to take advantage of “mixmer” design:

  1. First of all, nucleotide analogs that are selected for constructing mixmer-like ASO need to be compatible with each other. Since PMO chemistry is not compatible with other modifications, morpholino nucleic acid (MNA) and thiophosphoramidate morpholino oligomer (TMO), which retain the featured morpholine ring of a PMO unit, have been envisaged to replace PMO. MNA/2′-OMe-PS, TMO/2′-OMe-PS, and TMO/DNA/2′-OMe-PS mixmers have been synthesized and investigated for their capability in inducing splice modulation (exon skipping) [206, 207].

  2. Introduction of LNA modifications into a uniformly modified 2′-OMe-PS ASO, generating different patterns of LNA/2′-OMe-PS mixmers, could enhance the exon skipping efficiency of the ASO sequence, thus allowing synthesis of shorter ASO sequences to reduce cost without compromising efficacy [208].

  3. As 2′-MOE is sufficiently resistant to nucleases, in a fully 2′-MOE modified ASO sequence, the internucleotide linkages do not have to be uniformly PS modified. Instead, PO/PS mixmers can be designed and screened to fine tune the pharmacokinetics of the ASO sequence [209]. For example, tofersen has mixed phosphate linkage modification (PO/PS) (Fig. 4).

Splice-Modulating ASOs Targeting Inborn Errors of Metabolism

In most cases, uniformly modified splice-modulating ASOs are devised to correct the aberrant splicing of mutant genes responsible for IEMs. In this section, we introduce the current developments of splice-switching ASOs towards targeting IEMs, including Batten disease, Pompe disease, Fabry disease (FD), Niemann-Pick type C disease (NPCD), inclusion-cell disease, Hunter syndrome (HS), organic acidemias (OAs), congenital disorder of glycosylation (CDG), hereditary myopathy with lactic acidosis (HML), 6-pyruvovl-tetrahydropterin synthase (PTPS) deficiency, erythropoietic protoporphyria (EPP), complementation group cobalamin E (cblE) type of homocystinuria, and aromatic l-amino acid decarboxylase deficiency (AADCD). The feasibility of these ASOs in treating IEMs with specific mutation has been tested in patient cells or commercialized human cell lines. Further, the basic information of these works in combination with additional rodent-based research and RNase H-dependent ASO-related studies are summarized in Table 1 for the readers’ reference.

Table 1.

Developments of therapeutic ASOs for IEMs

Disease (phenotype MIM number) Molecular target Drug/lead candidate(s) name ASO mechanism ASO design Development stage References
Familial hypercholanemia (607748, 143890) APOB Mipomersen (Kynamro®) mRNA degradation by RNase H 20mer 5-10-5 gapmer (DNA-PS gap and 2′-MOE-PS flanks) FDA approved for marketing [13, 95]
Phase III clinical [245–248]
Phase II clinical [249, 250]
Phase I clinical [251, 252]
Preclinical [252]
LSDs Batten disease (also known as NCL) NCL7 (CLN7 Batten disease; 610951) MFSD8 (also known as CLN7) Milasen (TY777) ORF restoration by splice modulation (prevention of pseudoexon inclusion) 22mer 2′-MOE-PS FDA permitted for clinical investigational treatment [36]
CLN3 Batten disease (204200) CLN3 ASO-20 and ASO-28 ORF restoration by splice modulation (induction of exon skipping) 18mer 2′-MOE-PS Preclinical [212]
GSD type 1a (232200) G6PC DS-4108b ORF restoration by splice modulation 15mer mixmer (2′-OMe-PS and ENA-PS) Preclinical [253]
Pompe disease (also known as GSD type II; 232300) Gys1 (mouse) PMO sequence (number 10) NMD by splice modulation (induction of exon skipping) 25mer PMO Preclinical [254]
GAA AON intron 15, AON intron 10, and AON exon 8 Splice modulation (prevention of pseudoexon inclusion, partial intron retention, exon skipping, and/or partial exon skipping) 25mer PMO, 21mer PMO, and 24mer PMO Preclinical [255]
AON 3 and AON 4 Splice modulation (prevention of pseudoexon inclusion, exon skipping, and partial exon skipping) 21mer PMO and 25mer PMO Preclinical [215, 216]
AMO 1, AMO 2, and AMO 3 Splice modulation (prevention of exon skipping) 25mer PMOs Preclinical [214]
PMO 15 Splice modulation (prevention of exon skipping) 20mer PMO Preclinical [217]
Fabry disease (also known as α-galactosidase A deficiency; 301500) GLA 3'ss-SSO ORF restoration by splice modulation (prevention of pseudoexon inclusion) 24mer 2′-OMe-PS Preclinical [219]
NPCD (257220) NPC1 AMO 111 ORF restoration by splice modulation (prevention of pseudoexon inclusion) PMO (sequence was not disclosed) Preclinical [256]
Inclusion-cell disease (also known as mucolipidosis type II α/β; 252500) GNPTAB H19A(+119+138) ORF restoration by splice modulation (induction of exon skipping) 20mer 2′-OMe-PS Preclinical [221]
HS (also known as MPS type II; 309900) IDS All AOs (AMO1, AMO 2, AMO 3, and LNA) failed to correct aberrant splicing Failure to prevent partial exon skipping 25mer PMOs and 20mer LNA Preclinical [223, 224]
OAs Propionic acidemia (606054) PCCA N/A Splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [226]
ASO-29 ORF restoration by splice modulation (prevention of pseudoexon inclusion) 18mer 2′-MOE-PS Preclinical [228]
PCCB N/A Splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [226]
Methylmalonic aciduria (251000) MUT N/A Splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [226]
AMO-B Splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [227]
CDG CDG-Ia (PMM2-CDG; 212065) PMM2 AMOA and AMOB Splice modulation (prevention of pseudoexon inclusion) 25mer PMOs Preclinical [231]
CDG-IIk (TMEM165-CDG; 614727) TMEM165 N/A Splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [232]
HML (255125) ISCU N/A ORF restoration by splice modulation (prevention of pseudoexon inclusion) 25mer PMO Preclinical [234]
AO-A ORF restoration by splice modulation (prevention of pseudoexon inclusion) 22mer 2′-OMe-PS Preclinical [233]
Ionis Pharmaceuticals Inc. oligonucleotide 676672 ORF restoration by splice modulation (prevention of pseudoexon inclusion) 18mer mixmer (2′-MOE-PS and cEt-PS) Preclinical [235]
PTPS deficiency: hyperphenylalaninemia (261640) PTS PTS-AMO1, PTS-AMO2, and PTS-AMO3 Splice modulation (prevention of pseudoexon inclusion) 25mer PMOs Preclinical [237]
SSO 1, SSO 5, and SSO 6 Splice modulation (prevention of pseudoexon inclusion) 25mer 2′-OMe-PS Preclinical [238]
EPP (177000) FECH V1-LNA-ASO ORF restoration by splice modulation (prevention of partial intron retention) 19mer mixmer (DNA-PS and LNA-PS) Preclinical [240]
Phenylketonuria (261600) Slc6a19 (mouse) 19e6-ei Splice inhibition 25mer PMO Preclinical [257]
cblE type of homocystinuria (236270) MTRR MTRR ESE-SSO Splice modulation (prevention of pseudoexon inclusion) 24mer 2′-OMe-PS Preclinical [242]
Canavan disease (271900) Nat8l (mouse) Nat8l gapmer mRNA degradation by RNase H 16mer LNA-PS gapmer Preclinical [258]
AADCD (608643) DDC ASO-D ORF restoration by splice modulation (prevention of partial intron retention) 25mer PMO Preclinical [244]

2'-MOE 2′-O-methoxyethyl, 2'-OMe 2′-O-methyl, AADCD aromatic l-amino acid decarboxylase deficiency, ASO antisense oligonucleotide, cblE complementation group cobalamin E, CDG congenital disorder of glycosylation, cEt 2′,4′-constrained ethyl, ENA 2′-O,4′-C-ethylene-bridged nucleic acid, EPP erythropoietic protoporphyria, FDA Food and Drug Administration, GSD glycogen storage disease, HML hereditary myopathy with lactic acidosis, HS Hunter syndrome, IEM inborn error of metabolism, LNA locked nucleic acid, LSD lysosomal storage disease, MIM mendelian inheritance in man, MPS mucopolysaccharidosis, N/A not available, NCL neuronal ceroid lipofuscinosis, NMD nonsense-mediated mRNA decay, NPCD Niemann-Pick type C disease, OA organic acidemia, ORF open reading frame, PMO phosphorodiamidate morpholino oligomer, PS phosphorothioate, PTPS 6-pyruvovl-tetrahydropterin synthase, RNase H ribonuclease H

Lysosomal Storage Diseases

Batten Disease

Batten disease is an inherited autosomal recessive neurodegenerative condition, also known as neuronal ceroid lipofuscinoses (NCLs), that clinically manifests as an LSD causing neuronal loss and lipo-pigment accumulation. The disease carries a prevalence of one to eight of 1 million live births worldwide [210]. Batten disease consists of 14 subtypes. The universal characteristic of Batten disease is a distinct mutation in ceroid lipofuscinosis neuronal (CLN) gene [211].

CLN3 is one of the subtypes of Batten disease that has a prevalence of one in 25,000 births in the USA, with a carrier frequency of one in 70. The most common mutation of CLN3 Batten disease is deletion of exon 7 and 8 (CLN3Δex7/8). As a result, a shift in the reading frame causes a premature termination of CLN3 transcript, creating a truncated protein lacking 257 amino acids including the lysosomal targeting sequence (LTS). Apart from CLN3Δex7/8, other mutations that can eliminate LTS are frame-shifting deletions and nonsense mutations [212]. According to Tang et al. [213], this is manifested as changes in lysosomal size, autophagic flux, and lysosomal dysfunction. A couple of the currently preclinical candidates are ASO-20 and ASO-28, which are highly active. ASO-20 and ASO-28 target the middle of exon 5 at the 5′ splice site (ss) of the pre-mRNA and induce exon 5 skipping, creating an mRNA isoform [212].

SINE-VNTR-Alu (SVA) insertion in the MFSD8 gene (also referred to as CLN7) has been identified to introduce a cryptic spice-acceptor site (i6.SA) in MSD8 intron 6, located 119 bp upstream to the SVA site. This results in a premature translational termination, clinically manifesting as Batten disease. ASO TY777 (milasen) is a 22mer oligonucleotide with PS and 2′-MOE modifications. Milasen blocks the i6.SA cryptic splice-acceptor site and the adjoining splice enhancer, restoring MFSD8 expression. RNA sequencing (RNA-seq) data have displayed a 34% increase in normal exon 6 splicing in patient fibroblast transfected with milasen. Clinical data have displayed that the patients treated with milasen had favorable medical outcomes where the patient’s seizure count decreased by 63% and seizure duration decreased by 52% [36].

Glycogen Storage Disease Type II (Pompe Disease)

Glycogen storage disease type II (GSDII) also known as Pompe disease is an autosomal recessive LSD caused by suboptimal activity of acid alpha-glucosidase (GAA). GAA consists of 952 amino acids and plays a catabolic role in degrading glycogen within lysosomes. The GAA gene contains 20 exons located in human chromosome 17q25.2-25.3. When mutations compromise the integrity of the GAA gene, the GAA protein loses its ability to degrade glycogen in lysosomes. This leads to the accumulation of glycogen in lysosomes. Lysosomal accumulation of glycogen results in lysosomal swelling, dysfunction, and defective autophagy. Scientists have discovered 497 mutations associated with the GAA gene; these include missense, nonsense, splice-site mutation, intragenic deletions, and insertions. Based on the clinical manifestation, GSDII is categorized into two forms, a rapidly progressing infantile-onset (IO) form and a slow progressing late-onset (LO) form [214].

The most common mutation among LO patients is c.-32-13T>G in intron 1 of the GAA gene, and genetic screening has shown that 40–70% of LO GSDII patients possess this mutation. This mutation in the intron region restricts spliceosomes from identifying exon 2 of GAA, thus inhibiting the splicing. Goina et al. [214] have developed 25mer PMOs (AMO 1, 2, and 3) for splice correction to treat LO GSDII patients. Compared to wild type, only 20% of enzyme activity was retained by myotubes of patients. Yet, 3 days after patient fibroblasts were treated with a combination of the AMOs, a 70% increase in GAA activity as well as a significant reduction in accumulation of glycogen has been observed [214].

PMOs also have been identified to target the putative polypyrimidine tract of a cryptic splice acceptor site created by c.-32-13T>G mutation as part of the pseudoexon created in GAA intron 1, blocking the cryptic splice donor, which leads to the inclusion of exon 2. Van der Wal et al. (2017) have identified AON 3 and 4 restoring exon 2 by inhibiting the usage of natural pseudoexon rather than silencing a putative intronic splice silencer [215]. Simultaneous targeting of cryptic splice acceptor and donor sites of pseudoexon has been investigated. This has displayed a 3.2-fold increase in exon 2 inclusion and sixfold reduction of natural pseudoexon inclusion [216]. Furthermore, PMOs have also been developed to improve exon 2 inclusion in patients with c.-32-13T>G. Aung-Htut et al. [217] evaluated 20 PMO candidates. The best-performing candidate (PMO 15) has displayed the most promising results, with a 1.6-fold increase in GAA activity when a 50-µM concentration of this ASO was transfected using RNAiMAX.

Fabry Disease

FD is a recessive X-linked glycosphingolipid metabolism disorder that is caused by a mutation in the lysosomal α-galactosidase A (GLA) gene leading to full or partial reduction of GLA enzyme. Due to the impaired functionality of GLA enzyme, progressive accumulation of globotriaosylceramide and other related glycosphingolipids takes place within lysosomes, leading to lysosomal dysfunction. As lysosomes are universal subcellular components, dysfunction of lysosome causes a progressive clinical manifestation of FD. FD is a multi-system disorder with characteristic clinical presentation of small vessel injury, potassium calcium channel dysfunction in endothelial cells, corneal changes, impaired autophagosome maturation, and irreversible fibrosis of cardiac and renal tissue. The prevalence of FD in the general population is estimated to range from one in 476,000 to one in 117,000, yet global epidemiological studies need to be conducted for accurate estimation [218].

There have been more than 600 pathogenic mutations identified as responsible for FD. The most prevalent mutation with a relatively higher newborn incidence rate is c.639 + 919G>A, which leads to an insertion of a 57-bp pseudoexon sequence at intron 4. The pseudoexon inclusion takes place as the mutation blocks the binding motif of the ESS at + 17 to + 22 bp and disrupts the recruitment of heterogeneous nuclear ribonucleoprotein (hnRNP) A1 and hnRNP A2/B1. The pseudoexon present in the mutated transcript creates an in-frame PTC at 27 bp in the exon, leading the misspliced mRNA to be targeted by NMD. Since the 5′ and 3′ canonical splice sites are still intact, splice-switching ASOs are used to block the pseudo-5′ and 3′ canonical splice sites. Preclinical studies have displayed multiple suitable ASO candidates to reduce pseudoexon inclusion. Among those candidates, 2′-OMe-PS 3′ss-SSO has displayed promising outcomes, becoming the leading candidate. Both 3′-targeting and 5′-targeting ASOs were investigated, and 2′-OMe-PS 3′ss-SSO has consistently been the best candidate, showing a 40–73% reduction in pseudoexon inclusion [219].

Niemann-Pick Type C Disease

NPCD is an autosomal recessive neurovisceral atypical lysosomal lipid storage disease that is caused by a mutation in either the NPC1 or NPC2 gene. NPC1 is a large protein with 1252 amino acids, while NPC2 is a smaller protein with 132 amino acids. These proteins play a key role in lipid transport in the human body, specifically egestion of cholesterol from lysosome. Mutations of NPC1 or NPC2 will disrupt the intracellular transport of lipids, resulting in the accumulation of cholesterol and lipids in tissues such as brain, liver, and spleen. The estimated minimal incidence rate of NPCD is one in 120,000 live births [218].

Multiple mutations, such as missense, splicing, and point mutations, could affect the function of the NPC protein. c.1554-1009G>A is a mutation affecting the NPC1 gene at intron 9 that creates a cryptic donor splice site by adding a 194-bp intronic sequence to mature mRNA. This results in the incorporation of a pseudoexon in mRNA, leading to a PTC being included, thus leading mRNA transcript to be degraded by NMD. PMO has been used to prevent mRNA from being degraded by NMD by correcting aberrant splicing. AMO 111 is considered the leading candidate since it has been proven to restore normal splicing in preclinical studies [217].

Inclusion-Cell Disease (Mucolipidosis Type II α/β)

Mucolipidosis type II α/β (MLII) is an autosomal recessive condition caused by a deficiency of uridine diphosphate (UDP)-N-acetylglucosamine-1-phosphotransferase (GlcNAc-1-phosphotransferase). GlcNAc-1-phosphotransferase is responsible for producing a specific targeting signal for transporting multiple lysosomal hydrolases to lysosomes. Mutation of the GNPTAB and GNPTG genes will produce a truncated version of the protein GlcNAc-phosphotransferase. This results in abnormal glycosylation of hydrolytic enzymes, which in turn compromises the trafficking of those enzymes, leading to accumulation and secretion of those enzymes into extracellular components. These cellular pathologies clinically manifest as severe cardiac complications, respiratory complications, severe skeletal dysplasia, craniofacial abnormalities, and muscular skeletal abnormalities. The prevalence of MLII is one in 100,000–400,000 [220].

GlcNAc-1-phosphotransferase is composed of three subunits known as α, β, and γ. α and β subunits are encoded in the GNPTAB gene, while the γ subunit is encoded in the GNPTG gene. MLII is one of the most severe LSDs and is commonly caused by a TC dinucleotide deletion mutation on exon 19 of GNPTAB (c.3503_3504del). This deletion disrupts the ORF and produces a truncated inactive protein. 2′-OMe-modified splice-modulating ASOs have been designed and evaluated to treat this condition. These ASOs induce exon 19 skipping, producing a smaller transcript with 56 amino acid deletion, yet allowing in-frame synthesis of α and β subunits. This will restore partial activity to GlcNAc-1-phosphotransferase, reducing the severe clinical manifestation of the disease. Two ASOs, named H19D(+12−9) and H19A(+119+138), obtained the most promising results. H19A(+119+138) produced the longest GNPTAB transcript missing exon 19 compared to full length out-of-frame transcript [221].

Hunter Syndrome (Mucopolysaccharidosis II)

HS is an X-linked recessive condition caused by the deficiency of iduronate-2 sulfatase (I2S) in lysosomes. I2S is used to break down glycosaminoglycans dermatan and heparan sulfate. I2S enzyme is encoded in the IDS gene; mutation in the IDS gene causes cellular accumulation of glycosaminoglycans dermatan and heparan sulfate. Clinical presentations of HS are stiff joints, facial dysmorphia (Hunters’ phenotype), and enlarged spleen and liver. The prevalence of HS is one in 170,000 male births [222].

The IDS gene contains nine exons and is located at Xq28. Multiple different mutations affect the expression of the IDS gene. Missense and nonsense mutations like c.241.C>T and c.257C>T cause dysregulation of exon 3 splicing by activating cryptic splice sites in exon 3 and 8. These mutations also make an SRSF1 binding site while removing SRSF2 and hnRNP E2 binding sites. Synonymous mutation c.1122C>T creates a cryptic splice site at exon 8, and it has increased the splice score of 5′ss. Matos et al. [223, 224] developed 25mer PMOs and 20mer LNA modified ASOs to block the new 5′ss in exon 8 to recover the mRNA, but results still displayed spliced mRNA. The PMO and LNA ASOs that were used failed to fully block the aberrant splicing.

Organic Acidemias

OAs are a group of medical conditions that are caused by defects in biochemical pathways converting isoleucine, cholesterol, valine, threonine odd-chain fatty acids, and methionine to organic acids by degradation. This disruption results in accumulation of toxic organic acids that disrupts other metabolic pathways and increases anion gap metabolic acidosis, ketosis, hyperammonemia, hypoglycemia, and elevated lactate [225]. Propionic acidemia (PA) and methylmalonic acidemia (MMA) are the two most prominent examples of OA caused by the disruption of the propionate oxidative pathway (POP). OAs are autosomal recessive inherited conditions that affect the synthesis or functionality of two major enzymes of the POP, propionyl coenzyme A (CoA) carboxylase (PCC) and methylmalonyl CoA mutase (MCM), or their coenzymes (biotin and adenosyl-cobalamin) [226].

The PCC enzyme has two subunits encoded in the PCCA gene and PCCB gene. The MCM enzyme is encoded in the MUT gene. The MMAA and MMAB genes are responsible for adenosylcobalamin synthesis in mitochondria. Mutation in MUT, MMAA, or MMAB genes causes isolated MMA, while a mutation in the PCCA or PCCB gene causes PA [226].

Various mutations pertinent to OA have been extensively researched. Over 50 different mutations have been studied, and the majority of them are missense mutations. The molecular mechanism of pathology is mostly common among the conditions. A single point mutation in the gene causes an activation of a cryptic splice site followed by a complementary splicing site closer to the mutation, leading to an insertion of an intronic sequence known as a pseudoexon into mature mRNA. In MMA, pathogenic mutations like c.1957-898A, c.458T>A, and c.458T>A have been identified in the MUT gene. One of the promising candidates selected for treatment of MMA is a 25mer PMO named AMO-B, which is complementary to the 5′ region of the inserted intronic sequence in c.1957-898A and c.458T>A mutations. In periclinal studies, patient fibroblast cells were transfected with AMO-B for 24 h, and results displayed that the treatment effectively recovered the production of normal MUT transcript [227].

An IVS14-1416A→G mutation was observed among patients with PCCA deficiency. This mutation has led to an insertion of an 84-bp pseudoexon between exon 14 and exon 15 of the PCCA gene. In PCCB-deficient patients, IVS6+462A→G was identified where a new 72-bp segment had been inserted between exon 6 and 7, which had created a 5' cryptic donor splice site. Currently, the most promising potential treatment for PCCA deficiency is ASO-29, which is an 18nt long 2'-MOE-PS AO. The modifications allow ASO-29 to bind to 3'ss and its alternating region with high affinity, restoring the normal splicing. A study displayed the dose-dependent nature of ASO-29 from 1-nM to 25-nM concentrations. At the 1-nM concentration, a onefold protein increase can be observed, while at the 25-nM concentration, close to a twofold PCCA protein increase can be observed [228]. PMO therapy targeting 3' and 5′ss of the pseudoexon is being studied as a potential treatment for PCCB mutation, and reverse transcriptase polymerase chain reaction (RT-PCR) results show at 10-µM and 20-µM concentrations the transcript is fully restored without the 72-bp intronic insertion [226].

Congenital Disorder of Glycosylation

CDG is a group of medical conditions characterized by disorder in protein and lipid glycosylation. This is caused by impairment of glycosyltransferases, glycosidases, nuclear-sugar transporters as well as proteins involved in Golgi trafficking and Golgi pH management. CDG is generally grouped into four types, i.e., O-linked glycosylation, N-linked glycosylation, O- and N-linked multiple glycosylation, and lipid and glycosylphosphatidylinositol (GPI) anchor biosynthesis defects [229]. These conditions lead to defective trafficking of proteins and abnormalities in channels implicated in pH or metal ion homeostasis. Since these biochemical processes are ubiquitous in all tissues, the clinical manifestation of CDG will carry mild to severe symptoms and multiorgan failure [230].

The N-linked glycosylation protein defect also known as PMM2-CDG (CDG type Ia) is the most common CDG. Patients suffering from PMM2-CDG harbor pathogenic missense mutations in the PMM2 gene. These mutations create a deficiency in PMM2 enzyme, which catalyzes the conversion of mannose-6-phosphate (M-6-P) to mannose-1-phosphate (M-1-P) in the guanosine diphosphate (GDP) mannose synthesis pathway [229]. There are multiple mutations that have been identified that affect the PMM2 gene. c.256-1G>C substitution creates exon skipping of exon 3 and 4 by introducing a 3'ss in intron 3, while the c.640-9T>G mutation activates a cryptic splice site in intron 3. Mutation c.640-15479C>T has been identified to introduce a 123-bp pseudoexon sequence in exon 7. 25mer PMOs AMOA and AMOB have been identified as leading candidates for treatment, where one binds to the 5′ss while the other binds to the 3′ss. A 20-µM concentration of the two PMOs was used to transfect patient fibroblasts, and after 24 h, the PMM2 protein level had increased by 9–23%. After 48 h and 72 h, PMM activity had increased to 50% compared to the healthy fibroblast control [231].

A novel mutation causing CDG type II was discovered to be associated with the TMEM165 gene. The TMEM165 gene produces a transmembrane protein that is responsible for calcium and pH homeostasis in Golgi complex, plasma membranes, and late endosomes. Multiple mutations have been identified that would affect the activity of the TMEM165 protein. Sixty percent of patients reported with TMEM mutation-related CDG type II had intronic substitution c.792+182G>A, while the rest had missense mutations such as c.377G>A, c.376C>T, or c.910G>A. Yuste-Checa et al. (2015) identified that the c.792+182G>A mutation activated a pseudoexon where a 117-bp sequence is inserted into intron 4, creating a new 5′ cryptic splice site. This resulted in either only exon 4 or both exon 3 and 4 being deleted from the transcript. A 25mer PMO has been identified by the same group, targeting the new 5′ cryptic splice site. Patient fibroblast cells were transfected with the PMO (20- or 30-µM concentrations). Twenty-four hours later, a tenfold increase in TMEM165 protein was observed among patients with the c.792+182G>A mutation, but no increase in protein production was observed in missense-mutated patient cells. This reveals that this PMO candidate specifically targets the c.792+182G>A mutation [232].

Hereditary Myopathy with Lactic Acidosis

HML is a recessively inherited condition with an IVS5+382 G>C mutation in the last intron of the ISCU gene. This single base transition introduces a PTC via retention of a pseudoexon between exon 5 and exon 6. This results in the loss of full-length iron-sulfur cluster assembly (ISCU) protein, creating a truncated protein due to loss of mRNA. This results in defects in iron- and sulfur-containing enzymes like succinate dehydrogenase, aconitase, and complex I–III of the mitochondrial respiratory chain. These enzymes fulfill a critical role in cellular respiration. Patients with HML have a characteristic clinical presentation of intolerance to exercises, fatigue, dyspnea, and muscle pain [233].

Exon skipping of the pseudoexon using ASOs to restore the wild type of mRNA of the allele is a therapeutic mechanism that has been investigated by scientists. Another approach is blocking the splice site to restore proper splicing of the pre-mRNA. A study conducted by transfecting three homozygous patient cell lines with 25mer PMO displayed that, 48 h after transfection, the splicing pattern was restored to 100% like the wild type. Also, the effects of the transfection were stable for 21 days [234].

Multiple studies have been conducted to explore therapeutic options to treat HML. Patient-derived primary muscle cells were transfected with 300 nM of a 22mer 2′-OMe-PS oligomer named AO-A targeting the pseudoexon acceptor splice site; restoration was close to onefold [233]. Some therapeutic candidates have been investigated regarding inducing exon skipping. One of the promising candidates of treatment for the phenotype of ISCU myopathy is a 18mer ASO sequence modified either with 2′-MOE-PS or cEt-PS chemistry. According to Holmes-Hampton et al. (2016), ISCU protein levels were elevated to the control level after patient fibroblasts were transfected with 30 nM of the 18mer ASO. The results further display a twofold increase in succinate in myotube cultures while aconitase and complex III activity increased to the level of the control group [235].

6-Pyruvovl-Tetrahydropterin Synthase Deficiency: Hyperphenylalaninemia

Hyperphenylalaninemia (HPA) is an autosomal recessive disorder of the phenylalanine metabolism pathway that results in phenylalanine accumulating in blood while blood tyrosine concentration is reduced, causing phenylketonuria. The average prevalence of HPA worldwide is 1:10,000. HPA has three major genotypes: phenylalanine hydroxylase (PAH) deficiency, tetrahydrobiopterin (BH4) metabolism defects, and DnaJ heat-shock protein family (Hsp40) member C12 (DNAJC12) deficiency [236].

BH4 metabolism is an essential metabolic process in the human body that creates BH4, which is a natural cofactor for tyrosine, phenylalanine, and tryptophan hydrolases. The PTPS enzyme catalyzes the second step of BH4 metabolism. The PTPS enzyme is encoded in the PTS gene. Mutation in the PTS gene will create a deficiency in PTPS enzyme, which could affect BH4 metabolism and causes HPA with moderate to severe neurological conditions, including hypotonia, bradykinesia, and seizures. Even though oral BH4 administration can be conducted, BH4 transfer across the blood–brain barrier is very poor; therefore, alternative therapeutic interventions are needed [237]. Martinez-Pizarro et al. (2022) have identified multiple mutations that could result in deficiency of PTPS enzyme by affecting mRNA processing. For example, c.243+3A>G results in exon 4 skipping and c.164-672C>T creates four overlapping pseudoexons resulting in a 5′ cryptic splice site. Studies have shown 20- and 25mer splice-modulating ASOs (SSO1–SSO6) with 2′-OMe-PS chemistry as good candidates for treatment. After transfection of patient fibroblasts with 25mer SSO1, 5, and 6, corrected PTS mRNA was produced and PTPS protein expression was increased from 5 to 50% relative to the untreated fibroblasts [238].

Apart from c.243+3A>G and c.164-672C>T, scientists have discovered more than 64 mutations that could cause PTPS deficiency. Some intronic mutations like c.84-322A>T, c.163+695_163+751del57, or c.164-712A>T create/delete splice regulatory elements and introduce new cryptic exons that are derived from short interspersed nuclear elements (SINEs) or long interspersed nuclear elements (LINEs) in the human genome. To reverse the pathogenic effect of these types of mutations in PTPS deficiency, Brasil et al. (2011) developed 24mer PTS PMOs (PTS-AMO1, PTS-AMO2, and PTS-AMO3). PTS-AMO1 targeted 3′ cryptic splice sites, while PTS-AMO2 and PTS-AMO3 targeted 5′ cryptic splice sites to block access of splicing agents to pseudoexons in pre-mRNA. Patient fibroblasts were transfected with 30µM of each ASO, and 24 h after transfection, correct PTS mRNA was recovered and functional PTPS protein was observed in patient cells [237].

Erythropoietic Protoporphyria

EPP is a rare genetic disorder in the heme metabolic pathway, characterized by ferrochelatase (FECH) deficiency. This clinically manifests in patients with an accumulation of protoporphyrin in blood, connective tissue, and erythrocytes. One of the unique clinical presentations of EPP is photodermatosis. The prevalence of EPP is estimated to be 1:75,000 and 1:200,000 births worldwide [239].

Biallelic polymorphism c.315-48T>C in intron 3 has been identified to increase the usage of a cryptic splice site between exon 3 and 4 by creating a 63-bp pseudoexon in intron 3. In wild-type alleles, the cryptic splice site can be seen to be only 20% active, yet with the alleles with cytosine substitution, it increases to 60%. c.315-48T>C creates PTC upstream from the mutation site − 63, causing aberrant splicing. This results in an unstable mature mRNA degraded by NMD. Deficiency of stable wild-type FECH mRNA in the body leads to a lack of stable FECH mRNA. FECH protein expression goes below 35% from healthy FECH levels, causing the deposing of free protoporphyrin IX. The 315-48C allele is present in more than 90% of EPP patients; therefore, researchers have taken interest in therapeutic approaches targeting the polymorphism. One of the approaches scientists have employed is an LNA-modified ASO method because of its nuclease resistance and higher affinity. Oustric et al. (2014) used two targets for LNA ASO development, i.e., the cryptic splice site at − 63 bp from intron 4 and the 315-48C nucleotide site. The optimum candidate that had the highest effect on reducing exon inclusion was 24mer V1-LNA-ASO, which targets the region of intron 3 from − 45 to − 63, covering both mutation point (− 48) and cryptic splice site (− 63). After 48 h of transfection with V1-LNA-ASO (125 nM), pseudoexon retention was reduced by 25% and the proportion between abnormally spliced mRNA and total mRNA was similar to the asymptomatic subject. Overall, FECH protein production increased, resulting in reduced accumulation of protoporphyrin [240].

Complementation Group Cobalamin E Type of Homocystinuria

Homocystinurias are a group of disorders of homocysteine metabolism [241]. The cblE type of homocystinuria is a rare autosomal recessive disorder caused by deficiency of methionine synthase reductase (MTRR) [242]. MTRR deficiency clinically manifests as brain demyelination and atrophy, megaloblastic anemia, psychomotor retardation, and homocystinuria. Fifteen exons have been identified in the MTRR gene, and 15 mutations in each exon have the potential to cause disease. The most prevalent mutation among these is the c.903+469T>C mutation in intron 6. c.903+469T>C mutation creates an ESE site binding to serine/arginine splicing factor 1 (SRFS1), which identifies a 5'ss leading to activation of a pseudoexon. Researchers have investigated different therapeutic options, and they have identified splice-switching ASOs as potential therapeutics that could be used to treat the cblE type of homocystinuria. ASOs bind to pre-mRNA to restore normal splicing by providing steric hindrance to block the binding of splicing factors like U2AF and UIsnRNP, thus inhibiting the pseudoexon inclusion. 2′-OMe-PS modified 24mer MTRR ESE-SSO, MTRR 5′ss-SSO, and 3′ss-SSO were used as candidates for transfection. The patient fibroblast cells were transfected with these three candidates, and MTRR ESE-SSO showed promising results by successfully inducing pseudoexon skipping and restoring correct splicing in MTRR mRNA to the control level [242].

Aromatic l-Amino Acid Decarboxylase Deficiency

AADCD is a rare autosomal recessive neurometabolic disorder caused by a mutation in the dopa-carboxylase (DDC) gene affecting the biosynthesis pathway of dopamine and serotonin. The prevalence of the condition is 1:116,000 in the European Union and 1:64,000–1:90,000 births in the USA [243].

Mutation of the DDC gene causes AADCD. This deficiency results in low levels of dopamine and serotonin in the body, which clinically manifest as developmental delays, athetoid movement, and oculogyric crises. Scientists have identified 40 distinct mutations among patients, and the most prevalent mutation of AADCD is c.714+4A>T. This mutation causes a splicing error that removes a splice donor site, creating a +38 cryptic splice site that can produce a PTC in DDC mRNA. To correct the aberrant splicing, Tsai et al. (2018) suggested the therapeutic option of 25mer PMOs. The ASOs restore the aberrantly spliced 5-6+37-7 transcript of DDC.714+4A>T to the normal 5-6-7-8 isoform. The leading candidate of this study, ASO-D, restored 41% of transcripts to the normal isoform. ASO-D restored mRNA to the normal form more effectively than any other candidate, and it has the highest target specificity among the candidates tested. Yet some unexpected novel splice variants were created by the ASOs. To increase efficacy, this group has suggested the combination of ASO-D with suppressor binding blocker ASO-9AA [244].

Conclusion

Although the individual prevalence of a single IEM or a single disease-causing mutation is extremely rare, collectively they affect a large population worldwide. Despite the availability of traditional treatments such as dietary manipulations, cofactor administrations, enzyme replacement therapies, and transplantation, most of the inherited metabolic diseases still lack effective therapeutic interventions. In addition, early diagnosis of the diseases resulting from technological advances further increases the demand for more effective treatments. To this end, splice-switching ASOs, owing to their capacity to suppress aberrant splicing patterns of mutant pre-mRNA in a mutation-specific manner and consequently recover normal protein expression, have been developed as an individualized molecular therapy for IEMs. The recent FDA permission given to milasen for investigating its therapeutic effect on CLN7 Batten disease can be considered a milestone in this field, proving the feasibility of splice-modulating ASO-based therapeutic strategies. In fact, as reviewed in this work, specific splice-modulating ASOs have been developed and evaluated in patients’ cells for targeting several IEMs, including LSDs, OAs, CDG, HML, PTPS deficiency, EPP, the cblE type of homocystinuria, and AADCD.

Herein, integrating the knowledge on the diversity of ASOs’ mechanisms, chemistry, and design, we provide suggestions on improving and optimizing the development of therapeutic ASOs towards targeting IEMs:

  1. Splice modulation, rather than RNase H-mediated RNA degradation, is the first choice when choosing an appropriate ASO mechanism of action for IEM treatment. This is due to the fact that most IEMs are monogenic disorders [259], and an IEM is usually caused by the defective expression of an enzyme resulting from a specific ORF-destructing mutation. A splice-modulating ASO can be designed to skip the mutation-induced pseudoexon, restore the ORF, and consequently recover the synthesis of functional enzyme. Alternatively, in some cases, RNase H-dependent ASOs may also be developed to avoid or reduce the toxic accumulation of a metabolite through inhibition of its transporter. For example, in the case of familial hypercholesterolemia, mipomersen, an FDA-approved gapmer-like ASO, is used to downregulate the expression of apolipoprotein B-100, thus lowering the plasma cholesterol level.

  2. Although all the FDA-permitted splice-modulating ASO drugs are uniformly modified, for example, milasen is a fully 2′-MOE-PS molecule, a lead candidate may be further optimized to improve its drug-like properties through incorporating promising novel nucleotide chemistries, such as cMOE, TMO, 7′,5′-α-bc-DNA, and MsPA (Fig. 3).

  3. Similar to point 2, further optimization of a lead candidate can be done by screening different mixmer-like ASOs with combinations of diverse chemistries (Fig. 4), leading to identification of the best-performing mixmer ASO design.

  4. Furthermore, administration of cocktails of two or more ASO sequences is worth investigating to further increase the potency of individual ASO candidates [260], as a single ASO sequence may not effectively disturb the secondary structure of its RNA target. However, ASO cocktail therapy may complicate or delay FDA approval.

  5. In addition, although most of the reported ASOs targeting IEMs have been shown effective in the correction of phenotypes preclinically, few have entered the clinical stage. Therefore, we would also like to suggest researchers screen and identify more efficacious ASO sequences for the same target gene. For example, ISIS 113715 was identified and selected as the lead ASO sequence targeting PTP1B for the therapy of type 2 diabetes in preclinical and phase I stages, but a more efficacious sequence (ISIS 404173) was chosen as the lead compound for a phase II trial [59]. Another example is the development of ASO targeting SOD1 for treating amyotrophic lateral sclerosis. ISIS 333611 (CCGTCGCCCTTCAGCACGCA) was initially selected as the lead candidate, but a better sequence, namely, tofersen (CAGGATACATTTCTACAGCT), was eventually chosen, clinically evaluated, and approved by the FDA [33, 261]. In addition to efficacy, pharmacokinetic properties and toxicity should also be considered when choosing a more promising ASO sequence as the new lead candidate.

Finally, given the considerable versatility, flexibility, and specificity of ASO-based therapeutics, which are offered by the diversity of their mechanisms, chemical modifications, and designs, we believe that more IEM-targeting ASOs listed in our work will enter clinical trials in the near future and splice-modulating ASOs will keep playing an important role in providing individualized treatment for IEMs with newly identified mutations.

Acknowledgements

RNV acknowledges financial support from the McCusker Charitable Foundation and the Perron Institute for Neurological and Translational Science. BTL acknowledges the financial support from ProGenis Pharmaceuticals Pty Ltd. SNH acknowledges the funding from the Industry-funded MSS Partnership Scholarship and International Tuition Fee Scholarship scheme from Murdoch University.

Declarations

Funding

Open Access funding enabled and organized by CAUL and its Member Institutions.

Conflict of interest

The authors have no conflicts of interest to declare.

Ethics approval

Not applicable.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and material

Not applicable.

Code availability

Not applicable.

Authors’ contributions

Conceptualization: SC and RNV. Writing—original draft preparation: SC and SNH. Writing—review and editing: BTL, KR, NR, QuAZ, and RNV. Supervision: RNV. All authors have read and agreed to the published version of the manuscript.

Footnotes

Suxiang Chen and Saumya Nishanga Heendeniya contributed equally.

References

  • 1.Chan JHP, Lim S, Wong WSF. Antisense oligonucleotides: from design to therapeutic application. Clin Exp Pharmacol Physiol. 2006;33:533–540. doi: 10.1111/j.1440-1681.2006.04403.x. [DOI] [PubMed] [Google Scholar]
  • 2.Crooke ST, Baker BF, Crooke RM, Liang XH. Antisense technology: an overview and prospectus. Nat Rev Drug Discov. 2021;20:427–453. doi: 10.1038/s41573-021-00162-z. [DOI] [PubMed] [Google Scholar]
  • 3.Alama A, Barbieri F, Cagnoli M, Schettini G. Antisense oligonucleotides as therapeutic agents. Pharmacol Res. 1997;36:171–178. doi: 10.1006/phrs.1997.0227. [DOI] [PubMed] [Google Scholar]
  • 4.Dias N, Stein CA. Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther. 2002;1:347–355. [PubMed] [Google Scholar]
  • 5.Smith CIE, Zain R. Therapeutic oligonucleotides: State of the art. Annu Rev Pharmacol Toxicol. 2019;59:605–630. doi: 10.1146/annurev-pharmtox-010818-021050. [DOI] [PubMed] [Google Scholar]
  • 6.Zamecnik PC, Stephenson ML. Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proc Natl Acad Sci USA. 1978;75:280–284. doi: 10.1073/pnas.75.1.280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Stephenson ML, Zamecnik PC. Inhibition of Rous sarcoma viral RNA translation by a specific oligodeoxyribonucleotide. Proc Natl Acad Sci USA. 1978;75:285–288. doi: 10.1073/pnas.75.1.285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Donis-Keller H. Site specific enzymatic cleavage of RNA. Nucleic Acids Res. 1979;7:179–192. doi: 10.1093/nar/7.1.179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dominski Z, Kole R. Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc Natl Acad Sci USA. 1993;90:8673–8677. doi: 10.1073/pnas.90.18.8673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Perry CM, Balfour JA. Fomivirsen. Drugs. 1999;57:375–380. doi: 10.2165/00003495-199957030-00010. [DOI] [PubMed] [Google Scholar]
  • 11.de Smet MD, Meenken CJ, van den Horn GJ. Fomivirsen—a phosphorothioate oligonucleotide for the treatment of CMV retinitis. Ocul Immunol Inflamm. 1999;7:189–198. doi: 10.1076/ocii.7.3.189.4007. [DOI] [PubMed] [Google Scholar]
  • 12.Roehr B. Fomivirsen approved for CMV retinitis. J Int Assoc Physicians AIDS Care. 1998;4:14–16. [PubMed] [Google Scholar]
  • 13.Wong E, Goldberg T. Mipomersen (kynamro): a novel antisense oligonucleotide inhibitor for the management of homozygous familial hypercholesterolemia. P T. 2014;39:119–122. [PMC free article] [PubMed] [Google Scholar]
  • 14.Chambergo-Michilot D, Alur A, Kulkarni S, Agarwala A. Mipomersen in familial hypercholesterolemia: an update on health-related quality of life and patient-reported outcomes. Vasc Health Risk Manag. 2022;18:73–80. doi: 10.2147/VHRM.S191965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Baker DE. Eteplirsen. Hosp Pharm. 2017;52:302–305. doi: 10.1310/hpx5204-302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lim KR, Maruyama R, Yokota T. Eteplirsen in the treatment of Duchenne muscular dystrophy. Drug Des Dev Ther. 2017;11:533–545. doi: 10.2147/DDDT.S97635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Stein CA. Eteplirsen approved for Duchenne muscular dystrophy: the FDA faces a difficult choice. Mol Ther. 2016;24:1884–1885. doi: 10.1038/mt.2016.188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Charleston JS, Schnell FJ, Dworzak J, Donoghue C, Lewis S, Chen L, et al. Eteplirsen treatment for Duchenne muscular dystrophy: exon skipping and dystrophin production. Neurology. 2018;90:e2146–e2154. doi: 10.1212/WNL.0000000000005680. [DOI] [PubMed] [Google Scholar]
  • 19.Heo YA. Golodirsen: first approval. Drugs. 2020;80:329–333. doi: 10.1007/s40265-020-01267-2. [DOI] [PubMed] [Google Scholar]
  • 20.Aartsma-Rus A, Corey DR. The 10th oligonucleotide therapy approved: Golodirsen for Duchenne muscular dystrophy. Nucleic Acid Ther. 2020;30:67–70. doi: 10.1089/nat.2020.0845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Anwar S, Yokota T. Golodirsen for Duchenne muscular dystrophy. Drugs Today (Barc) 2020;56:491–504. doi: 10.1358/dot.2020.56.8.3159186. [DOI] [PubMed] [Google Scholar]
  • 22.Viltolarsen DS. First approval. Drugs. 2020;80:1027–1031. doi: 10.1007/s40265-020-01339-3. [DOI] [PubMed] [Google Scholar]
  • 23.Roshmi RR, Yokota T. Viltolarsen for the treatment of Duchenne muscular dystrophy. Drugs Today (Barc) 2019;55:627–639. doi: 10.1358/dot.2019.55.10.3045038. [DOI] [PubMed] [Google Scholar]
  • 24.Roshmi RR, Yokota T. Viltolarsen: from preclinical studies to FDA approval. Methods Mol Biol. 2023;2587:31–41. doi: 10.1007/978-1-0716-2772-3_2. [DOI] [PubMed] [Google Scholar]
  • 25.Casimersen SM. First approval. Drugs. 2021;81:875–879. doi: 10.1007/s40265-021-01512-2. [DOI] [PubMed] [Google Scholar]
  • 26.Wilton-Clark H, Yokota T. Casimersen for Duchenne muscular dystrophy. Drugs Today (Barc) 2021;57:707–717. doi: 10.1358/dot.2021.57.12.3352740. [DOI] [PubMed] [Google Scholar]
  • 27.Zakeri SE, Pradeep SP, Kasina V, Laddha AP, Manautou JE, Bahal R. Casimersen for the treatment of Duchenne muscular dystrophy. Trends Pharmacol Sci. 2022;43:607–608. doi: 10.1016/j.tips.2022.04.009. [DOI] [PubMed] [Google Scholar]
  • 28.Neil EE, Bisaccia EK. Nusinersen: a novel antisense oligonucleotide for the treatment of spinal muscular atrophy. J Pediatr Pharmacol Ther. 2019;24:194–203. doi: 10.5863/1551-6776-24.3.194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li Q. Nusinersen as a therapeutic agent for spinal muscular atrophy. Yonsei Med J. 2020;61:273–283. doi: 10.3349/ymj.2020.61.4.273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wurster CD, Ludolph AC. Nusinersen for spinal muscular atrophy. Ther Adv Neurol Disord. 2018;11:1756285618754459. doi: 10.1177/1756285618754459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gales L. Tegsedi (inotersen): an antisense oligonucleotide approved for the treatment of adult patients with hereditary transthyretin amyloidosis. Pharmaceuticals (Basel) 2019;12:78. doi: 10.3390/ph12020078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Keam SJ. Inotersen: first global approval. Drugs. 2018;78:1371–1376. doi: 10.1007/s40265-018-0968-5. [DOI] [PubMed] [Google Scholar]
  • 33.Blair HA. Tofersen: first approval. Drugs Today (Barc) 2023;83:1039–1043. doi: 10.1007/s40265-023-01904-6. [DOI] [PubMed] [Google Scholar]
  • 34.Akcea's antisense drug rejection worries analysts. Nat Biotechnol. 2018; 36:911 [DOI] [PubMed]
  • 35.Paik J, Duggan S. Volanesorsen: first global approval. Drugs. 2019;79:1349–1354. doi: 10.1007/s40265-019-01168-z. [DOI] [PubMed] [Google Scholar]
  • 36.Kim J, Hu C, Moufawad El Achkar C, Black LE, Douville J, Larson A, et al. Patient-customized oligonucleotide therapy for a rare genetic disease. N Engl J Med. 2019;381:1644–1652. doi: 10.1056/NEJMoa1813279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Cappella M, Pradat PF, Querin G, Biferi MG. Beyond the traditional clinical trials for amyotrophic lateral sclerosis and the future impact of gene therapy. J Neuromuscul Dis. 2021;8:25–38. doi: 10.3233/JND-200531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Synofzik M, van Roon-Mom WMC, Marckmann G, van Duyvenvoorde HA, Graessner H, Schüle R, et al. Preparing n-of-1 antisense oligonucleotide treatments for rare neurological diseases in Europe: genetic, regulatory, and ethical perspectives. Nucleic Acid Ther. 2022;32:83–94. doi: 10.1089/nat.2021.0039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bennett CF, Swayze EE. RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol. 2010;50:259–293. doi: 10.1146/annurev.pharmtox.010909.105654. [DOI] [PubMed] [Google Scholar]
  • 40.Crooke ST, Liang XH, Baker BF, Crooke RM. Antisense technology: a review. J Biol Chem. 2021;296:100416. doi: 10.1016/j.jbc.2021.100416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Crooke ST, Witztum JL, Bennett CF, Baker BF. RNA-targeted therapeutics. Cell Metab. 2019;27:714–739. doi: 10.1016/j.cmet.2018.03.004. [DOI] [PubMed] [Google Scholar]
  • 42.Damase TR, Sukhovershin R, Boada C, Taraballi F, Pettigrew RI, Cooke JP. The limitless future of RNA therapeutics. Front Bioeng Biotechnol. 2021;9:628137. doi: 10.3389/fbioe.2021.628137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dhuri K, Bechtold C, Quijano E, Pham H, Gupta A, Vikram A, et al. Antisense oligonucleotides: an emerging area in drug discovery and development. J Clin Med. 2020;9:2004. doi: 10.3390/jcm9062004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Egli M, Manoharan M. Chemistry, structure and function of approved oligonucleotide therapeutics. Nucleic Acids Res. 2023;51:2529–2573. doi: 10.1093/nar/gkad067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kuijper EC, Bergsma AJ, Pijnappel WWMP, Aartsma-Rus A. Opportunities and challenges for antisense oligonucleotide therapies. J Inherit Metab Dis. 2021;44:72–87. doi: 10.1002/jimd.12251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Moumné L, Marie AC, Crouvezier N. Oligonucleotide therapeutics: from discovery and development to patentability. Pharmaceutics. 2022;14:260. doi: 10.3390/pharmaceutics14020260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Quemener AM, Bachelot L, Forestier A, Donnou-Fournet E, Gilot D, Galibert MD. The powerful world of antisense oligonucleotides: from bench to bedside. Wiley Interdiscip Rev RNA. 2020;11:e1594. doi: 10.1002/wrna.1594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Quemener AM, Centomo ML, Sax SL, Panella R. Small drugs, huge impact: the extraordinary impact of antisense oligonucleotides in research and drug development. Molecules. 2022;27:536. doi: 10.3390/molecules27020536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Scoles DR, Minikel EV, Pulst SM. Antisense oligonucleotides: a primer. Neurol Genet. 2019;5:e323. doi: 10.1212/NXG.0000000000000323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shen X, Corey DR. Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs. Nucleic Acids Res. 2018;46:1584–1600. doi: 10.1093/nar/gkx1239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Li D, McIntosh CS, Mastaglia FL, Wilton SD, Aung-Htut MT. Neurodegenerative diseases: a hotbed for splicing defects and the potential therapies. Transl Neurodegener. 2021;10:16. doi: 10.1186/s40035-021-00240-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Li D, Mastaglia FL, Fletcher S, Wilton SD. Progress in the molecular pathogenesis and nucleic acid therapeutics for Parkinson's disease in the precision medicine era. Med Res Rev. 2020;40:2650–2681. doi: 10.1002/med.21718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Chakravarthy M, Chen S, Dodd PR, Veedu RN. Nucleic acid-based theranostics for tackling Alzheimer's disease. Theranostics. 2017;7:3933–3947. doi: 10.7150/thno.21529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Le BT, Raguraman P, Kosbar TR, Fletcher S, Wilton SD, Veedu RN. Antisense oligonucleotides targeting angiogenic factors as potential cancer therapeutics. Mol Ther Nucleic Acids. 2019;14:142–157. doi: 10.1016/j.omtn.2018.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Raguraman P, Balachandran AA, Chen S, Diermeier SD, Veedu RN. Antisense oligonucleotide-mediated splice switching: potential therapeutic approach for cancer mitigation. Cancers (Basel). 2021;13:5555. doi: 10.3390/cancers13215555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Li Y, Tan Y, Zhang R, Wang T, Na N, Zheng T, et al. Antisense oligonucleotide: a potential therapeutic intervention for chronic kidney disease. Kidney Dial. 2022;2:16–37. doi: 10.3390/kidneydial2010004. [DOI] [Google Scholar]
  • 57.Yang YW, Poudel B, Frederick J, Dhillon P, Shrestha R, Ma Z, et al. Antisense oligonucleotides ameliorate kidney dysfunction in podocyte-specific APOL1 risk variant mice. Mol Ther. 2022;30:2491–2504. doi: 10.1016/j.ymthe.2022.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Pérez B, Rodríguez-Pascau L, Vilageliu L, Grinberg D, Ugarte M, Desviat LR. Present and future of antisense therapy for splicing modulation in inherited metabolic disease. J Inherit Metab Dis. 2010;33:397–403. doi: 10.1007/s10545-010-9135-1. [DOI] [PubMed] [Google Scholar]
  • 59.Chen S, Sbuh N, Veedu RN. Antisense oligonucleotides as potential therapeutics for type 2 diabetes. Nucleic Acid Ther. 2021;31:39–57. doi: 10.1089/nat.2020.0891. [DOI] [PubMed] [Google Scholar]
  • 60.Pérez B, Vilageliu L, Grinberg D, Desviat LR. Antisense mediated splicing modulation for inherited metabolic diseases: challenges for delivery. Nucleic Acid Ther. 2014;24:48–56. doi: 10.1089/nat.2013.0453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Dardis A, Buratti E. Impact, characterization, and rescue of pre-mRNA splicing mutations in lysosomal storage disorders. Genes (Basel). 2018;9:73. doi: 10.3390/genes9020073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Goga A, Stoffel M. Therapeutic RNA-silencing oligonucleotides in metabolic diseases. Nat Rev Drug Discov. 2022;21:417–439. doi: 10.1038/s41573-022-00407-5. [DOI] [PubMed] [Google Scholar]
  • 63.Martinez-Pizarro A, Desviat LR. RNA solutions to treat inborn errors of metabolism. Mol Genet Metab. 2022;136:289–295. doi: 10.1016/j.ymgme.2022.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Kamboj M. Clinical approach to the diagnoses of inborn errors of metabolism. Pediatr Clin N Am. 2008;55:1113–1127. doi: 10.1016/j.pcl.2008.07.004. [DOI] [PubMed] [Google Scholar]
  • 65.Garrod AE. The incidence of alkaptonuria: a study in chemical individuality. Lancet. 1902;160:1616–1620. doi: 10.1016/S0140-6736(01)41972-6. [DOI] [Google Scholar]
  • 66.Lindner M, Gramer G, Haege G, Fang-Hoffmann J, Schwab KO, Tacke U, et al. Efficacy and outcome of expanded newborn screening for metabolic diseases—report of 10 years from South-West Germany. Orphanet J Rare Dis. 2011;6:44. doi: 10.1186/1750-1172-6-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Ginocchio VM, Brunetti-Pierri N. Progress toward improved therapies for inborn errors of metabolism. Hum Mol Genet. 2016;25:R27–35. doi: 10.1093/hmg/ddv418. [DOI] [PubMed] [Google Scholar]
  • 68.Saudubray JM, Sedel F, Walter JH. Clinical approach to treatable inborn metabolic diseases: an introduction. J Inherit Metab Dis. 2006;29:261–274. doi: 10.1007/s10545-006-0358-0. [DOI] [PubMed] [Google Scholar]
  • 69.Leonard JV, Morris AA. Inborn errors of metabolism around time of birth. Lancet. 2000;356:583–587. doi: 10.1016/S0140-6736(00)02591-5. [DOI] [PubMed] [Google Scholar]
  • 70.Ezgu F. Inborn errors of metabolism. Adv Clin Chem. 2016;73:195–250. doi: 10.1016/bs.acc.2015.12.001. [DOI] [PubMed] [Google Scholar]
  • 71.Martins AM. Inborn errors of metabolism: a clinical overview. Sao Paulo Med J. 1999;117:251–265. doi: 10.1590/S1516-31801999000600006. [DOI] [PubMed] [Google Scholar]
  • 72.Ferreira CR, Rahman S, Keller M, Zschocke J, ICIMD Advisory Group An international classification of inherited metabolic disorders (ICIMD) J Inherit Metab Dis. 2021;44:164–177. doi: 10.1002/jimd.12348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Chace DH, Kalas TA, Naylor EW. The application of tandem mass spectrometry to neonatal screening for inherited disorders of intermediary metabolism. Annu Rev Genom Hum Genet. 2002;3:17–45. doi: 10.1146/annurev.genom.3.022502.103213. [DOI] [PubMed] [Google Scholar]
  • 74.Zytkovicz TH, Fitzgerald EF, Marsden D, Larson CA, Shih VE, Johnson DM, et al. Tandem mass spectrometric analysis for amino, organic, and fatty acid disorders in newborn dried blood spots: a two-year summary from the New England Newborn Screening Program. Clin Chem. 2001;47:1945–1955. doi: 10.1093/clinchem/47.11.1945. [DOI] [PubMed] [Google Scholar]
  • 75.Ferreira CR, van Karnebeek CDM. Inborn errors of metabolism. Handb Clin Neurol. 2019;162:449–481. doi: 10.1016/B978-0-444-64029-1.00022-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Sanderson S, Green A, Preece MA, Burton H. The incidence of inherited metabolic disorders in the West Midlands, UK. Arch Dis Child. 2006;91:896–899. doi: 10.1136/adc.2005.091637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Bharadwaj A, Wahi N, Saxena A. Occurrence of inborn errors of metabolism in newborns, diagnosis and prophylaxis. Endocr Metab Immune Disord Drug Targets. 2021;21:592–616. doi: 10.2174/1871530321666201223110918. [DOI] [PubMed] [Google Scholar]
  • 78.Rice GM, Steiner RD. Inborn errors of metabolism (metabolic disorders) Pediatr Rev. 2016;37:3–47. doi: 10.1542/pir.2014-0122. [DOI] [PubMed] [Google Scholar]
  • 79.Stockler-Ipsiroglu S, Potter BK, Yuskiv N, Tingley K, Patterson M, van Karnebeek C. Developments in evidence creation for treatments of inborn errors of metabolism. J Inherit Metab Dis. 2021;44:88–98. doi: 10.1002/jimd.12315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Camp KM, Lloyd-Puryear MA, Huntington KL. Nutritional treatment for inborn errors of metabolism: indications, regulations, and availability of medical foods and dietary supplements using phenylketonuria as an example. Mol Genet Metab. 2012;107:3–9. doi: 10.1016/j.ymgme.2012.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Parenti G, Andria G, Ballabio A. Lysosomal storage diseases: from pathophysiology to therapy. Annu Rev Med. 2015;66:471–486. doi: 10.1146/annurev-med-122313-085916. [DOI] [PubMed] [Google Scholar]
  • 82.Pastores GM, Hughes DA. Non-neuronopathic lysosomal storage disorders: disease spectrum and treatments. Best Pract Res Clin Endocrinol Metab. 2015;29:173–182. doi: 10.1016/j.beem.2014.08.005. [DOI] [PubMed] [Google Scholar]
  • 83.Mazariegos G, Shneider B, Burton B, Fox IJ, Hadzic N, Kishnani P, et al. Liver transplantation for pediatric metabolic disease. Mol Genet Metab. 2014;111:418–427. doi: 10.1016/j.ymgme.2014.01.006. [DOI] [PubMed] [Google Scholar]
  • 84.Vernon HJ. Inborn errors of metabolism: advances in diagnosis and therapy. JAMA Pediatr. 2015;169:778–782. doi: 10.1001/jamapediatrics.2015.0754. [DOI] [PubMed] [Google Scholar]
  • 85.Therrell BL, Padilla CD, Loeber JG, Kneisser I, Saadallah A, Borrajo GJ, et al. Current status of newborn screening worldwide: 2015. Semin Perinatol. 2015;39:171–187. doi: 10.1053/j.semperi.2015.03.002. [DOI] [PubMed] [Google Scholar]
  • 86.Roberts TC, Langer R, Wood MJA. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov. 2020;19:673–694. doi: 10.1038/s41573-020-0075-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Gagliardi M, Ashizawa AT. The Challenges and strategies of antisense oligonucleotide drug delivery. Biomedicines. 2021;9:433. doi: 10.3390/biomedicines9040433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Ward AJ, Norrbom M, Chun S, Bennett CF, Rigo F. Nonsense-mediated decay as a terminating mechanism for antisense oligonucleotides. Nucleic Acids Res. 2014;42:5871–5879. doi: 10.1093/nar/gku184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Rinaldi C, Wood MJA. Antisense oligonucleotides: the next frontier for treatment of neurological disorders. Nat Rev Neurol. 2018;14:9–21. doi: 10.1038/nrneurol.2017.148. [DOI] [PubMed] [Google Scholar]
  • 90.Cerritelli SM, Crouch RJ. Ribonuclease H: the enzymes in eukaryotes. FEBS J. 2009;276:1494–1505. doi: 10.1111/j.1742-4658.2009.06908.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Wu H, Lima WF, Zhang H, Fan A, Sun H, Crooke ST. Determination of the role of the human RNase H1 in the pharmacology of DNA-like antisense drugs. J Biol Chem. 2004;279:17181–17189. doi: 10.1074/jbc.M311683200. [DOI] [PubMed] [Google Scholar]
  • 92.Liang XH, Sun H, Nichols JG, Crooke ST. RNase H1-dependent antisense oligonucleotides are robustly active in directing RNA cleavage in both the cytoplasm and the nucleus. Mol Ther. 2017;25:2075–2092. doi: 10.1016/j.ymthe.2017.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Nagarajan VK, Jones CI, Newbury SF, Green PJ. XRN 5′→3′ exoribonucleases: structure, mechanisms and functions. Biochim Biophys Acta. 2013;1829:590–603. doi: 10.1016/j.bbagrm.2013.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Lima WF, De Hoyos CL, Liang XH, Crooke ST. RNA cleavage products generated by antisense oligonucleotides and siRNAs are processed by the RNA surveillance machinery. Nucleic Acids Res. 2016;44:3351–3363. doi: 10.1093/nar/gkw065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Hair P, Cameron F, McKeage K. Mipomersen sodium: first global approval. Drugs Today (Barc) 2013;73:487–493. doi: 10.1007/s40265-013-0042-2. [DOI] [PubMed] [Google Scholar]
  • 96.Baker BF, Lot SS, Condon TP, Cheng-Flournoy S, Lesnik EA, Sasmor HM, et al. 2′-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J Biol Chem. 1997;272:11994–12000. doi: 10.1074/jbc.272.18.11994. [DOI] [PubMed] [Google Scholar]
  • 97.Boiziau C, Kurfurst R, Cazenave C, Roig V, Thuong NT, Toulmé JJ. Inhibition of translation initiation by antisense oligonucleotides via an RNase-H independent mechanism. Nucleic Acids Res. 1991;19:1113–1119. doi: 10.1093/nar/19.5.1113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Liang XH, Shen W, Sun H, Migawa MT, Vickers TA, Crooke ST. Translation efficiency of mRNAs is increased by antisense oligonucleotides targeting upstream open reading frames. Nat Biotechnol. 2016;34:875–880. doi: 10.1038/nbt.3589. [DOI] [PubMed] [Google Scholar]
  • 99.Somers J, Pöyry T, Willis AE. A perspective on mammalian upstream open reading frame function. Int J Biochem Cell Biol. 2013;45:1690–1700. doi: 10.1016/j.biocel.2013.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Vickers TA, Wyatt JR, Burckin T, Bennett CF, Freier SM. Fully modified 2′ MOE oligonucleotides redirect polyadenylation. Nucleic Acids Res. 2001;29:1293–1299. doi: 10.1093/nar/29.6.1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Havens MA, Hastings ML. Splice-switching antisense oligonucleotides as therapeutic drugs. Nucleic Acids Res. 2016;44:6549–6563. doi: 10.1093/nar/gkw533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Lu QL, Rabinowitz A, Chen YC, Yokota T, Yin H, Alter J, et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA. 2005;102:198–203. doi: 10.1073/pnas.0406700102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Passini MA, Bu J, Richards AM, Kinnecom C, Sardi SP, Stanek LM, et al. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci Transl Med. 2011;3:72ra18. doi: 10.1126/scitranslmed.3001777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Svasti S, Suwanmanee T, Fucharoen S, Moulton HM, Nelson MH, Maeda N, et al. RNA repair restores hemoglobin expression in IVS2-654 thalassemic mice. Proc Natl Acad Sci USA. 2009;106:1205–1210. doi: 10.1073/pnas.0812436106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Kole R, Krainer AR, Altman S. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat Rev Drug Discov. 2012;11:125–140. doi: 10.1038/nrd3625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 106.Aartsma-Rus A, Straub V, Hemmings R, Haas M, Schlosser-Weber G, Stoyanova-Beninska V, et al. Development of exon skipping therapies for Duchenne muscular dystrophy: a critical review and a perspective on the outstanding issues. Nucleic Acid Ther. 2017;27:251–259. doi: 10.1089/nat.2017.0682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Alshaer W, Zureigat H, Al Karaki A, Al-Kadash A, Gharaibeh L, Hatmal MM, et al. siRNA: mechanism of action, challenges, and therapeutic approaches. Eur J Pharmacol. 2021;905:174178. doi: 10.1016/j.ejphar.2021.174178. [DOI] [PubMed] [Google Scholar]
  • 108.Gareri C, Polimeni A, Giordano S, Tammè L, Curcio A, Indolfi C. Antisense oligonucleotides and small interfering RNA for the treatment of dyslipidemias. J Clin Med. 2022;11:3884. doi: 10.3390/jcm11133884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Bajan S, Hutvagner G. RNA-based therapeutics: From antisense oligonucleotides to miRNAs. Cells. 2020;9:137. doi: 10.3390/cells9010137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 110.Zhu Y, Zhu L, Wang X, Jin H. RNA-based therapeutics: an overview and prospectus. Cell Death Dis. 2022;13:644. doi: 10.1038/s41419-022-05075-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Watts JK, Corey DR. Silencing disease genes in the laboratory and the clinic. J Pathol. 2012;226:365–379. doi: 10.1002/path.2993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Paterson BM, Roberts BE, Kuff EL. Structural gene identification and mapping by DNA-mRNA hybrid-arrested cell-free translation. Proc Natl Acad Sci USA. 1977;74:4370–4374. doi: 10.1073/pnas.74.10.4370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Bennett CF, Baker BF, Pham N, Swayze E, Geary RS. Pharmacology of antisense drugs. Annu Rev Pharmacol Toxicol. 2017;57:81–105. doi: 10.1146/annurev-pharmtox-010716-104846. [DOI] [PubMed] [Google Scholar]
  • 114.Shadid M, Badawi M, Abulrob A. Antisense oligonucleotides: absorption, distribution, metabolism, and excretion. Expert Opin Drug Metab Toxicol. 2021;17:1281–1292. doi: 10.1080/17425255.2021.1992382. [DOI] [PubMed] [Google Scholar]
  • 115.Dowdy SF. Overcoming cellular barriers for RNA therapeutics. Nat Biotechnol. 2017;35:222–229. doi: 10.1038/nbt.3802. [DOI] [PubMed] [Google Scholar]
  • 116.Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016;44:6518–6548. doi: 10.1093/nar/gkw236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Wan WB, Seth PP. The medicinal chemistry of therapeutic oligonucleotides. J Med Chem. 2016;59:9645–9667. doi: 10.1021/acs.jmedchem.6b00551. [DOI] [PubMed] [Google Scholar]
  • 118.Crooke ST, Wang S, Vickers TA, Shen W, Liang XH. Cellular uptake and trafficking of antisense oligonucleotides. Nat Biotechnol. 2017;35:230–237. doi: 10.1038/nbt.3779. [DOI] [PubMed] [Google Scholar]
  • 119.Geary RS, Norris D, Yu R, Bennett CF. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides. Adv Drug Deliv Rev. 2015;87:46–51. doi: 10.1016/j.addr.2015.01.008. [DOI] [PubMed] [Google Scholar]
  • 120.Bennett CF, Baker BF, Pham N, Swayze E, Geary RS. Therapeutic antisense oligonucleotides are coming of age. Annu Rev Med. 2019;70:307–321. doi: 10.1146/annurev-med-041217-010829. [DOI] [PubMed] [Google Scholar]
  • 121.Freier SM, Altmann KH. The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes. Nucleic Acids Res. 1997;25:4429–4443. doi: 10.1093/nar/25.22.4429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Eckstein F. Phosphorothioates, essential components of therapeutic oligonucleotides. Nucleic Acid Ther. 2014;24:374–387. doi: 10.1089/nat.2014.0506. [DOI] [PubMed] [Google Scholar]
  • 123.Ghosh MK, Ghosh K, Dahl O, Cohen JS. Evaluation of some properties of a phosphorodithioate oligodeoxyribonucleotide for antisense application. Nucleic Acids Res. 1993;21:5761–5766. doi: 10.1093/nar/21.24.5761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Gryaznov S, Skorski T, Cucco C, Nieborowska-Skorska M, Chiu CY, Lloyd D, et al. Oligonucleotide N3′→P5′phosphoramidates as antisense agents. Nucleic Acids Res. 1996;24:1508–1514. doi: 10.1093/nar/24.8.1508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 125.Miller PS. Oligonucleoside methylphosphonates as antisense reagents. Biotechnology. 1991;9:358–362. doi: 10.1038/nbt0491-358. [DOI] [PubMed] [Google Scholar]
  • 126.Rait V, Sergueev D, Summers J, He K, Huang F, Krzyzanowska B, et al. Boranophosphate nucleic acids—a versatile DNA backbone. Nucleosides Nucleotides. 1999;18:1379–1380. doi: 10.1080/07328319908044721. [DOI] [PubMed] [Google Scholar]
  • 127.Sheehan D, Lunstad B, Yamada CM, Stell BG, Caruthers MH, Dellinger DJ. Biochemical properties of phosphonoacetate and thiophosphonoacetate oligodeoxyribonucleotides. Nucleic Acids Res. 2003;31:4109–4118. doi: 10.1093/nar/gkg439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 128.Miroshnichenko SK, Patutina OA, Burakova EA, Chelobanov BP, Fokina AA, Vlassov VV, et al. Mesyl phosphoramidate antisense oligonucleotides as an alternative to phosphorothioates with improved biochemical and biological properties. Proc Natl Acad Sci USA. 2019;116:1229–1234. doi: 10.1073/pnas.1813376116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Eckstein F. Phosphorothioate oligodeoxynucleotides: what is their origin and what is unique about them? Antisense Nucleic Acid Drug Dev. 2000;10:117–121. doi: 10.1089/oli.1.2000.10.117. [DOI] [PubMed] [Google Scholar]
  • 130.Stein CA, Subasinghe C, Shinozuka K, Cohen JS. Physicochemical properties of phosphorothioate oligodeoxynucleotides. Nucleic Acids Res. 1988;16:3209–3221. doi: 10.1093/nar/16.8.3209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 131.Steinke CA, Reeves KK, Powell JW, Lee SA, Chen YZ, Wyrzykiewicz T, et al. Vibrational analysis of phosphorothioate DNA: II. The POS group in the model compound dimethyl phosphorothioate [(CH3O)2(POS)]–. J Biomol Struct Dyn. 1997;14:509–516. doi: 10.1080/07391102.1997.10508149. [DOI] [PubMed] [Google Scholar]
  • 132.Baraniak J, Frey PA. Effect of ion pairing on bond order and charge localization in alkyl phosphorothioates. J Am Chem Soc. 1988;110:4059–4060. doi: 10.1021/ja00220a067. [DOI] [Google Scholar]
  • 133.Sands H, Gorey-Feret LJ, Cocuzza AJ, Hobbs FW, Chidester D, Trainor GL. Biodistribution and metabolism of internally 3H-labeled oligonucleotides. I. Comparison of a phosphodiester and a phosphorothioate. Mol Pharmacol. 1994;45:932–943. [PubMed] [Google Scholar]
  • 134.Crooke ST, Bennett CF. Progress in antisense oligonucleotide therapeutics. Annu Rev Pharmacol Toxicol. 1996;36:107–129. doi: 10.1146/annurev.pa.36.040196.000543. [DOI] [PubMed] [Google Scholar]
  • 135.Liang XH, Sun H, Shen W, Crooke ST. Identification and characterization of intracellular proteins that bind oligonucleotides with phosphorothioate linkages. Nucleic Acids Res. 2015;43:2927–2945. doi: 10.1093/nar/gkv143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 136.Wang S, Sun H, Tanowitz M, Liang XH, Crooke ST. Annexin A2 facilitates endocytic trafficking of antisense oligonucleotides. Nucleic Acids Res. 2016;44:7314–7330. doi: 10.1093/nar/gkw595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 137.Miller CM, Donner AJ, Blank EE, Egger AW, Kellar BM, Østergaard ME, et al. Stabilin-1 and Stabilin-2 are specific receptors for the cellular internalization of phosphorothioate-modified antisense oligonucleotides (ASOs) in the liver. Nucleic Acids Res. 2016;44:2782–2794. doi: 10.1093/nar/gkw112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 138.Liang XH, Sun H, Hsu CW, Nichols JG, Vickers TA, De Hoyos CL, et al. Golgi-endosome transport mediated by M6PR facilitates release of antisense oligonucleotides from endosomes. Nucleic Acids Res. 2020;48:1372–1391. doi: 10.1093/nar/gkz1171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139.Wang S, Allen N, Vickers TA, Revenko AS, Sun H, Liang XH, et al. Cellular uptake mediated by epidermal growth factor receptor facilitates the intracellular activity of phosphorothioate-modified antisense oligonucleotides. Nucleic Acids Res. 2018;46:3579–3594. doi: 10.1093/nar/gky145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140.Brown DA, Kang SH, Gryaznov SM, DeDionisio L, Heidenreich O, Sullivan S, Xu X, Nerenberg MI. Effect of phosphorothioate modification of oligodeoxynucleotides on specific protein binding. J Biol Chem. 1994;269:26801–26805. doi: 10.1016/S0021-9258(18)47090-1. [DOI] [PubMed] [Google Scholar]
  • 141.Weidner DA, Valdez BC, Henning D, Greenberg S, Busch H. Phosphorothioate oligonucleotides bind in a non sequence-specific manner to the nucleolar protein C23/nucleolin. FEBS Lett. 1995;366:146–150. doi: 10.1016/0014-5793(95)00517-D. [DOI] [PubMed] [Google Scholar]
  • 142.Shen W, Liang XH, Crooke ST. Phosphorothioate oligonucleotides can displace NEAT1 RNA and form nuclear paraspeckle-like structures. Nucleic Acids Res. 2014;42:8648–8662. doi: 10.1093/nar/gku579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 143.Liang XH, Shen W, Sun H, Prakash TP, Crooke ST. TCP1 complex proteins interact with phosphorothioate oligonucleotides and can co-localize in oligonucleotide-induced nuclear bodies in mammalian cells. Nucleic Acids Res. 2014;42:7819–7832. doi: 10.1093/nar/gku484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144.Oka N, Kondo T, Fujiwara S, Maizuru Y, Wada T. Stereocontrolled synthesis of oligoribonucleoside phosphorothioates by an oxazaphospholidine approach. Org Lett. 2009;11:967–970. doi: 10.1021/ol802910k. [DOI] [PubMed] [Google Scholar]
  • 145.Nukaga Y, Yamada K, Ogata T, Oka N, Wada T. Stereocontrolled solid-phase synthesis of phosphorothioate oligoribonucleotides using 2′-O-(2-cyanoethoxymethyl)-nucleoside 3′-O-oxazaphospholidine monomers. J Org Chem. 2012;77:7913–7922. doi: 10.1021/jo301052v. [DOI] [PubMed] [Google Scholar]
  • 146.Nukaga Y, Oka N, Wada T. Stereocontrolled solid-phase synthesis of phosphate/phosphorothioate (PO/PS) chimeric oligodeoxyribonucleotides on an automated synthesizer using an oxazaphospholidine-phosphoramidite method. J Org Chem. 2016;81:2753–2762. doi: 10.1021/acs.joc.5b02793. [DOI] [PubMed] [Google Scholar]
  • 147.Gaus HJ, Gupta R, Chappell AE, Østergaard ME, Swayze EE, Seth PP. Characterization of the interactions of chemically-modified therapeutic nucleic acids with plasma proteins using a fluorescence polarization assay. Nucleic Acids Res. 2019;47:1110–1122. doi: 10.1093/nar/gky1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 148.Abeydeera ND, Egli M, Cox N, Mercier K, Conde JN, Pallan PS, et al. Evoking picomolar binding in RNA by a single phosphorodithioate linkage. Nucleic Acids Res. 2016;44:8052–8064. doi: 10.1093/nar/gkw725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 149.Schneider PN, Olthoff JT, Matthews AJ, Houston DW. Use of fully modified 2′-O-methyl antisense oligos for loss-of-function studies in vertebrate embryos. Genesis. 2011;49:117–123. doi: 10.1002/dvg.20689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150.Jirka SM, de Winter CLT, van der Meulen JWB, van Putten M, Hiller M, Vermue R, et al. Evaluation of 2′-deoxy-2′-fluoro antisense oligonucleotides for exon skipping in Duchenne muscular dystrophy. Mol Ther Nucleic Acids. 2015;4:e265. doi: 10.1038/mtna.2015.39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 151.Chen S, Le BT, Chakravarthy M, Kosbar TR, Veedu RN. Systematic evaluation of 2′-Fluoro modified chimeric antisense oligonucleotide-mediated exon skipping in vitro. Sci Rep. 2019;9:6078. doi: 10.1038/s41598-019-42523-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152.Kalota A, Karabon L, Swider CR, Viazovkina E, Elzagheid M, Damha MJ, et al. 2′-Deoxy-2′-fluoro-beta-d-arabinonucleic acid (2'F-ANA) modified oligonucleotides (ON) effect highly efficient, and persistent, gene silencing. Nucleic Acids Res. 2006;34:451–461. doi: 10.1093/nar/gkj455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 153.Veedu RN, Wengel J. Locked nucleic acid as a novel class of therapeutic agents. RNA Biol. 2009;6:321–323. doi: 10.4161/rna.6.3.8807. [DOI] [PubMed] [Google Scholar]
  • 154.Veedu RN, Wengel J. Locked nucleic acids: promising nucleic acid analogs for therapeutic applications. Chem Biodivers. 2010;7:536–542. doi: 10.1002/cbdv.200900343. [DOI] [PubMed] [Google Scholar]
  • 155.Morita K, Hasegawa C, Kaneko M, Tsutsumi S, Sone J, Ishikawa T, et al. 2′-O,4′-C-ethylene-bridged nucleic acids (ENA): highly nuclease-resistant and thermodynamically stable oligonucleotides for antisense drug. Bioorg Med Chem Lett. 2002;12:73–76. doi: 10.1016/S0960-894X(01)00683-7. [DOI] [PubMed] [Google Scholar]
  • 156.Pallan PS, Allerson CR, Berdeja A, Seth PP, Swayze EE, Prakash TP, et al. Structure and nuclease resistance of 2′,4′-constrained 2′-O-methoxyethyl (cMOE) and 2′-O-ethyl (cEt) modified DNAs. Chem Commun. 2012;48:8195–8197. doi: 10.1039/c2cc32286b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157.Liu LS, Leung HM, Tam DY, Lo TW, Wong SW, Lo PK. α-l-Threose nucleic acids as biocompatible antisense oligonucleotides for suppressing gene expression in living cells. ACS Appl Mater Interfaces. 2018;10:9736–9743. doi: 10.1021/acsami.8b01180. [DOI] [PubMed] [Google Scholar]
  • 158.Le BT, Chen S, Abramov M, Herdewijn P, Veedu RN. Evaluation of anhydrohexitol nucleic acid, cyclohexenyl nucleic acid and d-altritol nucleic acid-modified 2′-O-methyl RNA mixmer antisense oligonucleotides for exon skipping in vitro. Chem Commun. 2016;52:13467–13470. doi: 10.1039/C6CC07447B. [DOI] [PubMed] [Google Scholar]
  • 159.Relizani K, Griffith G, Echevarría L, Zarrouki F, Facchinetti P, Vaillend C, et al. Efficacy and safety profile of tricyclo-DNA antisense oligonucleotides in Duchenne muscular dystrophy mouse model. Mol Ther Nucleic Acids. 2017;8:144–157. doi: 10.1016/j.omtn.2017.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 160.Evéquoz D, Leumann CJ. Probing the backbone topology of DNA: Synthesis and properties of 7′,5′-bicyclo-DNA. Chemistry. 2017;23:7953–7968. doi: 10.1002/chem.201700435. [DOI] [PubMed] [Google Scholar]
  • 161.Evéquoz D, Verhaart IEC, van de Vijver D, Renner W, Aartsma-Rus A, Leumann CJ. 7′,5′-Alpha-bicyclo-DNA: new chemistry for oligonucleotide exon splicing modulation therapy. Nucleic Acids Res. 2021;49:12089–12105. doi: 10.1093/nar/gkab1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 162.Altona C, Sundaralingam M. Conformational analysis of the sugar ring in nucleosides and nucleotides. A new description using the concept of pseudorotation. J Am Chem Soc. 1972;94:8205–8212. doi: 10.1021/ja00778a043. [DOI] [PubMed] [Google Scholar]
  • 163.Manoharan M. 2′-Carbohydrate modifications in antisense oligonucleotide therapy: importance of conformation, configuration and conjugation. Biochim Biophys Acta. 1999;1489:117–130. doi: 10.1016/S0167-4781(99)00138-4. [DOI] [PubMed] [Google Scholar]
  • 164.Southwell AL, Skotte NH, Bennett CF, Hayden MR. Antisense oligonucleotide therapeutics for inherited neurodegenerative diseases. Trends Mol Med. 2012;18:634–643. doi: 10.1016/j.molmed.2012.09.001. [DOI] [PubMed] [Google Scholar]
  • 165.Shen W, De Hoyos CL, Sun H, Vickers TA, Liang XH, Crooke ST. Acute hepatotoxicity of 2 fluoro-modified 5–10–5 gapmer phosphorothioate oligonucleotides in mice correlates with intracellular protein binding and the loss of DBHS proteins. Nucleic Acids Res. 2018;46:2204–2217. doi: 10.1093/nar/gky060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 166.Veedu RN, Wengel J. Locked nucleic acid nucleoside triphosphates and polymerases: on the way towards evolution of LNA aptamers. Mol Biosyst. 2009;5:787–792. doi: 10.1039/b905513b. [DOI] [PubMed] [Google Scholar]
  • 167.Campbell MA, Wengel J. Locked vs. unlocked nucleic acids (LNA vs. UNA): contrasting structures work towards common therapeutic goals. Chem Soc Rev. 2011;40:5680–5689. doi: 10.1039/c1cs15048k. [DOI] [PubMed] [Google Scholar]
  • 168.Petersen M, Bondensgaard K, Wengel J, Jacobsen JP. Locked nucleic acid (LNA) recognition of RNA: NMR solution structures of LNA:RNA hybrids. J Am Chem Soc. 2002;124:5974–5982. doi: 10.1021/ja012288d. [DOI] [PubMed] [Google Scholar]
  • 169.Nielsen KE, Spielmann HP. The structure of a mixed LNA/DNA:RNA duplex is driven by conformational coupling between LNA and deoxyribose residues as determined from 13C relaxation measurements. J Am Chem Soc. 2005;127:15273–15282. doi: 10.1021/ja051026z. [DOI] [PubMed] [Google Scholar]
  • 170.Straarup EM, Fisker N, Hedtjärn M, Lindholm MW, Rosenbohm C, Aarup V, et al. Short locked nucleic acid antisense oligonucleotides potently reduce apolipoprotein B mRNA and serum cholesterol in mice and non-human primates. Nucleic Acids Res. 2010;38:7100–7111. doi: 10.1093/nar/gkq457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 171.Seth PP, Siwkowski A, Allerson CR, Vasquez G, Lee S, Prakash TP, et al. Design, synthesis and evaluation of constrained methoxyethyl (cMOE) and constrained ethyl (cEt) nucleoside analogs. Nucleic Acids Symp Ser. 2008;52:553–554. doi: 10.1093/nass/nrn280. [DOI] [PubMed] [Google Scholar]
  • 172.Simões-Wüst AP, Hopkins-Donaldson S, Sigrist B, Belyanskaya L, Stahel RA, Zangemeister-Wittke U. A functionally improved locked nucleic acid antisense oligonucleotide inhibits Bcl-2 and Bcl-xL expression and facilitates tumor cell apoptosis. Oligonucleotides. 2004;14:199–209. doi: 10.1089/1545457042258297. [DOI] [PubMed] [Google Scholar]
  • 173.Swayze EE, Siwkowski AM, Wancewicz EV, Migawa MT, Wyrzykiewicz TK, Hung G, et al. Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals. Nucleic Acids Res. 2007;35:687–700. doi: 10.1093/nar/gkl1071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 174.Burel SA, Hart CE, Cauntay P, Hsiao J, Machemer T, Katz M, et al. Hepatotoxicity of high affinity gapmer antisense oligonucleotides is mediated by RNase H1 dependent promiscuous reduction of very long pre-mRNA transcripts. Nucleic Acids Res. 2016;44:2093–2109. doi: 10.1093/nar/gkv1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 175.Khvorova A, Watts JK. The chemical evolution of oligonucleotide therapies of clinical utility. Nat Biotechnol. 2017;35:238–248. doi: 10.1038/nbt.3765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 176.Goyenvalle A, Griffith G, Babbs A, El Andaloussi S, Ezzat K, Avril A, et al. Functional correction in mouse models of muscular dystrophy using exon-skipping tricyclo-DNA oligomers. Nat Med. 2015;21:270–275. doi: 10.1038/nm.3765. [DOI] [PubMed] [Google Scholar]
  • 177.Aung-Htut MT, McIntosh CS, West KA, Fletcher S, Wilton SD. In vitro validation of phosphorodiamidate morpholino oligomers. Molecules. 2019;24:2922. doi: 10.3390/molecules24162922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 178.Gupta A, Mishra A, Puri N. Peptide nucleic acids: advanced tools for biomedical applications. J Biotechnol. 2017;259:148–159. doi: 10.1016/j.jbiotec.2017.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 179.Moulton JD, Yan YL. Using morpholinos to control gene expression. Curr Protoc Mol Biol. 2008;83:26. doi: 10.1002/0471142727.mb2608s83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 180.Iversen PL. Phosphorodiamidate morpholino oligomers: favorable properties for sequence-specific gene inactivation. Curr Opin Mol Ther. 2001;3:235–238. [PubMed] [Google Scholar]
  • 181.Egholm M, Buchardt O, Christensen L, Behrens C, Freier SM, Driver DA, et al. PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules. Nature. 1993;365:566–568. doi: 10.1038/365566a0. [DOI] [PubMed] [Google Scholar]
  • 182.Nielsen PE, Egholm M, Berg RH, Buchardt O. Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science. 1991;254:1497–1500. doi: 10.1126/science.1962210. [DOI] [PubMed] [Google Scholar]
  • 183.Pellestor F, Paulasova P. The peptide nucleic acids (PNAs), powerful tools for molecular genetics and cytogenetics. Eur J Hum Genet. 2004;12:694–700. doi: 10.1038/sj.ejhg.5201226. [DOI] [PubMed] [Google Scholar]
  • 184.Summerton J, Weller D. Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev. 1997;7:187–195. doi: 10.1089/oli.1.1997.7.187. [DOI] [PubMed] [Google Scholar]
  • 185.Sanghvi YS, Hoke GD, Freier SM, Zounes MC, Gonzalez C, Cummins L, et al. Antisense oligodeoxynucleotides: synthesis, biophysical and biological evaluation of oligodeoxynucleotides containing modified pyrimidines. Nucleic Acids Res. 1993;21:3197–3203. doi: 10.1093/nar/21.14.3197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 186.Herdewijn P. Heterocyclic modifications of oligonucleotides and antisense technology. Antisense Nucleic Acid Drug Dev. 2000;10:297–310. doi: 10.1089/108729000421475. [DOI] [PubMed] [Google Scholar]
  • 187.Sharma PK, Kumar P, Nielsen P. Double-headed nucleotides: Building blocks for new nucleic acid architectures. Aust J Chem. 2016;69:1094–1101. doi: 10.1071/CH16021. [DOI] [Google Scholar]
  • 188.Tran P, Weldemichael T, Liu Z, Li HY. Delivery of oligonucleotides: Efficiency with lipid conjugation and clinical outcome. Pharmaceutics. 2022;14:342. doi: 10.3390/pharmaceutics14020342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 189.Copolovici DM, Langel K, Eriste E, Langel Ü. Cell-penetrating peptides: design, synthesis, and applications. ACS Nano. 2014;8:1972–1994. doi: 10.1021/nn4057269. [DOI] [PubMed] [Google Scholar]
  • 190.Arnold AE, Malek-Adamian E, Le PU, Meng A, Martínez-Montero S, Petrecca K, et al. Antibody-antisense oligonucleotide conjugate downregulates a key gene in glioblastoma stem cells. Mol Ther Nucleic Acids. 2018;11:518–527. doi: 10.1016/j.omtn.2018.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 191.Ni S, Zhuo Z, Pan Y, Yu Y, Li F, Liu J, et al. Recent progress in aptamer discoveries and modifications for therapeutic applications. ACS Appl Mater Interfaces. 2021;13:9500–9519. doi: 10.1021/acsami.0c05750. [DOI] [PubMed] [Google Scholar]
  • 192.Prakash TP, Graham MJ, Yu J, Carty R, Low A, Chappell A, et al. Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice. Nucleic Acids Res. 2014;43:8796–8807. doi: 10.1093/nar/gku531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 193.Huang S, Hao XY, Li YJ, Wu JY, Xiang DX, Luo S. Nonviral delivery systems for antisense oligonucleotide therapeutics. Biomater Res. 2022;26:49. doi: 10.1186/s40824-022-00292-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194.Godfrey C, Desviat LR, Smedsrød B, Piétri-Rouxel F, Denti MA, Disterer P, et al. Delivery is key: lessons learnt from developing splice-switching antisense therapies. EMBO Mol Med. 2017;9:545–557. doi: 10.15252/emmm.201607199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 195.Gupta R, Salave S, Rana D, Karunakaran B, Butreddy A, Benival D, et al. Versatility of liposomes for antisense oligonucleotide delivery: a special focus on various therapeutic areas. Pharmaceutics. 2023;15:1435. doi: 10.3390/pharmaceutics15051435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 196.Lysik MA, Wu-Pong S. Innovations in oligonucleotide drug delivery. J Pharm Sci. 2003;92:1559–1573. doi: 10.1002/jps.10399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 197.Yu B, Zhao X, Lee LJ, Lee RJ. Targeted delivery systems for oligonucleotide therapeutics. AAPS J. 2009;11:195–203. doi: 10.1208/s12248-009-9096-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 198.Wu L, Zhou W, Lin L, Chen A, Feng J, Qu X, et al. Delivery of therapeutic oligonucleotides in nanoscale. Bioact Mater. 2021;7:292–323. doi: 10.1016/j.bioactmat.2021.05.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 199.Asami Y, Yoshioka K, Nishina K, Nagata T, Yokota T. Drug delivery system of therapeutic oligonucleotides. Drug Discov Ther. 2016;10:256–262. doi: 10.5582/ddt.2016.01065. [DOI] [PubMed] [Google Scholar]
  • 200.Bost JP, Barriga H, Holme MN, Gallud A, Maugeri M, Gupta D, et al. Delivery of oligonucleotide therapeutics: chemical modifications, lipid nanoparticles, and extracellular vesicles. ACS Nano. 2021;15:13993–14021. doi: 10.1021/acsnano.1c05099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 201.Anwar S, Mir F, Yokota T. Enhancing the effectiveness of oligonucleotide therapeutics using cell-penetrating peptide conjugation, chemical modification, and carrier-based delivery strategies. Pharmaceutics. 2023;15:1130. doi: 10.3390/pharmaceutics15041130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 202.Sharma VK, Watts JK. Oligonucleotide therapeutics: chemistry, delivery and clinical progress. Future Med Chem. 2015;7:2221–2242. doi: 10.4155/fmc.15.144. [DOI] [PubMed] [Google Scholar]
  • 203.Inoue H, Hayase Y, Imura A, Iwai S, Miura K, Ohtsuka E. Synthesis and hybridization studies on two complementary nona(2′-O-methyl)ribonucleotides. Nucleic Acids Res. 1987;15:6131–6148. doi: 10.1093/nar/15.15.6131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 204.Malchère C, Verheijen J, van der Laan S, Bastide L, van Boom J, Lebleu B, et al. A short phosphodiester window is sufficient to direct RNase H-dependent RNA cleavage by antisense peptide nucleic acid. Antisense Nucleic Acid Drug Dev. 2000;10:463–468. doi: 10.1089/oli.1.2000.10.463. [DOI] [PubMed] [Google Scholar]
  • 205.Kuespert S, Heydn R, Peters S, Wirkert E, Meyer AL, Siebörger M, et al. Antisense oligonucleotide in LNA-gapmer design targeting TGFBR2-A key single gene target for safe and effective inhibition of TGFβ signaling. Int J Mol Sci. 2020;21:1952. doi: 10.3390/ijms21061952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 206.Chen S, Le BT, Rahimizadeh K, Shaikh K, Mohal N, Veedu RN. Synthesis of a morpholino nucleic acid (MNA)-uridine phosphoramidite, and exon skipping using MNA/2'-O-methyl mixmer antisense oligonucleotide. Molecules. 2016;21:1582. doi: 10.3390/molecules21111582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 207.Le BT, Paul S, Jastrzebska K, Langer H, Caruthers MH, Veedu RN. Thiomorpholino oligonucleotides as a robust class of next generation platforms for alternate mRNA splicing. Proc Natl Acad Sci USA. 2022;119:e2207956119. doi: 10.1073/pnas.2207956119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 208.Le BT, Adams AM, Fletcher S, Wilton SD, Veedu RN. Rational design of short locked nucleic acid-modified 2′-O-methyl antisense oligonucleotides for efficient exon-skipping in vitro. Mol Ther Nucleic Acids. 2017;9:155–161. doi: 10.1016/j.omtn.2017.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 209.Geary RS, Watanabe TA, Truong L, Freier S, Lesnik EA, Sioufi NB, et al. Pharmacokinetic properties of 2′-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J Pharmacol Exp Ther. 2001;296:890–897. [PubMed] [Google Scholar]
  • 210.Sheth J, Mistri M, Bhavsar R, Pancholi D, Kamate M, Gupta N, et al. Batten disease: biochemical and molecular characterization revealing novel PPT1 and TPP1 gene mutations in Indian patients. BMC Neurol. 2018;18:203. doi: 10.1186/s12883-018-1206-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 211.Kim WD, Wilson-Smillie MLDM, Thanabalasingam A, Lefrancois S, Cotman SL, Huber RJ. Autophagy in the neuronal ceroid lipofuscinoses (Batten disease) Front Cell Dev Biol. 2022;10:812728. doi: 10.3389/fcell.2022.812728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 212.Centa JL, Jodelka FM, Hinrich AJ, Johnson TB, Ochaba J, Jackson M, et al. Therapeutic efficacy of antisense oligonucleotides in mouse models of CLN3 Batten disease. Nat Med. 2020;26:1444–1451. doi: 10.1038/s41591-020-0986-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 213.Tang C, Han J, Dalvi S, Manian K, Winschel L, Volland S, et al. A human model of Batten disease shows role of CLN3 in phagocytosis at the photoreceptor–RPE interface. Commun Biol. 2021;4:161. doi: 10.1038/s42003-021-01682-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 214.Goina E, Peruzzo P, Bembi B, Dardis A, Buratti E. Glycogen reduction in myotubes of late-onset Pompe disease patients using antisense technology. Mol Ther. 2017;25:2117–2128. doi: 10.1016/j.ymthe.2017.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 215.van der Wal E, Bergsma AJ, Pijnenburg JM, van der Ploeg AT, Pijnappel WWMP. Antisense oligonucleotides promote exon inclusion and correct the common c.-32-13T>G GAA splicing variant in Pompe disease. Mol Ther Nucleic Acids. 2017;7:90–100. doi: 10.1016/j.omtn.2017.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 216.van der Wal E, Bergsma AJ, van Gestel TJM, In ‘t Groen SLM, Zaehres H, Araúzo-Bravo MJ, et al. GAA deficiency in Pompe disease is alleviated by exon inclusion in iPSC-derived skeletal muscle cells. Mol Ther Nucleic Acids. 2017;7:101–115. doi: 10.1016/j.omtn.2017.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 217.Aung-Htut MT, Ham KA, Tchan M, Johnsen R, Schnell FJ, Fletcher S, et al. Splice modulating antisense oligonucleotides restore some acid-alpha-glucosidase activity in cells derived from patients with late-onset Pompe disease. Sci Rep. 2020;10:6702. doi: 10.1038/s41598-020-63461-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 218.Germain DP. Fabry disease. Orphanet J Rare Dis. 2010;5:30. doi: 10.1186/1750-1172-5-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 219.Palhais B, Dembic M, Sabaratnam R, Nielsen KS, Doktor TK, Bruun GH, et al. The prevalent deep intronic c. 639+919 G>A GLA mutation causes pseudoexon activation and Fabry disease by abolishing the binding of hnRNPA1 and hnRNP A2/B1 to a splicing silencer. Mol Genet Metab. 2016;119:258–269. doi: 10.1016/j.ymgme.2016.08.007. [DOI] [PubMed] [Google Scholar]
  • 220.Edmiston R, Wilkinson S, Jones S, Tylee K, Broomfield A, Bruce IA. I-cell disease (Mucolipidosis II): a case series from a tertiary paediatric centre reviewing the airway and respiratory consequences of the disease. JIMD Rep. 2019;45:1–8. doi: 10.1007/8904_2018_130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 221.Matos L, Vilela R, Rocha M, Santos JI, Coutinho MF, Gaspar P, et al. Development of an antisense oligonucleotide-mediated exon skipping therapeutic strategy for Mucolipidosis II: validation at RNA level. Hum Gene Ther. 2020;31:775–783. doi: 10.1089/hum.2020.034. [DOI] [PubMed] [Google Scholar]
  • 222.Muenzer J, Beck M, Eng CM, Escolar ML, Giugliani R, Guffon NH, et al. Multidisciplinary management of Hunter syndrome. Pediatrics. 2009;124:e1228–e1239. doi: 10.1542/peds.2008-0999. [DOI] [PubMed] [Google Scholar]
  • 223.Matos L, Gonçalves V, Pinto E, Laranjeira F, Prata MJ, Jordan P, et al. Functional analysis of splicing mutations in the IDS gene and the use of antisense oligonucleotides to exploit an alternative therapy for MPS II. Biochim Biophys Acta. 2015;1852:2712–2721. doi: 10.1016/j.bbadis.2015.09.011. [DOI] [PubMed] [Google Scholar]
  • 224.Matos L, Gonçalves V, Pinto E, Laranjeira F, Prata MJ, Jordan P, et al. Data in support of a functional analysis of splicing mutations in the IDS gene and the use of antisense oligonucleotides to exploit an alternative therapy for MPS II. Data Brief. 2015;5:810–817. doi: 10.1016/j.dib.2015.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 225.Aldubayan SH, Rodan LH, Berry GT, Levy HL. Acute illness protocol for organic acidemias: methylmalonic acidemia and propionic acidemia. Pediatr Emerg Care. 2017;33:142–146. doi: 10.1097/PEC.0000000000001028. [DOI] [PubMed] [Google Scholar]
  • 226.Rincón A, Aguado C, Desviat LR, Sánchez-Alcudia R, Ugarte M, Pérez B. Propionic and methylmalonic acidemia: antisense therapeutics for intronic variations causing aberrantly spliced messenger RNA. Am J Hum Genet. 2007;81:1262–1270. doi: 10.1086/522376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 227.Pérez B, Rincón A, Jorge-Finnigan A, Richard E, Merinero B, Ugarte M, et al. Pseudoexon exclusion by antisense therapy in methylmalonic aciduria (MMAuria) Hum Mutat. 2009;30:1676–1682. doi: 10.1002/humu.21118. [DOI] [PubMed] [Google Scholar]
  • 228.Lim KH, Han Z, Jeon HY, Kach J, Jing E, Weyn-Vanhentenryck S, et al. Antisense oligonucleotide modulation of non-productive alternative splicing upregulates gene expression. Nat Commun. 2020;11:3501. doi: 10.1038/s41467-020-17093-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 229.Chang IJ, He M, Lam CT. Congenital disorders of glycosylation. Ann Transl Med. 2018;6:477. doi: 10.21037/atm.2018.10.45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 230.Wilson MP, Matthijs G. The evolving genetic landscape of congenital disorders of glycosylation. Biochim Biophys Acta Gen Subj. 2021;1865:129976. doi: 10.1016/j.bbagen.2021.129976. [DOI] [PubMed] [Google Scholar]
  • 231.Vega AI, Pérez-Cerdá C, Desviat LR, Matthijs G, Ugarte M, Pérez B. Functional analysis of three splicing mutations identified in the PMM2 gene: toward a new therapy for congenital disorder of glycosylation type Ia. Hum Mutat. 2009;30:795–803. doi: 10.1002/humu.20960. [DOI] [PubMed] [Google Scholar]
  • 232.Yuste-Checa P, Medrano C, Gámez A, Desviat LR, Matthijs G, Ugarte M, et al. Antisense-mediated therapeutic pseudoexon skipping in TMEM165-CDG. Clin Genet. 2015;87:42–48. doi: 10.1111/cge.12402. [DOI] [PubMed] [Google Scholar]
  • 233.Sanaker PS, Toompuu M, McClorey G, Bindoff LA. Antisense oligonucleotide corrects splice abnormality in hereditary myopathy with lactic acidosis. Gene. 2012;494:231–236. doi: 10.1016/j.gene.2011.11.021. [DOI] [PubMed] [Google Scholar]
  • 234.Kollberg G, Holme E. Antisense oligonucleotide therapeutics for iron-sulphur cluster deficiency myopathy. Neuromuscul Disord. 2009;19:833–836. doi: 10.1016/j.nmd.2009.09.011. [DOI] [PubMed] [Google Scholar]
  • 235.Holmes-Hampton GP, Crooks DR, Haller RG, Guo S, Freier SM, Monia BP, et al. Use of antisense oligonucleotides to correct the splicing error in ISCU myopathy patient cell lines. Hum Mol Genet. 2016;25:5178–5187. doi: 10.1093/hmg/ddw338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 236.Chen A, Pan Y, Chen J. Clinical, genetic, and experimental research of hyperphenylalaninemia. Front Genet. 2023;13:1051153. doi: 10.3389/fgene.2022.1051153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 237.Brasil S, Viecelli HM, Meili D, Rassi A, Desviat LR, Pérez B, et al. Pseudoexon exclusion by antisense therapy in 6-pyruvoyl-tetrahydropterin synthase deficiency. Hum Mutat. 2011;32:1019–1027. doi: 10.1002/humu.21529. [DOI] [PubMed] [Google Scholar]
  • 238.Martínez-Pizarro A, Leal F, Holm LL, Doktor TK, Petersen USS, Bueno M, et al. Antisense oligonucleotide rescue of deep-intronic variants activating pseudoexons in the 6-pyruvoyl-tetrahydropterin synthase gene. Nucleic Acid Ther. 2022;32:378–390. doi: 10.1089/nat.2021.0066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 239.Lecha M, Puy H, Deybach JC. Erythropoietic protoporphyria. Orphanet J Rare Dis. 2009;4:19. doi: 10.1186/1750-1172-4-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 240.Oustric V, Manceau H, Ducamp S, Soaid R, Karim Z, Schmitt C, et al. Antisense oligonucleotide-based therapy in human erythropoietic protoporphyria. Am J Hum Genet. 2014;94:611–617. doi: 10.1016/j.ajhg.2014.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 241.Gerrard A, Dawson C. Homocystinuria diagnosis and management: it is not all classical. J Clin Pathol. 2022;75:744–750. doi: 10.1136/jcp-2021-208029. [DOI] [PubMed] [Google Scholar]
  • 242.Palhais B, Præstegaard VS, Sabaratnam R, Doktor TK, Lutz S, Burda P, et al. Splice-shifting oligonucleotide (SSO) mediated blocking of an exonic splicing enhancer (ESE) created by the prevalent c.903+469T>C MTRR mutation corrects splicing and restores enzyme activity in patient cells. Nucleic Acids Res. 2015;43:4627–4639. doi: 10.1093/nar/gkv275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 243.Williams K, Skrobanski H, Buesch K, Acaster S. Symptoms and impacts of aromatic l-amino acid decarboxylase (AADC) deficiency among individuals with different levels of motor function. Orphanet J Rare Dis. 2022;17:128. doi: 10.1186/s13023-022-02274-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 244.Tsai CR, Lee HF, Chi CS, Yang MT, Hsu CC. Antisense oligonucleotides modulate dopa decarboxylase function in aromatic l-amino acid decarboxylase deficiency. Hum Mutat. 2018;39:2072–2082. doi: 10.1002/humu.23659. [DOI] [PubMed] [Google Scholar]
  • 245.Raal FJ, Santos RD, Blom DJ, Marais AD, Charng MJ, Cromwell WC, et al. Mipomersen, an apolipoprotein B synthesis inhibitor, for lowering of LDL cholesterol concentrations in patients with homozygous familial hypercholesterolaemia: a randomised, double-blind, placebo-controlled trial. Lancet. 2010;375:998–1006. doi: 10.1016/S0140-6736(10)60284-X. [DOI] [PubMed] [Google Scholar]
  • 246.McGowan MP, Tardif JC, Ceska R, Burgess LJ, Soran H, Gouni-Berthold I, et al. Randomized, placebo-controlled trial of mipomersen in patients with severe hypercholesterolemia receiving maximally tolerated lipid-lowering therapy. PLoS One. 2012;7:e49006. doi: 10.1371/journal.pone.0049006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 247.Stein EA, Dufour R, Gagne C, Gaudet D, East C, Donovan JM, et al. Apolipoprotein B synthesis inhibition with mipomersen in heterozygous familial hypercholesterolemia: results of a randomized, double-blind, placebo-controlled trial to assess efficacy and safety as add-on therapy in patients with coronary artery disease. Circulation. 2012;126:2283–2292. doi: 10.1161/CIRCULATIONAHA.112.104125. [DOI] [PubMed] [Google Scholar]
  • 248.Mearns BM. Dyslipidemia: phase III trial of mipomersen in heterozygous FH. Nat Rev Cardiol. 2012;9:674. doi: 10.1038/nrcardio.2012.151. [DOI] [PubMed] [Google Scholar]
  • 249.Kastelein JJ, Wedel MK, Baker BF, Su J, Bradley JD, Yu RZ, et al. Potent reduction of apolipoprotein B and low-density lipoprotein cholesterol by short-term administration of an antisense inhibitor of apolipoprotein B. Circulation. 2006;114:1729–1735. doi: 10.1161/CIRCULATIONAHA.105.606442. [DOI] [PubMed] [Google Scholar]
  • 250.Akdim F, Tribble DL, Flaim JD, Yu R, Su J, Geary RS, et al. Efficacy of apolipoprotein B synthesis inhibition in subjects with mild-to-moderate hyperlipidaemia. Eur Heart J. 2011;32:2650–2659. doi: 10.1093/eurheartj/ehr148. [DOI] [PubMed] [Google Scholar]
  • 251.Yu RZ, Geary RS, Flaim JD, Riley GC, Tribble DL, vanVliet AA, et al. Lack of pharmacokinetic interaction of mipomersen sodium (ISIS 301012), a 2′-O-methoxyethyl modified antisense oligonucleotide targeting apolipoprotein B-100 messenger RNA, with simvastatin and ezetimibe. Clin Pharmacokinet. 2009;48:39–50. doi: 10.2165/0003088-200948010-00003. [DOI] [PubMed] [Google Scholar]
  • 252.Yu RZ, Kim TW, Hong A, Watanabe TA, Gaus HJ, Geary RS. Cross-species pharmacokinetic comparison from mouse to man of a second-generation antisense oligonucleotide, ISIS 301012, targeting human apolipoprotein B-100. Drug Metab Dispos. 2007;35:460–468. doi: 10.1124/dmd.106.012401. [DOI] [PubMed] [Google Scholar]
  • 253.Ito K, Tajima G, Kamisato C, Tsumura M, Iwamoto M, Sekiguchi Y, et al. A splice-switching oligonucleotide treatment ameliorates glycogen storage disease type 1a in mice with G6PC c.648G>T. J Clin Investig. 2023;133:e163464. doi: 10.1172/JCI163464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 254.Clayton NP, Nelson CA, Weeden T, Taylor KM, Moreland RJ, Scheule RK, et al. Antisense oligonucleotide-mediated suppression of muscle glycogen synthase 1 synthesis as an approach for substrate reduction therapy of Pompe disease. Mol Ther Nucleic Acids. 2014;3:e206. doi: 10.1038/mtna.2014.57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 255.Bergsma AJ, In ‘t Groen SL, Verheijen FW, van der Ploeg AT, Pijnappel WWMP. From cryptic toward canonical pre-mRNA splicing in Pompe disease: a pipeline for the development of antisense oligonucleotides. Mol Ther Nucleic Acids. 2016;5:e361. doi: 10.1038/mtna.2016.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 256.Rodríguez-Pascau L, Coll MJ, Vilageliu L, Grinberg D. Antisense oligonucleotide treatment for a pseudoexon-generating mutation in the NPC1 gene causing Niemann-Pick type C disease. Hum Mutat. 2009;30:E993–E1001. doi: 10.1002/humu.21119. [DOI] [PubMed] [Google Scholar]
  • 257.Belanger AM, Przybylska M, Gefteas E, Furgerson M, Geller S, Kloss A, et al. Inhibiting neutral amino acid transport for the treatment of phenylketonuria. JCI Insight. 2018;3:e121762. doi: 10.1172/jci.insight.121762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 258.Hull V, Wang Y, Burns T, Zhang S, Sternbach S, McDonough J, et al. Antisense oligonucleotide reverses leukodystrophy in Canavan disease mice. Ann Neurol. 2020;87:480–485. doi: 10.1002/ana.25674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 259.Cossu M, Pintus R, Zaffanello M, Mussap M, Serra F, Marcialis MA, et al. Metabolomic studies in inborn errors of metabolism: last years and future perspectives. Metabolites. 2023;13:447. doi: 10.3390/metabo13030447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 260.Adams AM, Harding PL, Iversen PL, Coleman C, Fletcher S, Wilton SD. Antisense oligonucleotide induced exon skipping and the dystrophin gene transcript: cocktails and chemistries. BMC Mol Biol. 2007;8:57. doi: 10.1186/1471-2199-8-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 261.McCampbell A, Cole T, Wegener AJ, Tomassy GS, Setnicka A, Farley BJ, et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J Clin Investig. 2018;128:3558–3567. doi: 10.1172/JCI99081. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Biodrugs are provided here courtesy of Springer

RESOURCES