Abstract
PpLSU3, a mobile group I intron in the rRNA genes of Physarum polycephalum, also can home into yeast chromosomal ribosomal DNA (rDNA) (D. E. Muscarella and V. M. Vogt, Mol. Cell. Biol. 13:1023–1033, 1993). By integrating PpLSU3 into the rDNA copies of a yeast strain temperature sensitive for RNA polymerase I, we have shown that the I-PpoI homing endonuclease encoded by PpLSU3 is expressed from an RNA polymerase I transcript. We have also developed a method to integrate mutant forms of PpLSU3 as well as the Tetrahymena intron TtLSU1 into rDNA, by expressing I-PpoI in trans. Analysis of I-PpoI expression levels in these mutants, along with subcellular fractionation of intron RNA, strongly suggests that the full-length excised intron RNA, but not RNAs that are further cleaved, serves as or gives rise to the mRNA.
Group I introns are a class of RNA elements that share a secondary structure which allows the intron to undergo self-splicing from the primary transcript (5). While most group I introns are located in the genes of mitochondria and chloroplasts of lower eucaryotes, some are found in nuclear genes. Interestingly, nuclear group I introns reside only in rDNA, the gene encoding rRNA, and when present they occupy all of the ca. 200 rDNA copies typical of eucaryotic organisms. Some group I introns are mobile genetic elements. They encode a site-specific endonuclease that recognizes and cleaves a DNA sequence at or near the intron insertion site of the intron-lacking allele. The double-strand break is then repaired by replication of the intron into the intron-lacking allele, thus converting all intron-lacking alleles into intron-containing alleles. This process is termed intron homing due to its high specificity (3).
Among the ca. 150 nuclear group I introns reported so far, only three have been shown or have been inferred to be mobile: DiSSU1 from the slime mold Didymium iridis (6, 21, 22), NaSSU1 from the protist Naegleria andersoni and other Naegleria species (8), and PpLSU3 from the slime mold Physarum polycephalum. Originally found in the large-subunit rDNA gene of the Carolina strain (29), PpLSU3 contains the open reading frame (ORF) for the homing endonuclease I-PpoI (for nomenclature of intron-encoded endonucleases, see reference 7) in its 5′ half and the ribozyme part in its 3′ half. The sequence of the ribozyme part of PpLSU3 is 70% identical to the Tetrahymena thermophila intron TtLSU1, which is inserted at the same location as PpLSU3, suggesting a common evolutionary origin. Previous work has shown that PpLSU3 RNA not only undergoes self-splicing but also cleaves itself at an internal processing site (IPS), thus separating the I-PpoI ORF and the ribozyme (38). I-PpoI recognizes a 13- to 15-bp DNA sequence in a portion of the large-subunit rRNA gene that is 100% identical in all eucaryotes (9, 52). When a plasmid-borne PpLSU3 is transformed into Saccharomyces cerevisiae, most cells die upon the induction of I-PpoI expression, because I-PpoI makes double-strand breaks in the ca. 120 rDNA repeats on chromosome XII. Of the cells that survive, most do so because of disruption of the cleavage site in all rDNA copies, due either to acquisition of point mutations at the cleavage site or to homing of PpLSU3 into this site (30). Homing of PpLSU3 into yeast rDNA provides a unique experimental system with which to study PpLSU3 and I-PpoI expression in vivo.
In all known eucaryotes, protein-encoding genes are known to be transcribed only by RNA polymerase II (pol II). The repeated genes for three of the four rRNAs are transcribed by pol I, giving rise to a pre-rRNA that is further processed to yield mature 28S, 5.8S, and 18S rRNAs (reviewed in reference 33). A few attempts have been made to express protein under the pol I promoter control on a plasmid. In some cases, a cryptic pol II promoter nearby on the plasmid was utilized to make the mRNA, thus complicating the interpretation of the data (25). In cases where protein synthesis was attributed to the pol I-made transcript, the expression level was much lower than that from a pol II transcript (11, 15, 44). Low expression is probably due to the fact that the pol I transcript lacks a 5′ cap and a 3′ poly(A) tail, which are important for export, stabilization, and efficient translation of mRNAs (reviewed in reference 18). Recently, Lo et al. (24) reported that the HIS4 RNA synthesized from the pol I promoter is uncapped but does have a poly(A) tail at its 3′ end. The pol I-made HIS4 RNA is both unstable and translated inefficiently, giving rise to 3% as much HIS4 protein as the HIS4 mRNA transcribed by pol II from the wild-type gene (24). Pol I is not absolutely required for the expression of rRNA. Nogi et al. have demonstrated that transcription of the 35S rDNA from the GAL7 promoter on a plasmid can provide the sole source of rRNA in a pol I temperature-sensitive (ts) yeast strain (31, 32). Furthermore, functional rRNA can be synthesized from separate 18S and 5.8S/28S transcriptional units driven by the GAL7 promoter (23).
The endonucleases encoded by the three mobile nuclear group I introns constitute a unique example of naturally occurring protein expression from the rDNA gene. Interestingly, these endonucleases (I-PpoI, I-DirI, and I-NanI) also comprise a distinct family based on a common sequence motif of 30 amino acids containing histidine and cysteine residues (20). I-PpoI is the only member of this group for which a genetic system is readily available to study how the endonuclease is expressed from the rDNA gene. In this study, we sought to answer two questions about the expression of I-PpoI. First, is pol I actually responsible for the synthesis of the mRNA for I-PpoI, as might be surmised from the location of the intron in rDNA? A ts pol I strain carrying PpLSU3 in chromosomal rDNA showed no I-PpoI activity at the nonpermissive temperature, directly implicating this RNA polymerase in endonuclease expression. Second, is the mRNA for I-PpoI the full-length excised intron RNA or the processed 5′ half intron RNA? A PpLSU3 mutant with greatly reduced levels of the processed 5′ half intron RNA showed increased levels of I-PpoI, strongly suggesting that the full-length intron is, or gives rise to, the mRNA for the endonuclease.
MATERIALS AND METHODS
Protein extraction and endonuclease activity assay.
Yeast cells were grown to an optical density at 600 nm (OD600) of 1.0 to 1.5. Cells from a 5-ml culture were spun down and resuspended in 100 μl of breakage buffer (10% glycerol, 200 mM Tris-HCl [pH 8.0], 10 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride [PMSF]). One hundred microliters of glass beads (425 to 600 μm; Sigma) was added, and the cells were vortexed for 5 min at 4°C. After centrifugation at 4°C for 15 min, the supernatant was used as crude protein extract. Physarum microplasmodia were grown in shaking flasks at 26°C in SDM medium (1). For Physarum protein extracts, each gram (wet weight) of Physarum was homogenized in 2 ml of ice-cold buffer F (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 1 mM dithiothreitol [DTT], 0.5 mM PMSF, 10 μM leupeptin, 5% glycerol). The homogenate was centrifuged at 80,000 × g for 90 min. The supernatant was dialyzed at 4°C against buffer G (50 mM Tris-HCl [pH 7.5], 1 mM DTT, 0.5 mM PMSF, 5 μM leupeptin, 10% glycerol) for 24 h. Total protein was quantified with the Bio-Rad protein assay dye reagent kit. The I-PpoI endonuclease activity assay was performed as described previously (9). Plasmid p42 was linearized with AvaII and used as the substrate. Yeast crude protein extract was incubated with 300 ng of linearized p42 in I-PpoI buffer (50 mM Tris-HCl [pH 8.0], 10 mM MgCl2, 50 mM NaCl) at 37°C for 1 h. The reaction was stopped by adding EDTA to a final concentration of 20 mM. Yeast tRNA (25 μg), 1/10 volume of 3 M sodium acetate (NaOAc), and 2 volumes of ethanol were then added to precipitate the DNA. The DNA was resuspended in gel loading buffer (0.05% bromophenol, 0.05% xylene cyanol FF, 6% glycerol) and run on 1.0% agarose gels. For I-PpoI endonuclease activity assays with radiolabeled substrate, primers JL83 (5′TCACCCCGGAATTGGTTTATCC3′) and JL84 (5′CGAATGGGACCTTGAATGC3′) were used to amplify a 950-bp rDNA fragment in the presence of 20 μCi of [α-32P]dATP in a 100-μl PCR. Twenty nanograms of the PCR product was used in a 50-μl I-PpoI endonuclease assay reaction. The reaction also included 4 μg of poly(dI-dC). The DNA was run on a 1.5% agarose gel, and the gel was dried and exposed to film.
Primer extension.
Twenty picomoles of primer JL68 (5′TCTCGCAACATGCACGATGC3′) was end labeled with 20 μCi of [γ-32P]ATP, using T4 polynucleotide kinase (Boehringer Mannheim Corporation). The labeled primer was purified by passing it through a Sephadex G-25 column. The purified primer was precipitated with 20 μg of total RNA from yeast strain INVSc2/I3 and resuspended in reverse transcriptase buffer (Ambion Inc.). The reaction mixture was incubated at 90°C for 5 min and cooled to room temperature to allow annealing. One microliter of 10 mM deoxynucleoside triphosphates, 15 U of Moloney murine leukemia virus reverse transcriptase (Ambion), and 20 U of RNase inhibitor (Boehringer Mannheim) were added. The reaction mixture (20 μl) was incubated at 37°C for 1 h and ethanol precipitated. The product was fractionated on a 8% polyacrylamide-urea gel. Dideoxy sequencing reactions using the same primer and performed with the dsDNA Cycle Sequencing system (GIBCO BRL Life Technologies, Inc.) were run in parallel. The gel was dried and exposed to film.
RNA preparation and Northern blot analysis.
Yeast cells were grown to an OD600 of 1.0 to 1.5. Cells from a 10-ml culture were resuspended in 400 μl of AE buffer (50 mM NaOAc [pH 5.3], 10 mM EDTA [pH 8.0]) and 40 μl of 10% sodium dodecyl sulfate (SDS). An equal volume of phenol (450 μl, equilibrated with AE buffer) was added, and the cells were incubated at 65°C for 4 min. The cells were then snap-frozen in an ethanol-dry ice bath and spun for 6 min. The aqueous phase was extracted with phenol-chloroform (equilibrated with AE buffer) twice. RNA was precipitated by adding 1/10 volume of 3 M NaOAc (pH 5.3) and 2.5 volumes of ethanol to the aqueous phase and resuspended in H2O previously treated with diethylpyrocarbonate.
For RNA extraction from Physarum, microplasmodia were grown in liquid SDM at 26°C (1). RNA was prepared by using TRI Reagent (Molecular Research Center, Inc.) according to the manufacturer’s instructions.
RNA was fractionated on a 5% polyacrylamide–8 M urea gel in 1× Tris-borate-EDTA and transferred by capillary action to a GeneScreen Plus membrane (Du Pont NEN) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). The membrane was prehybridized in 50% formamide–5× SSC–5× Denhardt’s solution–1% SDS–100 μg of sheared salmon DNA per ml at 50°C for 4 h. Antisense RNA probe was synthesized from the T3 or the T7 promoter in the presence of 40 μCi of [α-32P]UTP and added to the prehybridization solution. The membrane was hybridized for 16 to 24 h at 50°C and then consecutively washed with 2× SSC–0.1% SDS, 0.5× SSC–0.1% SDS, and 0.1× SSC–0.1% SDS for 15 min each time at room temperature. For detecting PpLSU3 RNA, plasmid pd55ΔSph-Xho (10) was used to make the riboprobe. Northern blot analysis using formaldehyde-agarose gels and GeneScreen Plus membranes was performed as instructed by the manufacturer (Du Pont NEN).
Plasmid construction.
Plasmids were constructed by standard cloning methods (40). Mutations were introduced by PCR in two steps with the mutations included in the primers (47). Plasmid pCPIPpo was constructed by cloning the EcoRI-SphI fragment from pGal IPpo (30) into the EcoRI and SphI sites of the URA3-based plasmid yCP50 (37). Plasmids pJLI3, pJLI3/IPS1, and pJLI3DIPpo contain PpLSU3 with 170 bp of 5′ yeast rDNA exon sequence and 130 bp of 3′ yeast rDNA exon sequence cloned into the EcoRI and SalI sites of the HIS3-based plasmid pRS423 (43). pJLDIPpo contains two point mutations, at positions 57 and 58 of PpLSU3, to introduce two stop codons. pJLI3IPS1 has mutations at IPS1 changing G/U (the slash indicates the cleavage site) to AA. pJLTtLSU1 was constructed by cloning the EcoRI-HindIII fragment of pSW012 (53) into the EcoRI and SalI sites of pRS423. pJLI3ΔORF was constructed by cloning the EcoRI-SalI fragment of pI3ΔORFTZ (35) into the EcoRI and SalI sites of pRS423. It has the ribozyme part of PpLSU3 with 378 bp of Physarum upstream exon and 24 bp of downstream exon. Plasmid pRSIPpo was constructed by cloning the EcoRI-SphI fragment of pGal IPpo into the LEU2-based plasmid pRS415 (43).
Yeast strains and media.
Yeast strains (Table 1) were grown according to standard procedures (42) in YEPD medium at 30°C. When selection of plasmids was required, cells were grown in synthetic minimal medium supplemented with amino acids. For detection of I-PpoI activity in strain NOY401/I3, cells were transformed with pNOY103R by the lithium acetate method (2). Transformants were streaked on SD or SGal (42) plates and incubated at either 23 or 37°C, and cells were subsequently inoculated into liquid SD or SGal medium to make the protein extracts.
TABLE 1.
Yeast strains used in this study
| Strain | Genotype | Descriptiona | Reference or source |
|---|---|---|---|
| NOY401 | MATarpa190-3 ura3 leu2 trp1 can1 | Pol I ts strain | 31 |
| NOY401/I3 | MATarpa190-3 ura3 leu2 trp1 can1 25S::I3 | Pol I ts strain with PpLSU3 integrated | This study |
| INVSc2 | MATαhis3-Δ200 ura3-167 | Invitrogen | |
| INVSc2/I3 | MATαhis3-Δ200 ura3-167 25S:I3 | PpLSU3 integrated | This study |
| INVSc2/I3ΔORF | MATαhis3-Δ200 ura3-167 25S::I3ΔORF | I3ΔORF integrated | This study |
| INVSc2/TtLSU1 | MATαhis3-Δ200 ura3-167 25S::TtLSU1 | TtLSU1 integrated | This study |
| INVSc2/I3DIPpo | MATαhis3-Δ200 ura3-167 25S::I3DIPpo | I3DIPpo integrated | This study |
| INVSc2/I3IPS1 | MATαhis3-Δ200 ura3-167 25S::I3IPS | I3IPS1 integrated | This study |
In the context used in this report, “integrated” means that the intron is integrated into all copies of the rDNA repeats on chromosome XII.
Transintegration.
Plasmid pCPIPpo and one of the pJL series plasmids were cotransformed into yeast strain INVSc2 (Invitrogen Corporation) by the lithium acetate method (2), and the cells were plated on SD-Ura-His plates. Transformants were streaked on SGal-Ura-His plates to induce the expression of I-PpoI. Single colonies on SGal-Ura-His plates were grown in SGal-Ura-His liquid medium. DNA was extracted from the above culture, and PCR was performed to screen for intron-integrated colonies. Primers JL9 (5′CGTGAATTCAACTTAGAACTGGTACG3′) and JL8 (5′TATATCGATTCTGCCAAGCCCGT3′), which span the PpLSU3 insertion site, were used for this PCR analysis. Cells were cured of plasmids by being grown in liquid YEPD for approximately 10 generations and then plated on YEPD plates. The loss of the plasmids was checked by replicating colonies on YEPD plates onto SD-Ura and SD-His plates.
Subcellular fractionation of yeast.
Subcellular fractionation was performed according to reference 17. Yeast cells were grown to an OD600 of 1.0 to 1.5 in YEPD. Cells from 200 ml of culture were harvested, washed with H2O, and incubated in 10 ml of 100 mM Tris-HCl (pH 9.4)–10 mM DTT at room temperature for 10 min. The cells were spun down and washed in 10 ml of spheroplast buffer (1.2 M sorbitol, 20 mM KPO4 [pH 7.4]). The cells were incubated in 5 ml of spheroplast buffer with 4 mg of Lyticase (Sigma) at 25°C for 20 min. The spheroplasts were centrifuged and resuspended in 5 ml of homogenization buffer (18% Ficoll DL400 [Sigma], 0.5 mM MgCl2, 20 mM KPO4 [pH 6.45]) and homogenized by 10 strokes with a Dounce homogenizer. Five milliliters of sorbitol buffer (2.4 M sorbitol, 0.5 mM MgCl2, 20 mM KPO4 [pH 6.45]) was added to the homogenate. The homogenate was centrifuged at 3,000 rpm for 10 min at 4°C. The supernatant was centrifuged again at 12,000 rpm at 4°C for 25 min. The supernatant from the high-speed centrifugation was frozen on dry ice immediately, and RNA was extracted from it later. The pellet from the 12,000-rpm spin was resuspended in 16.6% Ficoll–0.3 M sucrose–0.5 mM MgCl2–20 mM KPO4 (pH 6.45) and homogenized again by three strokes. The homogenate was spun at 3,000 rpm for 5 min, and the supernatant was loaded on a sucrose step gradient (2.0, 1.8, 1.5, 1.3, and 1.2 M sucrose in 0.5 mM MgCl2–20 mM KPO4 [pH 6.45]). The gradient was spun in an SW60 rotor at 25,000 rpm at 4°C for 1 h, and the nuclear fraction, which is at the interphase of the 1.5 and 1.8 M sucrose steps, was used for RNA extraction.
To extract RNA from the subcellular fractions, an equal volume of phenol (equilibrated with AE buffer) and 1/10 volume of 10% SDS were added, and the fractions were incubated at 65°C for 4 min. The samples were snap-frozen in an ethanol-dry ice bath and then centrifuged. The aqueous phase was extracted with phenol-chloroform (equilibrated with AE buffer) twice, and RNA was precipitated by adding 1/10 volume of 3 M NaOAc (pH 5.3) and 2.5 volumes of ethanol. The RNA was spun down and resuspended in diethylpyrocarbonate-treated H2O.
RESULTS
Accumulation of PpLSU3 RNA and I-PpoI protein in yeast cells carrying the intron in rDNA.
To begin to understand how I-PpoI is expressed in yeast, we transformed plasmid pGALI3, which has PpLSU3 flanked by 376 bp of Physarum upstream rDNA sequence and 27 bp of downstream sequence cloned under the GAL1,10 promoter (30), into yeast strain INVSc2 (Table 1). This transformation yielded numerous colonies with PpLSU3 integrated into every rDNA copy, as evidenced by PCR analysis. The new yeast strain derived after curing of the plasmid, called INVSc2/I3, was mildly compromised in growth, with a doubling time of approximately 3 h in YEPD medium, compared with 1.5 h for the wild-type parent strain (data not shown). To identify PpLSU3 RNA species in yeast and to determine their steady-state levels, total RNA was analyzed by Northern blotting with a probe that covers both the I-PpoI ORF and the ribozyme part of PpLSU3 (Fig. 1A). The blot showed expected bands corresponding to the full-length intron RNA, the 5′ half intron RNA containing the I-PpoI ORF, and the 3′ half intron RNA containing the ribozyme (Fig. 1B), as well as a band smaller than the 3′ half intron RNA. Probing the blot separately with the 5′ or the 3′ half of the intron showed that the extra band was derived from the ribozyme part of the intron (data not shown). For ease of discussion, we call these two processed PpLSU3 RNA species 3′ half (L) and 3′ half (S), respectively. By comparison with known amounts of PpLSU3 RNA transcribed in vitro from plasmid pI3TZ (35), the amount of PpLSU RNA in yeast was estimated to be 2% of total RNA (data not shown). Consistent with this estimate, the 5′ half RNA, 3′ half (L), and 3′ half (S) could be seen readily on an ethidium bromide-stained polyacrylamide–8 M urea gel (Fig. 5B). These results imply that PpLSU3 RNA is very stable in yeast. Since total mRNA in a cell comprises only a few percent of total RNA (49), PpLSU3 RNA thus is present at a level much higher than that of any actively expressed mRNA species.
FIG. 1.
Detection of PpLSU3 RNA and I-PpoI endonuclease activity in the PpLSU3 integrated yeast strain INVSc2/I3. (A) Schematic drawing of the P. polycephalum rRNA gene with PpLSU3 inserted in position 1925 (Escherichia coli reference sequence) of the large subunit. Exon sequences are indicated by filled boxes, and intron sequences are indicated by open boxes. IPS1, internal processing site observed in vitro; IPS2, internal processing site observed in yeast only. The probe used for Northern blot analysis (10) is indicated as a bar below. (B) Northern blot analysis of PpLSU3 RNA in yeast. Lanes: Y, 6 μg of total RNA from INVSc2/I3 (Table 1) run on a 5% polyacrylamide–8 M urea gel followed by Northern blot analysis using a ribonucleotide probe transcribed from plasmid pd55ΔSX; T, in vitro-transcribed PpLSU3 from plasmid pI3TZ submitted to self-splicing conditions; M, Ambion Century RNA marker. (C) I-PpoI endonuclease activity assay. Lanes: M, 1-kb DNA ladder (New England Biolabs); P42, substrate plasmid p42 linearized with AvaII (the band above the major band is incompletely digested product); −, linearized p42 incubated with protein extract from intronless yeast strain INVSc2; +, linearized p42 incubated with 100 pg of purified I-PpoI; I3, linearized p42 incubated with 20 or 50 ng of total protein from INVSc2/I3.
FIG. 5.
Cleavage at IPS1 is abolished in the IPS1 mutant yeast strain, but I-PpoI expression is increased. (A) Northern blot analysis of the IPS1 mutant yeast strain. Lanes: 1 and 2, total RNA from wild-type (WT) strain INVSc2/I3; 3 and 4, total RNA from INVSc2/IPS1. For each strain, 2 and 6 μg of total RNA were loaded. Plasmid pd55ΔSX was used to make the riboprobe. The I-PpoI ORF is indicated by a filled box; the rest of the intron sequence is indicated by black bars. The dotted box represents the 5′ half (L) RNA, which is not detectable on this gel. (B) I-PpoI activity assay for the IPS1 mutant yeast strain. Lanes: M, 1-kb DNA ladders (New England Biolabs); P42, p42 linearized with AvaII; −, linearized p42 incubated with protein extract from the intronless strain INVSc2; WT, linearized p42 incubated with protein extract from INVSc2/I3. IPS, linearized p42 incubated with protein extract from INVSc2/IPS1. For each strain, 50, 200, and 500 ng of total protein were used.
To determine the amount of I-PpoI protein expressed from PpLSU3 integrated into yeast rDNA repeats on chromosome XII, we performed specific endonuclease assays using total protein extracts from INVSc2/I3. Linearized plasmid p42, which contains the I-PpoI target site, was used as the substrate. Cleavage by purified I-PpoI as the control yielded two fragments, of 1.5 and 1.3 kb (Fig. 1C). In crude yeast extracts, I-PpoI activity was easily detected with 20 ng of total protein. Assuming that the intrinsic activity of I-PpoI in the crude extract is equivalent to that of purified I-PpoI, we estimate from several similar experiments that I-PpoI protein represents approximately 0.04% of total protein in yeast strain INVSc2/I3. Thus, I-PpoI is of relatively low abundance in yeast, considering the high steady-state level of the intron RNA.
Cleavage of intron RNA at two internal processing sites.
PpLSU3 processing differs in vitro and in yeast, in that a second 3′ fragment of the intron RNA is generated in vivo (Fig. 1B). To further identify this RNA species, we carried out primer extension experiments to map the 5′ end of this new RNA species. An additional primer extension product corresponding to the 5′ end of the yeast-specific 3′ intron RNA was detected 15 bp downstream of the original internal processing site (Fig. 2A) which had been mapped in vitro (38). We call the original site IPS1 and the yeast-specific site IPS2. Previous results had shown that cleavage at IPS1 is mediated by the ribozyme (38). As in the first step of intron splicing, an exogenous G is added to the 5′ end of the 3′ RNA fragment when cleavage at IPS1 takes place with naked RNA in vitro. The primer extension product therefore extends one nucleotide beyond the actual cleavage site. It is likely that cleavage at IPS2 is also mediated by the ribozyme. This inference is based on the finding that when mutations abolishing ribozyme function were introduced into a plasmid-borne PpLSU3, no cleavage at IPS1 or at IPS2 was observed in yeast (data not shown). However, we cannot rigorously exclude that the yeast-specific cleavage is mediated by a cellular nuclease, nor do we know whether IPS2 cleavage is a G-addition reaction. If it is, IPS2 would map to the sequence GAGAG/AAAA (the slash indicates the cleavage site). In Fig. 2B, the positions of IPS1 and IPS2 are shown in the schematic drawing of part of the secondary structure of PpLSU3. IPS2 is at bottom of the P1 stem, which is formed as in all group I introns by base pairing between the 5′ exon and the intron internal guide sequence.
FIG. 2.
PpLSU3 RNA is cleaved at two IPSs in yeast. (A) The 5′ ends of the 3′ half PpLSU3 RNA species in yeast were mapped by primer extension. Note that the sequence from the primer extension reads the complementary strand to the RNA. (B) Schematic drawing of part of the PpLSU3 secondary structure showing the two IPSs as mapped in panel A. Exon sequences are in lowercase, and intron sequences are in uppercase. The 5′ splice site is indicated (5′SS).
I-PpoI protein is synthesized from a pol I transcript.
At least two hypotheses could explain the low level of I-PpoI protein compared with the high level of PpLSU3 RNA. In the first, the intron RNA is synthesized as a precursor along with the other rRNAs, i.e., by pol I. Intron RNA is then spliced from the precursor and processed further to yield the full-length, 5′ half, and 3′ half RNA species detected by Northern blotting. I-PpoI protein is translated from one of these pol I-derived RNAs. Lacking a 5′ cap and a 3′ poly(A) tail, the pol I transcript is translated inefficiently, but because of the abundance of intron RNAs, I-PpoI enzymatic activity nevertheless is easily detected. In the second hypothesis, a cryptic pol II promoter in the 5′ rDNA exon directs the synthesis of a low level of I-PpoI mRNA. Such a low level might be undetectable or indistinguishable because of the vast excess of pol I-derived RNA species.
To determine which RNA polymerase is responsible for I-PpoI expression, we took advantage of a genetic system in which a yeast strain temperature sensitive for pol I is rescued when rRNA is provided solely from the 35S rDNA gene under the GAL7 promoter control on a plasmid (pNOY103) (31, 32). This experimental system allowed us to measure I-PpoI expression at a nonpermissive temperature when pol I is not functional but the cells are still alive. We modified the system in two ways. First, PpLSU3 was integrated into chromosomal rDNA repeats of the pol I ts strain NOY401 by expressing the intron from plasmid pGALI3 as described in a previous paper (30). The resulting strain is called NOY401/I3. Second, a point mutation was selected at the I-PpoI target site on plasmid pNOY103 by cotransforming it into yeast along with the I-PpoI expression plasmid pRSIPpo. Since expression of I-PpoI causes a double-strand break in I-PpoI target site on pNOY103, mutant plasmids resistant to the endonuclease emerge readily. The mutant pNOY103 derivative was recovered and called pNOY103R. pNOY103R was transformed into strain NOY401/I3, and the resulting colonies were grown in galactose. pNOY103R was able to rescue the growth of NOY401/I3 at the nonpermissive temperature. Protein extracts were prepared from cultures after growing at 23 or 37°C and assayed for I-PpoI activity. We reasoned that if I-PpoI activity were not detected at the nonpermissive temperature, then pol I must be making I-PpoI mRNA under normal conditions; if I-PpoI expression remained the same at the nonpermissive temperature, then I-PpoI mRNA must come from a cryptic pol II promoter. This experimental strategy is illustrated in Fig. 3A.
FIG. 3.
I-PpoI mRNA is synthesized by pol I. (A) Experimental strategy used to determine which RNA polymerase is responsible for I-PpoI expression. Exon sequences are indicated by filled boxes; intron sequences are indicated by open boxes. Mutations at the I-PpoI target site on plasmid pNOY103R are indicated by an X in the 25S rDNA gene. (B) I-PpoI activity assay showing that I-PpoI protein is not expressed in the pol I ts strain at the restrictive temperature. Lanes: 1, p42 linearized with AvaII; 2 and 3, linearized p42 incubated with protein extract from wild-type (WT) strain INVSc2/I3/pNOY103R grown at 23°C; 4 and 5, linearized p42 incubated with protein extract from NOY401/I3/pNOY103R grown at 23°C; 6 and 7, linearized p42 incubated with protein extract from INVSc2/I3/pNOY103R grown at 37°C; 8 and 9, linearized p42 incubated with protein extract from NOY401/I3/pNOY103R grown at 37°C. For NOY401/I3/pNOY103R grown at 37°C, 1 and 2.5 μg of total protein were used. For the other protein extracts, 200 and 500 ng of total protein were used.
The results of this assay were unambiguous. The same level of I-PpoI activity was detected in the control strain INVSc2/I3 transformed with pNOY103R and in NOY401/I3 transformed with pNOY103R, both grown at 23°C in SGal medium (Fig. 3B). However, when cells were grown at 37°C, while the same I-PpoI activity was detected in INVSc2/I3/pNOY103R, no I-PpoI activity was detected in NOY401/I3/pNOY103R (Fig. 3B). A more quantitative assay using the 32P-labeled PCR product as the substrate revealed that NOY401/I3/pNOY103R grown at 37°C had about 1 to 2% of the endonuclease activity measured at 23°C (data not shown). This residual I-PpoI activity may reflect the remaining pol I activity at the nonpermissive temperature in vivo. Using a strain that has the same pol I ts allele as NOY401, Wittekind et al. found that in vitro pol I transcriptional activity of cells grown at 37°C was 17% of that of cells grown at 23°C (51). Comparison between these results and our in vivo results suggests that the temperature-sensitive phenotype of this mutation is more stringent in vivo than in vitro.
In summary, we conclude that the mRNA for I-PpoI is synthesized by pol I. This is the first well-documented example of natural protein expression by the pol I transcript derived from a chromosomal rDNA locus and represents a powerful and convenient assay for pol I function in vivo.
Integration of mutant PpLSU3 into chromosomal rDNA repeats by expression of I-PpoI in trans.
To further study how I-PpoI is expressed from the rRNA gene, we wanted to move mutant forms of PpLSU3, including mutants that might not express I-PpoI and thus would themselves be unable to home, into chromosomal rDNA repeats. To overcome this problem, we developed a method called transintegration (Fig. 4A), in which homing of the mutant intron is driven by expression of I-PpoI from a separate plasmid, pCPIPpo. In this plasmid the I-PpoI ORF, by itself without associated intron sequences, is under GAL1,10 promoter control. Most colonies that grow on galactose and hence are resistant to I-PpoI either have acquired point mutations at the I-PpoI target sites in rDNA on chromosome XII or have acquired the intron, thus disrupting that site. To identify survivors that have acquired the intron, PCR with two flanking exon primers can be performed. After the identification of colonies that have acquired the intron, both the donor plasmid carrying the mutant PpLSU3 and the I-PpoI expression plasmid pCPIPpo are cured (see Materials and Methods). I-PpoI endonuclease activity assays then are performed to assess the effect of mutation.
FIG. 4.
Integration of mutant forms of PpLSU3 as well as TtLSU1 into chromosomal rDNA repeats. (A) Diagram of the transintegration method. Exon sequences are indicated by filled boxes; intron sequences are indicated by open boxes. Mutations at I-PpoI target sites are indicated by an X on rDNA repeats. (B) Polyacrylamide–8 M urea gel run with total RNA from yeast strains integrated with the constructs described in Materials and Methods. The gel was stained with 0.5 μg of ethidium bromide per ml. INVSc2 is the parental intronless strain. For each strain, 2 and 6 μg of total RNA were loaded.
We tested several PpLSU3 derivatives for the ability to be integrated into rDNA repeats. JLΔORF lacks the entire sequence coding for I-PpoI, and JLDIPpo has two tandem stop codons in the ORF. These constructs were designed to test whether a mutant intron that does not express the endonuclease can home into chromosomal rDNA repeats when the endonuclease is expressed in trans. Both JLΔORF and JLDIPpo were readily integrated into every chromosomal rDNA copy, confirming that expression of I-PpoI in trans can indeed cause intron homing. This result also rules out possible roles for I-PpoI in splicing in vivo.
The Tetrahymena intron TtLSU1 is integrated into rDNA at exactly the same site as PpLSU3. The sequence of TtLSU1 is 70% identical to the ribozyme part of PpLSU3, implying that they were recently derived from a common ancestor. Since acellular slime molds (Physarum) and ciliates (Tetrahymena) are only very distantly related, the similarity between TtLSU1 and PpLSU3 suggests that one or both of these introns were introduced into their present hosts by a horizontal transfer event in evolution. We tested this possibility in our artificial system by expressing I-PpoI in yeast in the presence of a donor plasmid carrying TtLSU1. The Tetrahymena intron was readily integrated into every rDNA copy. TtLSU1 RNA accumulated to a high level, as is evident from staining of a gel with ethidium bromide (Fig. 4B). This result is quite different from the results of inserting TtLSU1 into the Schizosaccharomyces pombe 35S rDNA gene on a plasmid, which was reported to abolish the processing of the 5.8S rRNA in S. pombe (13). In our experiment, all rRNAs presumably are processed properly, since the doubling time of cells with TtLSU1 integrated into rDNA was approximately normal, 2 h in YEPD.
The IPS1 mutant yeast strain has greatly decreased 5′ half PpLSU3 RNA but increased I-PpoI expression.
Two major forms of I-PpoI ORF-containing PpLSU3 RNA exist in the cells: the full-length intron RNA and the 5′ half RNA. In principle, either or both might be the mRNA for the endonuclease. To determine which RNA species is translated or gives rise to an mRNA, we sought to prevent cleavage at IPS1 by mutating this site from G/U to AA (the slash indicates the actual cleavage site) (Fig. 2B and 4B). This mutant form of PpLSU3 was successfully integrated into rDNA repeats by means of the transintegration method, and then I-PpoI activity was assayed in crude extracts and RNA species were analyzed by Northern blotting. The experiment was based on the prediction that if the 5′ half RNA is the mRNA, mutation that abolishes cleavage at the IPS should decrease I-PpoI expression, whereas if the full-length PpLSU3 RNA is the messenger, the IPS1 mutant strain should have the same or increased I-PpoI activity. Northern blot analysis showed that cleavage at IPS1 was abolished, as indicated by the disappearance of the 3′ half RNA (L) band (Fig. 5A). However, the 3′ half RNA (S) band was still present in the IPS1 mutant, indicating that cleavage at IPS2 is independent of IPS1. Surprisingly, no 5′ half PpLSU3 RNA was detected in the IPS1 mutant. Since cleavage at IPS2 did take place, as evidenced by the presence of the complementary 3′ half RNA, we conclude that the 5′ half PpLSU3 RNA generated by cleavage at IPS2 [5′ half (L)] must be unstable. In fact, a low amount of this species was visible on Northern blots when total RNA was analyzed on formaldehyde-agarose gels, which in our hands detected lower levels of RNA than polyacrylamide gels (data not shown).
Despite the nearly complete absence of processed RNA species corresponding to the 5′ half of the intron, I-PpoI activity was not reduced; in fact, it was threefold greater than the wild-type control level (Fig. 5B). This result strongly suggests that the full-length RNA is or gives rise to the mRNA. To confirm this interpretation, we considered mutagenesis strategies to knock out IPS2 as well. However, this processing site is located in the P1 stem element, a region essential for splicing of the intron, and hence it is unclear if IPS2 cleavage could be abrogated by a mutation that did not compromise splicing.
Subcellular distribution of PpLSU3 RNA species in yeast.
To gain further support for the conclusion that the full-length PpLSU3 RNA is or gives rise to the mRNA, we performed subcellular fractionation experiments with the yeast strain INVSc2/I3. Broken yeast cells were separated into nuclear and cytoplasmic fractions as described in Materials and Methods. RNA was prepared from both fractions and subjected to Northern blot analysis along with total RNA. As marker for the integrity of nuclei, radioactive RNA complementary to the small nucleolar RNA U3 was used to probe the same fractions (Fig. 6). The majority of U3 was found in the nuclei as expected, but a small portion (approximately 8%) was detected in the cytoplasm. To facilitate the detection of small amounts of RNA, Northern blot analysis was performed with formaldehyde-agarose gels, on which the 3′ half (L) and 3′ half (S) RNA species are not resolved from one another. We found that all PpLSU3 RNA species were present in both nuclear and cytoplasmic fractions (Fig. 6). About 38, 65, and 70% (averages from two independent experiments) of the full-length, 5′ half, and 3′ half PpLSU3 RNAs, respectively, were present in the cytoplasmic fraction. These data by themselves do not help clarify the nature of the mRNA. However, subcellular fractionation with the IPS1 mutant strain INVSc2/IPS1 showed a similar distribution of intron RNA species, except that the 5′ half (L) RNA, which we showed previously was unstable, was about 2% of the wild-type level in both the nuclear and cytoplasmic fractions (data not shown). Given the increased levels of endonuclease in this mutant, the greatly reduced levels of cytoplasmic 5′ half RNA suggest strongly that this species cannot serve as the mRNA. Taken together, we interpret these data to support the model that the intact excised intron RNA is, or gives rise to, the mRNA. Our data do not address the possibility that a minor RNA species derived from the full-length RNA, but not the full-length RNA itself, is the mRNA. This possibility is difficult to test since such a minor species might be undetectable.
FIG. 6.
Subcellular distribution of PpLSU3 RNA species in yeast. Yeast cells were fractionated as described in Materials and Methods. RNA was prepared from the nuclear and cytoplasmic fractions and subjected to Northern blot analysis on a 1.5% formaldehyde-agarose gel, using a riboprobe synthesized from pd55ΔSX. Lanes: T, total RNA from INVSc2/I3; N, nuclear fraction; C, cytoplasmic fraction. U3, the same fractions probed with a riboprobe complementary to U3.
Measurement of PpLSU3 RNA and I-PpoI expression in Physarum.
To investigate if the results of these studies with yeast also apply to I-PpoI expression from the intron in its natural host, the acellular slime mold P. polycephalum, we performed Northern blot analysis with total RNA from Physarum microplasmodia. PpLSU3 RNA was found to accumulate to a much lower level in Physarum than in yeast (Fig. 7A). Among the three PpLSU3 RNA species, the 5′ half RNA was at a much higher level than the full-length RNA and the 3′ half RNA. The lower level of the 3′ half intron RNA indicates that it is less stable than the 5′ half intron RNA, in contrast to the relative stabilities of these species in yeast. The apparent low level of the full-length RNA in Physarum may be due to the more efficient cleavage at the IPS in the natural host for this intron. Quantitation of the Northern blot data showed that the amounts of the full-length, 5′ half, and 3′ half PpLSU3 RNAs were 250-, 30-, and 200-fold, respectively, lower than those in yeast. Therefore, it appears that all PpLSU3-derived RNA species are less stable in Physarum than in yeast.
FIG. 7.
Both PpLSU3 RNA and I-PpoI protein accumulate at a low level in Physarum. (A) RNA samples were run on a 1.5% formaldehyde-agarose gel, and Northern blot analysis was carried out as described in the legend to Fig. 6. Lanes: Y, 100 ng of total RNA from yeast strain INVSc2/I3; P, 8 μg of total RNA from Physarum. (B) Detection of I-PpoI activity in Physarum protein extract. A PCR product containing the I-PpoI target site amplified in the presence of [α-32P]dATP was used as the substrate to be incubated with total protein extract from Physarum and yeast.
We also tested Physarum protein extracts for I-PpoI activity. Due to large amounts of nonspecific nucleases in the crude extracts, we had to use a [32P]dATP-labeled PCR product as the substrate in the endonuclease assay (see Materials and Methods), to allow inclusion of cold poly(dI-dC) as the competitor. Consistent with the lower PpLSU3 RNA level in Physarum, the I-PpoI protein level was found to be about 300-fold lower than that in yeast (Fig. 7B). Therefore, I-PpoI protein represents about 1.3 × 10−4% of total protein in Physarum. We attempted to fractionate Physarum microplasmodia by several methods but failed to obtain intact RNA due to large amounts of nonspecific RNases. Thus, the distribution of PpLSU3 RNA species in Physarum remains unknown.
DISCUSSION
Expression of I-PpoI from a pol I transcript.
We have provided direct evidence that the I-PpoI protein is translated from the pol I transcript from the chromosomal rDNA locus of rDNA of yeast. The rule that protein-encoding genes are transcribed by eucaryotic pol II is commonly accepted. A functional consequence of pol II transcription is that (with few exceptions) mRNAs contain a 5′ cap and a 3′ poly(A). These modifications serve to enhance translation efficiency in several ways, such as promoting export of mRNA to the cytoplasm, stabilizing mRNA, and stimulating translation initiation. Besides the three examples of mobile nuclear group I introns, a possible exception to this rule is provided by the variable surface glycoprotein gene of Trypanosoma brucei, which has been suggested to be transcribed by pol I (55). But in this case, a small RNA synthesized by pol II is ligated to the 5′ end of the pol I transcript by trans splicing, so that the mature mRNA still contains a 5′ cap (28, 46, 55). Furthermore, the mRNA is polyadenylated at the 3′ end. A second possible exception is offered by retrotransposons in the rDNA gene of insects, exemplified by the R2 element in Bombyx mori, which are inserted into multiple copies of rDNA repeats in many insects. But unlike the mobile group I introns in rDNA genes, where every rDNA copy has the intron, the R2 element never occupies more than about 30% of all rDNA repeats (19). Moreover, the rDNA copies carrying R2 elements are transcriptionally inactive. However, since mobility of the R2 element is observed occasionally, transcription of the retrotransposon is inferred to occur at a low level. The nature of the RNA polymerase that transcribes the R2 element has not been investigated in detail. I-PpoI, therefore, is the first well-documented case of protein expression by a pol I transcript from the chromosomal rDNA locus.
In order for an RNA to be translated, it has to be exported from the nucleus to the cytoplasm. For a typical pol II-made RNA, this is facilitated by the 3′ poly(A) tail. Most of the RNA product synthesized from the pol I promoter on a plasmid remains in the nucleus (44). Splicing of PpLSU3 is an early step in pre-rRNA processing in Physarum (36). We confirmed this conclusion in yeast by cloning a ribozyme-defective mutant of PpLSU3 into the 35S rDNA gene of pNOY103. The 27SA and 27SB precursor rRNAs (species that contain the 5.8S rRNA still attached to 25S rRNA) accumulated in the cells (data not shown), indicating that pre-rRNA was unable to undergo further processing if PpLSU3 RNA was not spliced (for a review on rRNA maturation, see reference 33). Therefore, the wild-type PpLSU3 intron RNA must splice itself out of the precursor RNA before the separation of the 5.8S and 25S rRNA species. This conclusion implies that splicing occurs in the nucleolus. We originally had hypothesized that cleavage at IPS1 is essential for the expression of I-PpoI, perhaps because the 5′ half PpLSU3 RNA is more easily exported to the cytoplasm. In contrast to this expectation, the subcellular distribution of PpLSU3 RNA species showed that for both the full-length RNA and the 5′ half RNA, a large fraction is exported to the cytoplasm. It is not known whether there are any trans-acting protein factors or cis-acting elements in PpLSU3 that facilitate the export of PpLSU3 RNA into the cytoplasm.
Cleavage at the IPS as a mechanism to regulate I-PpoI expression.
The IPS1 mutant has increased I-PpoI activity, suggesting that the full-length PpLSU3 RNA is the real messenger. Perhaps cleavage of the full-length RNA at the IPS has evolved as a mechanism to destroy the mRNA, in order to downregulate expression of I-PpoI. Downregulation of homing endonuclease expression is a common feature of mobile group I introns. Group I intron-encoded endonucleases recognize long DNA sequences of 12 to 40 bp, which ensures that the endonuclease has only one target site in the genome. However, at least under experimental conditions in vitro, these endonucleases can tolerate base changes in their recognition sites (52). Therefore, overexpression of the endonuclease potentially can be deleterious to the host cell. This is especially critical for nuclear endonucleases, since nuclear genomes are vastly larger than organellar genomes. In the case of the mitochondrially encoded yeast nucleases I-SceII, I-SceIII, and I-SceIV, endonuclease activity comes from a fusion protein that is in frame with the upstream exon (16, 27, 41, 50). Expression is therefore downregulated by splicing of the intron from pre-mRNA. I-SceI, the endonuclease encoded by the ω intron, is expressed from a minor species derived from cleavage at a certain site (54). Endonucleases of T-even phage group I introns are expressed only at later stages of phage infection (14).
The expression level of I-PpoI in Physarum microplasmodium is much lower than that in yeast but higher than that of other group I intron-encoded endonucleases in their natural environments since endonuclease activity cannot be detected in the wild-type situation for some group I introns (16, 50, 54). Lower expression can be attributed at least in part to more rapid processing of PpLSU3 RNA to remove the full-length excised intron species. It is possible that the more rapid processing in Physarum has evolved as a way of downregulating endonuclease expression. Alternatively, since in Physarum both the full-length and 3′ half intron RNAs are less stable than the 5′ half intron RNA, perhaps the ribozyme part of the intron is specifically targeted for degradation in Physarum. Therefore, cleavage at IPS1 may be a mechanism for the 5′ half intron RNA to escape degradation and thus allow expression of I-PpoI. Homing of PpLSU3 takes place when two Physarum amoebae of different mating types cross (29). This is probably the only time when expression of I-PpoI is needed. It will be interesting to determine the expression level of I-PpoI in Physarum amoebae undergoing mating.
A translation enhancer element in the full-length intron RNA?
The results presented in this paper strongly suggest that the full-length RNA is or gives rise to the real mRNA. How does the cellular translation machinery determine to translate the full-length RNA but not the 5′ half RNA? Perhaps the ribozyme part of PpLSU3 RNA, as a highly structured RNA, acts as a translation enhancer element to bind to protein factors that augment translation initiation. There are numerous examples of translation control elements in the 3′ untranslated region (UTR). Typical mRNAs have a 3′ poly(A) tail that enhances translation by stabilizing mRNA and by increasing translation initiation, acting synergistically with 5′ cap (12). The 3′ UTR of histone mRNAs enhances translation by serving as an exporting signal and by stabilizing the RNA (26, 45). The 3′ UTR region of PAV barley yellow dwarf virus acts as a translational enhancer that mimics a 5′ cap in facilitating translation of uncapped mRNA (48). Recently, the ω intron RNA of yeast has been shown to be in ribonucleoprotein complexes of 50S (34). Our preliminary data show that the majority of PpLSU3 RNA also is not free, indicating the presence of bound proteins. Identifications of these proteins may help elucidate the role of the 3′ sequence of PpLSU3 RNA in translation.
ACKNOWLEDGMENTS
We are grateful to Masayasu Nomura for providing strain NOY401 and plasmid pNOY103, Sarah Woodson for providing plasmids pSW012, pI3TZ, and pI3ΔORFTZ, and Robert Lowery (Promega Corporation) for providing the purified I-PpoI protein. We thank Steinar Johansen and Wayne Decatur for helpful discussions during the course of this work. We also thank Wayne Decatur for critical reading of the manuscript.
This work is supported by grant GM-51860 from the USPHS.
REFERENCES
- 1.Adler P N, Holt C E. Genetic analysis in the Colonia strain of Physarum polycephalum: heterothallic strains that mate with and are partially isogenic to the Colonia strain. Genetics. 1974;78:1051–1062. doi: 10.1093/genetics/78.4.1051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J G, Smith J A, Struhl K, editors. Current protocols in molecular biology. New York, N.Y: John Wiley & Sons, Inc.; 1990. [Google Scholar]
- 3.Belfort M, Perlman P S. Mechanisms of intron mobility. J Biol Chem. 1995;270:30237–30234. doi: 10.1074/jbc.270.51.30237. [DOI] [PubMed] [Google Scholar]
- 4.Bell-Pedersen D, Quirk S, Clyman J, Belfort M. Intron mobility in phage T4 is dependent upon a distinctive class of endonucleases and independent of DNA sequences encoding the intron core: mechanistic and evolutionary implications. Nucleic Acids Res. 1990;18:3763–3770. doi: 10.1093/nar/18.13.3763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cech T R. Self-splicing of group I introns. Annu Rev Biochem. 1990;59:543–568. doi: 10.1146/annurev.bi.59.070190.002551. [DOI] [PubMed] [Google Scholar]
- 6.Decatur W A, Einvik C, Johansen S, Vogt V M. Two group I intron ribozymes with different functions in a nuclear rDNA intron. EMBO J. 1995;14:4558–4568. doi: 10.1002/j.1460-2075.1995.tb00135.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dujon B, Belfort M, Butow R, Jacq C, Lemieux C, Perlman P S, Vogt V M. Mobile introns definition of terms and recommended nomenclature. Gene. 1989;82:115–118. doi: 10.1016/0378-1119(89)90035-8. [DOI] [PubMed] [Google Scholar]
- 8.Einvik C, Decatur W A, Embley T M, Vogt V M, Johansen S. Naegleria nucleolar introns contain two group I ribozymes with different functions in RNA splicing and processing. RNA. 1997;3:710–720. [PMC free article] [PubMed] [Google Scholar]
- 9.Ellison E L, Vogt V M. Interaction of the intron-encoded mobility endonuclease I-PpoI with its target site. Mol Cell Biol. 1993;13:7531–7539. doi: 10.1128/mcb.13.12.7531-7539.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ellison E L. Ph.D. thesis. Ithaca, N.Y: Cornell University; 1994. [Google Scholar]
- 11.Fleischer S, Grummt I. Expression of an mRNA gene under the control of an RNA polymerase I promoter. EMBO J. 1983;2:2319–2322. doi: 10.1002/j.1460-2075.1983.tb01740.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gallie D R. The cap and poly(A) tail function synergistically to regulate mRNA translation efficiency. Genes Dev. 1991;5:2108–2116. doi: 10.1101/gad.5.11.2108. [DOI] [PubMed] [Google Scholar]
- 13.Good L, Abou-Elela S, Nazar R N. Tetrahymena ribozyme disrupts rRNA processing in yeast. J Biol Chem. 1994;269:22169–22172. [PubMed] [Google Scholar]
- 14.Gott J M, Zeeh A, Bell-Pedersen D, Ehrenman K, Belfort M, Shub D A. Genes within genes: independent expression of phage T4 intron open reading frames and the genes in which they reside. Genes Dev. 1988;2:1791–1799. doi: 10.1101/gad.2.12b.1791. [DOI] [PubMed] [Google Scholar]
- 15.Grummt I, Skinner J A. Efficient transcription of a protein-coding gene from the RNA polymerase I promoter in transfected cells. Proc Natl Acad Sci USA. 1985;82:722–726. doi: 10.1073/pnas.82.3.722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Guo W-W, Moran J V, Hoffman P W, Henke R M, Butow R A, Perlman P S. The mobile group I intron 3α of the yeast mitochondrial COXI gene encodes a 35-KDa processed protein that is an endonuclease but not a maturase. J Biol Chem. 1995;270:15563–15570. doi: 10.1074/jbc.270.26.15563. [DOI] [PubMed] [Google Scholar]
- 17.Hurt E C, McDowall A, Schimmang T. Nucleolar and nuclear envelope proteins of the yeast Saccharomyces cerevisiae. Eur J Cell Biol. 1988;46:554–563. [PubMed] [Google Scholar]
- 18.Jacobson A. Poly(A) metabolism and translation: the closed-loop model. In: Hershey J W B, Mathews M B, Sonenberg N, editors. Translational control. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1996. pp. 451–480. [Google Scholar]
- 19.Jakubczak J L, Zenni M K, Woodruff R C, Eickbush T H. Turnover of R1 and R2 type II retrotransposable elements in the ribosomal DNA of Drosophila melanogaster. Genetics. 1992;131:129–142. doi: 10.1093/genetics/131.1.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Johansen S, Embley T M, Willassen N P. A family of nuclear homing endonuclease. Nucleic Acids Res. 1993;21:4405. doi: 10.1093/nar/21.18.4405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Johansen S, Vogt V M. An intron in the nuclear ribosomal DNA of Didymium iridis codes for a group I ribozyme and a novel ribozyme that cooperate in self-splicing. Cell. 1994;76:725–734. doi: 10.1016/0092-8674(94)90511-8. [DOI] [PubMed] [Google Scholar]
- 22.Johansen S, Elde M, Vader A, Haugen P, Haugli K, Haugli F. In vivo mobility of a group I twintron in nuclear ribosomal DNA of the myxomycete Didymium iridis. Mol Microbiol. 1997;24:737–745. doi: 10.1046/j.1365-2958.1997.3921743.x. [DOI] [PubMed] [Google Scholar]
- 23.Liang W-Q, Fournier M J. Synthesis of functional eukaryotic ribosomal RNAs in trans: development of a novel in vivo rDNA system for dissecting ribosome biogenesis. Proc Natl Acad Sci USA. 1997;94:2864–2868. doi: 10.1073/pnas.94.7.2864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Lo H-J, Huang H-K, Donahue T F. RNA polymerase I-promoted HIS4 expression yields uncapped, polyadenylated mRNA that is unstable and inefficiently translated in Saccharomyces cerevisiae. Mol Cell Biol. 1998;18:665–675. doi: 10.1128/mcb.18.2.665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lopata M A, Cleveland D W, Sollner-Webb B. RNA polymerase specificity of mRNA production and enhancer action. Proc Natl Acad Sci USA. 1986;83:6677–6681. doi: 10.1073/pnas.83.18.6677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Marzluff W F. Histone 3′ ends: essential and regulatory functions. Gene Expr. 1992;2:93–97. [PMC free article] [PubMed] [Google Scholar]
- 27.Moran J V, Wernette C M, Mecklenburg K L, Butow R A, Perlman P S. Intron 5a of the COXI gene of yeast mitochondrial DNA is a mobile group I intron. Nucleic Acids Res. 1992;20:4069–4076. doi: 10.1093/nar/20.15.4069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Murphy W J, Watkins K P, Agablan N. Identification of a novel Y branch structure as an intermediate in trypanosome mRNA processing: evidence for trans splicing. Cell. 1986;47:517–525. doi: 10.1016/0092-8674(86)90616-1. [DOI] [PubMed] [Google Scholar]
- 29.Muscarella D E, Vogt V M. A mobile group I intron in the nuclear rDNA of Physarum polycephalum. Cell. 1989;56:443–454. doi: 10.1016/0092-8674(89)90247-x. [DOI] [PubMed] [Google Scholar]
- 30.Muscarella D E, Vogt V M. A mobile group I intron from Physarum polycephalum can insert itself and induce point mutations in the nuclear ribosomal DNA of Saccharomyces cerevisiae. Mol Cell Biol. 1993;13:1023–1033. doi: 10.1128/mcb.13.2.1023-1033.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Nogi Y, Yano R, Nomura M. Synthesis of large rRNA by RNA polymerase II in mutants of Saccharomyces cerevisiae defective in RNA polymerase I. Proc Natl Acad Sci USA. 1991;88:3962–3966. doi: 10.1073/pnas.88.9.3962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nogi Y, Vu L, Nomura M. An approach for isolation of mutants defective in 35S ribosomal RNA synthesis in Saccharomyces cerevisiae. Proc Natl Acad Sci USA. 1991;88:7026–7030. doi: 10.1073/pnas.88.16.7026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Raue H A, Planta R J. The pathway to maturity: processing of ribosomal RNA in Saccharomyces cerevisiae. Gene Expr. 1995;5:71–77. [PMC free article] [PubMed] [Google Scholar]
- 34.Richard G, Dujon B. Association of transcripts from a group-I intron containing gene with high sedimentation coefficient particles. Curr Genet. 1997;32:175–181. doi: 10.1007/s002940050263. [DOI] [PubMed] [Google Scholar]
- 35.Rocheleau G A, Woodson S. Requirements for self-splicing of a group I intron from Physarum polycephalum. Nucleic Acids Res. 1994;22:4315–4320. doi: 10.1093/nar/22.20.4315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rocheleau G A, Woodson S A. Enhanced self-splicing of Physarum polycephalum intron 3 by a second group I intron. RNA. 1995;1:183–193. [PMC free article] [PubMed] [Google Scholar]
- 37.Rose M D, Novick P, Thomas J H, Botstein D, Fink G R. A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene. 1987;60:237–243. doi: 10.1016/0378-1119(87)90232-0. [DOI] [PubMed] [Google Scholar]
- 38.Ruoff B, Johansen S, Vogt V M. Characterization of the self-splicing products of a mobile intron from the nuclear rDNA of Physarum polycephalum. Nucleic Acids Res. 1992;20:5899–5906. doi: 10.1093/nar/20.22.5899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Sachs A B, Sarnow P, Hentze M W. Starting at the beginning, middle, and the end: translation initiation in eukaryotes. Cell. 1997;89:831–838. doi: 10.1016/s0092-8674(00)80268-8. [DOI] [PubMed] [Google Scholar]
- 40.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
- 41.Seraphin B, Faye G, Hatat D, Jacq C. The yeast mitochondrial intron aI5α: associated endonuclease activity and in vivo mobility. Gene. 1992;113:1–8. doi: 10.1016/0378-1119(92)90663-a. [DOI] [PubMed] [Google Scholar]
- 42.Sherman F, Fink G R, Hicks J B. Laboratory course manual for methods in yeast genetics. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1986. [Google Scholar]
- 43.Sikorski R S, Hieter P. A system for shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122:19–27. doi: 10.1093/genetics/122.1.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Smale S T, Tjian R. Transcription of herpes simplex virus tk sequence under the control of wild-type and mutant human RNA polymerase I promoters. Mol Cell Biol. 1985;5:352–362. doi: 10.1128/mcb.5.2.352-362.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Sun J, Pilch D R, Marzluff W E. The histone mRNA 3′ end is required for localization of histone mRNA to polyribosomes. Nucleic Acids Res. 1992;20:6057–6066. doi: 10.1093/nar/20.22.6057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Sutton R E, Boothroyd J C. Evidence for trans splicing trypanosomes. Cell. 1986;47:527–535. doi: 10.1016/0092-8674(86)90617-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Vallette F, Mege E, Reiss A, Adesnik M. Construction of mutant and chimeric genes using the polymerase chain reaction. Nucleic Acids Res. 1988;17:723–726. doi: 10.1093/nar/17.2.723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Wang S, Browing K S, Miller W A. A viral sequence in the 3′-untranslated region mimics a 5′ cap in facilitating translation of uncapped mRNA. EMBO J. 1997;16:4107–4116. doi: 10.1093/emboj/16.13.4107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Warner J R. The assembly of ribosome in yeast. J Biol Chem. 1971;246:447–454. [PubMed] [Google Scholar]
- 50.Wenzlau J M, Saldanha R J, Butow R A, Perlman P S. A latent intron-encoded maturase is also an endonuclease needed for intron mobility. Cell. 1989;56:421–430. doi: 10.1016/0092-8674(89)90245-6. [DOI] [PubMed] [Google Scholar]
- 51.Wittekind M, Dodd J, Vu L, Kolb J M, Buhler J-M, Sentenac A, Nomura M. Isolation and characterization of temperature-sensitive mutations in RPA190, the gene encoding the largest subunit of RNA polymerase I from Saccharomyces cerevisiae. Mol Cell Biol. 1988;8:3997–4008. doi: 10.1128/mcb.8.10.3997-4008.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Wittmayer P K, McKenzie J L, Raines R T. Degenerate DNA recognition by I-PpoI endonuclease. Gene. 1998;206:11–21. doi: 10.1016/s0378-1119(97)00563-5. [DOI] [PubMed] [Google Scholar]
- 53.Woodson S A. Exon sequences distant from the splice junction are required for efficient self-splicing of the Tetrahymena IVS. Nucleic Acids Res. 1992;20:4027–4032. doi: 10.1093/nar/20.15.4027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Zhu H, Macreadie I G, Butow R A. RNA processing and expression of an intron-encoded protein in yeast mitochondria: role of a conserved dodecamer sequence. Mol Cell Biol. 1987;7:2530–2537. doi: 10.1128/mcb.7.7.2530-2537.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zomerdijk J C B, Kieft R, Borst P. Efficient production of functional mRNA mediated by RNA polymerase I in Trypanosoma brucei. Nature. 1991;353:772–775. doi: 10.1038/353772a0. [DOI] [PubMed] [Google Scholar]







