Screening sensibility and antifungal activity after topical application of a synthetic lactoferrin-derived antimicrobial peptide

Abstract

Objective: Onychomycosis is the most common disease of the nails and constitutes about half of all nail abnormalities. Onychomycosis is usually caused by dermatophytes and incomparably less frequently by yeast-like fungi and non-dermatophyte molds. Current treatment options for onychomycosis are ineffective. Methods: This study evaluated the performance of a commercial and CE-registered product containing antimicrobial peptide hLF1-11 in vitro for treating toenail onychomycosis. In a case-control setting, nail samples from 59 volunteers were obtained before and after treatment by a pedicurist and investigated for the presence of fungi by culturing, barcode sequencing, and MALDI-TOF-MS. Results: Of 89 samples, T. rubrum (19%) and C. parapsilosis (17%) were cultured. In total, 47 samples (53%) were positive for culture. MALDI-TOF-MS could identify 28, but 19 remained unidentified; those species were not included in the commercial MALDI-TOF reference database library. A positive effect of treatment by the hLF1-11 product on 41 volunteers (1 placebo, 18 low doses, 22 high doses) was observed. No adverse effects of the peptide were observed or reported by the pedicurist or any of the participants. Conclusions: This study showed a positive therapeutic effect of a commercial product containing hLF1-11 in the case of 88.9% of the patients with onychomycosis. The present formulation of hLF1-11 into PBS is stable enough to permit storage at room temperature for at least two years.

Introduction

Fungal infections of the nail are collectively called onychomycosis. A recent review of population-based studies in Europe and the US reported a mean prevalence of 4.3-8.9% [1,2]. Onychomycosis affects up to 10-12% of the global population, and its treatment represents a significant worldwide market [3,4]. Onychomycosis is the most common disease of the nails, constituting about half of all nail abnormalities [5,6]. The infections are commonly caused by dermatophytes that actively degrade the keratin of the nail, in particular species of the genera Microsporum, Epidermophyton, and Trichophyton, and about 90% of cases are caused by Trichophyton rubrum [7]. The disease is generally considered a problem of a cosmetic nature but can significantly impact patients’ quality of life [8]. Onychomycosis can be transmitted mainly through direct contact or contamination when walking barefoot over surfaces contaminated with dermatophyte propagules. A clinical hallmark of onychomycosis is that the nail becomes friable, and often characteristic visible spikes occur. Typically, topical treatment is recommended when up to 50% of the distal nail plate is involved, no more than three or four nails are affected, and for early distal and lateral subungual onychomycosis treatment and superficial white onychomycosis [9].

In many countries, topical formulations based on ciclopirox, azoles, or terbinafine can be obtained prescription-free over the counter at the generic drugstore without consulting a clinician/dermatologist. Unfortunately, the overall effectivity of these drugs is relatively low (<10%) [10], and the treatment must be applied for at least one year [11-13]. There is a need for effective antifungal treatment of toenail infections, ideally with a highly effective and safe drug that could be used without a prescription. Antimicrobial peptides (AMP) may provide an opportunity to support the impact of using peptides in a therapeutic setting [14-17]. Human lactoferrin (hLF), an AMP present as a component of human breast milk, showed high antimicrobial properties against a broad diversity of bacteria and fungi with an excellent safety record in humans [18-20]. A synthetic fragment of the first 11 amino acids of hLF, hLF1-11, is effective against a broad range of microorganisms, including fungi, either directly by binding to the cell wall, induction of cytolysis, or indirectly through the activation of the immune system [21]. The peptide’s safety against pathogens in single and repetitive doses has been established in pre-clinical and clinical settings [22]. Large-scale production can be done in different ways, such as 1) extraction from natural resources (microalgae), 2) recombinant strategies, and 3) chemical synthesis from products [14,22] (see Supplementary Materials for more details).

In this study, we determined the antifungal efficacy of a registered commercially available product based on hLF1-11 on onychomycosis. After clinical screening, fungi were collected from the toenail scrapings of volunteers suffering from onychomycosis. Toenail scrapings were cultured, and fungi were isolated, identified, and characterized in vitro by culture, barcode sequencing, and MALDI-TOF MS. After that, in vitro antifungal susceptibility testing was determined for the commercial product that contains the hLF1-11 peptide. The medical pedicurist determined the antifungal efficacy of topical application for 3-7 months of the hLF1-11 product on toenail infections in volunteers suffering from onychomycosis. We described the synthesis and monitored the (shelf-life) stability of hLF1-11 containing the peptide by varying the temperature and storage time, as commonly determined for clinically graded solutions. The antibacterial and antifungal activity of the peptide was followed over 24 months.

Materials and methods

General

All chemicals were obtained from commercial sources and were used without further purification.

Peptide hLF1-11

The synthetic peptide corresponds to residues 1-11 [GRRRRSVQWCA; C₅₆H₉₅N₂₅O₁₄S, Mw. 1415.8 Da; purity of 98.54%] derived from human lactoferrin and will be further referred to as hLF1-11. The peptide’s synthesis and quality control (QC) analysis is extensively described in Supplementary Materials. For placebo control experiments, a control peptide without antimicrobial action in vitro comprising alanines at positions 2, 3, 6, and 10 [GAARRAVQWAA; Mw. 1156.4 Da] was purchased from Pepscan, Lelystad, The Netherlands [23]. For more details, see Supplementary Materials for quality analysis and stability testing.

Microorganisms

The following microbes were used for susceptibility testing of hLF1-11. The fluconazole-resistant C. albicans strain Y01-19 was obtained from the Department of Infectious Diseases, Leiden University Medical Center (LUMC), Leiden, The Netherlands, and identified using barcode sequencing and MALDI-TOF MS [23]. This yeast was further identified using Candiselect (Sanofi Pasteur, Paris, France) and confirmed by the pattern of sugar utilization (API-ID32C, bioMerieux, Marcy l’Etoile, France) as described by Pincus et al. [24]. The fluconazole resistance of this isolate was evaluated, with a Minimum Inhibitory Concentration (MIC) >256 µg/mL using Etest (AB Biodisk, Solna, Sweden). Two well-characterized Candida spp. strains were obtained from the American Type Culture Collection (ATCC, Rockville, MD): C. albicans ATTC 90028 and C. parapsilosis ATTC 22019 (CBS 604). The C. neoformans strain was provided by the Department of Infection Diseases, LUMC, The Netherlands. Six strains for six dermatophyte species (viz., E. floccosum, M. canis, N. gypsea, T. mentagrophytes, T. rubrum, and T. tonsurans) were obtained from the Department of Infectious Diseases, LUMC. The various fungal strains were used as a reference to compare the susceptibility and efficacy of the peptide [23].

Antifungal efficacy assays for yeast

An in vitro assay was used for sensitivity/selectivity testing of hLF1-11 for the most common fungi isolated from toenails with diagnosed onychomycosis. As with mammalian cells, monitoring of cell viability and growth, the internal environment of fungal pathogens becomes more reduced as the cells proliferate [25], and this process was monitored spectrophotometrically or spectrofluorometrically. The efficacy of the peptides against the various strains was quantitated using an in vitro microdilution procedure according to the National Committee for Clinical Laboratory Standards (NCCLS) with some minor amendments [24]. Dilutions of each modified hLF1-11 peptide were prepared with ¼ strength of medium RPMI 1640 medium R8758 (Sigma Chemical Co., St. Louis, MO) without buffering supplement [26]. The increasing strength of the medium negatively affects the peptide activity because of its high binding capacity, even to plastic surfaces. Peptide activity was tested against these fungi in peptide-friendly one-quarter strength RPMI 1640 broth. The peptide dilutions were dispended into 96-well round-bottom polypropylene low-binding microtiter plates (Greiner Bio-one, No.: 3474 Ultra-low Attachment, Germany), sealed, and stored at room temperature until needed. The yeast cells were adjusted to a concentration of 0.5-2.5 × 10⁵ colony forming units (CFU)/mL in RPMI 1640 medium, and an aliquot of 100 µL of this solution was added to each well of the microdilution plate (CLSI, M27-A4). AlamarBlue^TM has been used to monitor the susceptibility of several yeast pathogens, e.g., C. albicans, C. glabrata, and C. neoformans, to amphotericin B, fluconazole, and flucytosine [27,28] and was added at a volume of 2 µL/well. The total volume in each well was 200 µL. The cells were incubated at 35°C, and AlamarBlue^TM reduction was assessed after 3 and 24 hours. Yeast cell growth (endpoints) was determined by visual color reading. Growth was monitored using a spectrophotometer (SPECTRO star Nano Absorbance Reader, BMG Labtech, Germany) at 570 nm and 600 nm. The MIC was defined as the lowest concentration of drugs that produced a prominent decrease in turbidity compared to the drug-free control (score <2). AlamarBlue^TM was added to show cell viability through the measurement of oxidation. When growth was present, the well turned to red/pink color, and when no growth was present, the well remained dark blue/purple. OD at 570 nm and 600 nm was also measured to confirm those outcomes. Each experiment consists of at least three independent replications. Values were presented as the average of three individual experiments to compare peptide efficacy.

Modified antifungal susceptibility assays for filamentous fungi

Susceptibility to hLF1-11 for filamentous fungi was determined using microdilution according to protocol CLSI-M38-A2 with some modifications. Cultures of fungi isolated from nail samples and reference strains were sub-cultured on potato dextrose agar (PDA) and incubated at 30°C for five to seven days. After this period, the plates were flooded with 5 mL sterile physiological saline (0.85%), and the conidia were gently removed from the culture surface using a Drigalski spatula. The conidia were transferred with a sterile swab to a sterile plastic conical tube, and the final volume was adjusted to 5 mL with saline. The mixtures of conidia and hyphal fragments were mixed with a vortex for 30 s, and large particles were allowed to settle for five min. The suspensions were counted with a Bürker-Türk counting chamber to 1-5 × 10⁶ conidia/mL. This suspension was diluted 100× with ¼ strength of RPMI 1640 medium to final concentrations of 1-5 × 10⁴ conidia/mL. Aliquots of 100 µL of this solution were added to 100 µL of different peptide solutions and incubated using 96-well non-binding microdilution plates (Greiner bio-one, type 650901). Finally, the agent AlamarBlue^TM was added at 2 µL/well. The cells were incubated at 35°C and examined daily for up to five days. Growth was monitored using a spectrophotometer as described above. Experiments were performed for at least three independent replications. MIC values are presented as single data for clarity and ease of comparison of peptide efficacy. Values were presented as the average of three individual experiments of peptide efficacy.

Study design

Study objectives: Aninvestigator-initiated in vitro study aimed to identify and quantify the fungi before treating onychomycosis in infected toenails donated by volunteers. A medically registered pedicurist (affiliated with the Dutch branch association, Provoet, The Netherlands) saw all volunteers who were users/purchasers of the product and conducted the treatment with a commercially available product containing the antimicrobial peptide hLF1-11. This product is sold commercially on the open market in the Netherlands, has a CE certification (Class 1-NL-CA002-2019-45945), and is commercially registered as medical devices class 1 according to art.9, paragraph 3, European directive 93/42/EEC. Manufacturer: CBMR Scientific Nanoscience BV. This study performed in vitro analyses to determine the fungi’s presence and susceptibility to hLF1-11. Only material from volunteers was involved in this study, and this donation involved just the nail clippings collected before and after treatment. The volunteers were provided extensive information and signed a statement to take photographs and donate nail clippings. Volunteers were given a number so that anonymity and privacy were guaranteed. We designed this study to analyze the effectiveness of this commercial product. We opted for concentrations (MIC values) that were effective in previous hLF1-11 studies. The objectives of the study are: 1) to analyze the presence and identity of fungi in toenail clippings before and after therapy, 2) to assess an effective dose and time for eradicating fungi in infected toenails, and 3) to follow up with volunteers on the recurrence of toenail infections.

Study setup: Volunteers were enrolled in the study after screening by a professional certified medical pedicurist. Those with clinically suspected toenail infection(s) were included for topical treatment of infected toenails. Only affected toenails were visually monitored for each subject, but only one big toenail (digitus primus pedis) was included per subject. Before admission, a photographic record of the condition of the toenail was made, and nail clipping samples were taken to analyze the presence of dermatophytes and other fungi. Nail clippings were collected and analyzed at the Westerdijk Fungal Biodiversity Institute, The Netherlands. Samples of nail scrapings were examined by culture, and subsequently, isolates were identified by ITS barcode sequencing or MALDI-TOF-MS. Clinical responses to treatment were monitored by culturing, visual inspection by three independent observers and the subjects’ personal experiences. Also, the affected nails were categorized into their disorders by (i) low to mild fungal nail problems (low-dose group) or (ii) mild to severely infected onychomycosis (high-dose group); this due to the two concentrations of peptides with which the therapy was initiated. At each visit to the pedicurist, eventual adverse effects were evaluated using a standardized questionnaire of four questions addressing sensitivity, pain, adverse effects noticed during therapy, and thickness/disintegration or hardening of the treated nails. A pedicurist chose treatment concentration in the first study setup. Volunteers were categorized for their skin and nail disorders into three groups: (1) persons without fungal nail problems, (2) persons with mild complaints, and (3) persons with serious complaints. Treatment using different concentrations was given for low to mild fungal nail problems (hLF1-11, 3 µg/mL group), mild to severe fungal nail problems (combination group hLF1-11, 3 µg/mL or 33 µg/mL), and the high infected onychomycosis (hLF1-11, 33 µg/mL) group. After obtaining the informed consent, the volunteers were randomly assigned to treatment with either low or high peptide concentrations or a placebo (33 µg/mL of scrambled hLF1-11), according to a computer-generated randomization schedule. Test and placebo solutions were administered twice daily for at least 3-4 months at a low dose of 3 µg/mL or a high dose of 33 µg/mL as one drop application.

Endpoints and sample collection: Volunteers receiving the placebo solution (scrambled hLF1-11, 33 µg/mL) were monitored for 3-7 months. One or two samples of affected toenails were collected per volunteer during treatment to follow the effectiveness of the peptide.

Culturing of the fungi from nail clippings

Nail samples were washed in sodium hypochlorite 4 g/100 mL H₂O for 15 to 30 s to prevent bacterial growth by washing off externally present microorganisms at the clipped nails. After washing with sodium hypochlorite, the sample was neutralized with milli-Q purified water for 15-30 s, except for tiny nail samples. Small samples (<1 mm) were directly plated on malt extract agar (MEA) plates containing penicillin and streptomycin (MEA p/s, streptomycin sulfate, 0.4 mg/ml; penicillin G, 0.4 mg/mL) (Difco B112, Difco Laboratories Michigan, USA). Nail flakes obtained by scraping flakes of dis-eased nail parts with a scalpel were stuck into MEA p/s agar. A maximum of eight pieces of nail flakes were incubated per agar plate at 28°C for 4 weeks. Fungal colonies growing from each flake were isolated and transferred to a new MEA slant. To prevent possible infestations with mites, the tubes were sealed with a benzyl benzoate solution of 25% and incubated at 28°C until fungal growth was observed.

Identification of fungi using MALDI-TOF MS

For the identification of molds and yeasts, MALDI-TOF MS used a Bruker Microflex and standard procedures [29,30,34-36]. Isolates were incubated on a glucose-yeast ex-tract-peptone-agar (GYPA) plate at 28°C until enough growth was observed, permitting identification. The MALDI-TOF MS procedure followed the full extraction protocol [31,32]. A suspension was made with 100 µL demi-water, one colony of the GYPA plate, and 900 µL ethanol (96%) was added. The mixture was vortexed for 5 s and centrifuged for 3 m at 14,000 rpm, and after removing the supernatant and replenishing the solvent, it was centrifuged for 60 s at 14,000 rpm. The supernatant was removed, and 10 µL 70% formic acid (FA) was added to the sample. The mixture was vortexed for 5 s, and 10 µL acetonitrile was added and vortexed for another 2 s. Mixtures were centrifuged again for 1 m at 14,000 rpm. One µL of the prepared sample was added to a spot on the MAL-DI-TOF MS plate and left to dry completely. To this spot, 1 µL of the matrix α-cyano-4-hydroxycinnamic acid (α-CHCA) was added, kept in the dark, and thoroughly dried before the sample was identified by MALDI-TOF MS [33].

DNA extraction

At first, glass beads (1.5-2 mm) were added to 2 mL screw-cap tubes, after which 490 µL cetyltrimethylammonium bromide (Sigma-Aldrich, USA), CTAB-buffer 2x (CTAB 2%, NaCl 1.4 M, EDTA 20 mM, Tris 100 mM) was added. Parts of the fungal colonies obtained were added to the tubes. Ten µL proteinase K solution (ThermoFisher, Grand Island, NY, USA) was added, after which the suspension was thoroughly vortexed for 10 m on a vortex Mixer (Greiner, Bio-One, Germany). The samples were then incubated for one hour at 60°C and cooled on ice for a few minutes. Hereafter, 0.1 mL SEVAG (chloroform diluted 24:1 in iso-amyl alcohol) was added and mixed to form an emulsion. The samples were centrifuged for 10 m at 14,000 rpm, and the clear supernatant was harvested. To this sample, 220 µL ice-cold isopropanol (=0.55× the DNA sample size) was added, and the emulsion was remixed and centrifuged for 10 m at 14,000 rpm. The isopropanol was poured off, and 1 mL of ice-cold ethanol 70% was added. Next, the samples were centrifuged at 14,000 rpm for 2 min, and the ethanol supernatant was removed. The samples were dried in a SpeedVac (Savant Instruments Inc., Farmingdale, NY, USA), and 100 µL Tris-EDTA (TE) (Sigma-Aldrich) buffer was added. The DNA quality was tested as follows. Three µL of the sample was run for 30 m at 50 V on a 0.8% agarose gel, and the concentration was determined with a Qubit 4 Fluorometer (Qubit Fluorometric Quantification, ThermoFisher). The samples were stored at -20°C.

PCR and sequencing

The PCR mix for 1 reaction was made by adding 2.5 µL NH₄ ⁺ buffer (10×) (Sigma-Aldrich), 15 µL sterile water, 2.5 µL dNTP mix, 1 mM (Sigma-Aldrich), 1.0 µL Mg²⁺, 50 mM (Sigma-Aldrich), 1.0 µL ITS1 primer ((TCCGTAGGTGAACCTGCGG) [41], 10 pmol), 1.0 µL ITS4 primer ((TCCTCCGCTTATTGATATGC), 10 pmol) and 1.0 µL Taq polymerase (Bio-line, 0.5 U, Germany) to a low-binding Eppendorf tube. One µL of the DNA sample was added to the tubes of the PCR strips, after which 24 µL of the PCR mix was added. Twenty-five µL of the PCR mix without DNA was added to a tube as a negative control with the following settings: 95°C pre-denaturation for 5 min, denaturation at 95°C for 45 s, annealing at 48°C for 30 s, elongation at 72°C for 60 s and post-elongation at 72°C for 6 m. The denaturation, annealing, and elongation were done for 35 cycles. The samples were transferred to a 1.0% agarose gel slot as a quality control and run at 135 V for 20 min. The sequence mix was made by adding 3 µL buffer (Tris/Borate/EDTA), 0.7 µL Big Dye^TM sequencing buffer (ThermoFisher), 4.3 µL water, 1.0 µL primer (ITS1) or (ITS4) [34] and 1 µL of the PCR amplicon. The primers were firstly diluted to a concentration of 3-4 pmol, and amplicons were diluted in 0.1 M TE buffer to 3-10 ng/µL. A PCR was performed (for ITS1 and ITS4) with the following settings: 95°C for 1 minute and 30 cycles of the following steps: 95°C for 10 s, 5 s at 50°C, and 2-4 m at 60°C. The samples were submitted, purified, and sequenced with Sanger sequencing. Strains were sequenced bi-directionally, but only once. The isolates were identified using BLAST of the National Center for Biotechnology Information (NCBI) [35].

Stability and shelf-life

Samples containing peptides were evaluated at different temperatures. Prediction of shelf life can be defined as the period during which the peptide retains its original quality. The manufacturing, formation process, and processing steps of lactoferrin from human origin must be visualized and optimized to minimize its denaturation. Procedures and results are described in Supplementary Materials.

Statistical analysis

All data are presented as mean values or a percentage of the total number of patients. The Student two-tailed independent sample t-test was used to analyze differences between the treatment groups. All analyses and calculations were performed using Microsoft Office Excel 2019.

Results

Effect of peptides on the treatment of onychomycosis

The study included 59 volunteers with different clinical signs related to the severity of onychomycosis of the toenails (range 1 to 4, according to the score for the proximity of disease to the nail matrix) [43]. Six volunteers halted for personal reasons after 2-4 weeks, and those were excluded from the study. Most infected toenails were diagnosed as severe onychomycosis (high score group), and >30% of the toenail surface was affected for at least one year. From the nail samples, 89 samples were incubated for fungal growth. Forty-seven nail samples showed growth of microorganisms (52.8%), corresponding to earlier results [6,36,37]. Other infected toenail clippings that were culture-negative were likely infected with fungi that are difficult to culture (Table 1). Fifteen percent showed growth of fungal species, of which Trichophyton spp. and Candida spp. were most frequently retrieved with 22% and 32% of cultured nail samples, respectively. We found other species in 20% of volunteers, such as Aspergillus spp., Cladosporium spp., Fusarium spp., and Penicillium spp (Table 2). Furthermore, 28 fungal strains collected from the nail clippings were harvested and, when identified using MALDI-TOF, gave score values ≤1.7 (Table 1), and these were not further determined in this study.

Table 1.

Occurrence of fungal species sampled from 53 subjects

Isolate	Number	Isolate	Number
Aspergillus carbonarius	1	Hypocreales spp.	2
Aspergillus niger	1	Meyerozyma guilliermondii	1
Aspergillus sydowii	1	Naganishia albidosimilis	1
Aspergillus tamarii	6	Naganishia diffluens	2
Aspergillus terreus	1	Penicillium albocorenium	1
Aspergillus unguis	2	Penicillium canescens	1
Aspergillus versicolor	1	Penicillium chrysogenum	2
Candida haemulonii	1	Tintelnotia destructans	1
Candida metapsilosis	5	Trichophyton interdigitale	2
Candida parapsilosis	19	Trichophyton mentagrophytes	1
Cladosporium parahalotolerans	1	Trichophyton rubrum	10
Cystobasidium calyptogenae	1	Trichosporon mucoides	4
Cystobasidium lysinophilum	1	Westerdykella spp.	1
Debarynomyces hansenii	1	Unidentified	91
Fusarium solani	1

The samples were screened for fungi with MALDI-TOF-MS, and samples with a score below 1.700 were identified with ITS1 and ITS4 sequencing. C. parapsilosis (32%) and T. rubrum (22%) were most frequently retrieved from cultured nail samples.

Table 2.

In vitro MIC 90 values of hLF1-11 in case of fungal strains isolated from the toenail samples taken from 53 volunteers

Isolate	MIC 90 (microgram/mL)	Isolate	MIC 90 (microgram/mL)
Aspergillus carbonarius	12.5	Penicillium albocorenium	50
Aspergillus niger	25	Penicillium canescens	50
Aspergillus terreus	25	Penicillium chrysogenum	25
Candida haemulonii	25	Trichophyton interdigitale	12.5
Candida metapsilosis	12.5	Trichophyton mentagrophytes	6.25
Candida parapsilosis	12.5	Trichophyton rubrum	12.5
Cladosporium parahalotolerans	6.25	Trichosporon mucoides	6.25
Fusarium solani	6.25

After being cultured and isolated from the nails, the samples were identified with barcode sequencing or MALDI-TOF-MS. Minimal Inhibitory Concentration (MIC) MIC 90 values were determined in RPMI 1640 one-fourth of broth strength as assay medium. The assays were repeated in triplicate. Representative single assay data are given for clarity and ease of comparison of peptide efficacy.

Observations by a medical pedicurist about the toenail status after the treatment of volunteers at the end of the period were included in evaluating the final results (Table 3; Figure 1A, 1B). A positive outcome was established for 41 volunteers, of whom one received the placebo, 18 received a low dose (34%), and 22 received a high dose (42%) of hLF1-11 (Table 3). No effects were observed with 12 volunteers, of which 7 received the placebo. Three of them received a low dose, with one sample showing a positive culture of C. parapsilosis, and the other two could not be tested because they were culture-negative. The two volunteers with the highest dose during 12 months of fungal nail treatment yielded T. interdigitale and Hypocreales spp. isolates. Concentrations of both treatments of low (3 mg/L) and high (33 mg/L) doses were below the MIC value of the fungi isolated from those samples. MIC values of those strains were compared for susceptibility with MIC values from reference strains [38] (Table 4).

Table 3.

Observed visual effect of peptide antifungal activity after 12 months

hLF treatment	Patients (n)	Cured (% of total)	No effect (% of total)
Low (3 microgram/mL)	21	18 (85.7%)	3 (14.3%)
High (33 microgram/mL)	24	22 (91.7%)	2 (8.3%)
Control (placebo)	8	1 (12.5%)	7 (87.5%)

Fifty-three volunteers were treated with either placebo, or low or high dose peptide for 12 months with 2 drops daily on the infected nail. Treatment positively affected 40 out of 45 volunteers (88.9%).

Figure 1.

A. Examples of volunteers’ nails. Visual effect of the peptide after 4-7 months of treatment with daily 1-2 drops (33 mg/L dose of hLF1-11 peptide). Images before and after treatment of the product and no treatment (placebo) are shown. B. Images of the feet of two volunteers at the start, after 3 months, and after 7 months of treatment.

Table 4.

Minimum Inhibitory Concentration values of the antimicrobial compound hLF1-11

Isolate	MIC 90 (microgram/mL)	Isolate	MIC 90 (microgram/mL)
Candida albicans YO1-19	12.5	Microsporum canis	25
Candida albicans ATTC 90028	12.5	Nannizzia gypsea	25
Candida parapsilosis ATTC 22019	12.5	Trichophyton mentagrophytes	25
Cryptococcus neoformans WT	12.5	Trichophyton rubrum	50
Hypocreales spp.	50	Trichophyton tonsurans	25

MIC 90 values of antifungal compound hLF1-11 peptide were determined in RPMI 1640, one-fourth strength of the broth as assay medium. Experiments: 1 × 10⁵ CFU of various strains/mL were incubated for 24-48 h at 37°C into one-fourth medium of RPMI 1640 with the previous concentrations of hLF(1-11), respectively. As controls, reference strains were incubated for 24-48 h at 37°C with no agent, and then growth was monitored using a spectrophotometer at 600 nm. Results are means of at least three independent experiments. Representative single assay data are given for clarity and ease of comparison of peptide efficacy. MIC = Minimum Inhibitory Concentration.

A microbicidal effect was recorded in most cases. The lowest dose of hLF1-11 was equal to 3 mg/L and yielded a positive effect in 18 volunteers, and for 22 volunteers, the dose of hLF1-11 used was equivalent to 33 mg/L. Of the 12 non-responders, seven received the placebo, three subjects received a low dose, and two received a high dose for 12 months of treatment of the toenail.

The medical-certified pedicurist’s visible inspection revealed that the nail quality of volunteers with low-dose treatment improved after 4-7 months, whereas those treated with the highest dose treatment showed an improvement after 3-6 months. After 12 months, visual improvements of the nail were observed by almost 89% of the volunteers. 75.5% responded positively to the treatment, of which 9.4% had an effect after treatment with the higher peptide dose. Furthermore, 13.2% did not respond to treatment, and 1.9% (n=1) had a positive effect when treated with the placebo.

Comments from subjects obtained during the 12-month treatment with both doses of peptide revealed that sensitive and painful nails became less sensitive, and no more painful skin problems were encountered after two weeks. None of the participants reported any adverse side effects, and visual inspection confirmed that thick nails became thinner and shinier (Table 5).

Table 5.

Questionnaire of volunteers at the end of the trial period on sensitivity/pain relief, healthier skin, thickness reduction, and color change of the nails

Observation	Improvement (% of total)
Sensitivity/pain relief	29%
Healthier skin	72%
Thickness reduction of the nail	85%
Color change of the nail	29%

Discussion

This study showed that various fungal isolates obtained from onychomycosis could be identified by MALDI-TOF-MS, and their susceptibility to antimicrobial peptide hLF1-11 could be determined. Moreover, a commercially available product containing hLF1-11 reduced onychomycosis caused by these fungi. Of the 53 volunteers involved in the research, 88.9% achieved an infection-reducing effect. During the 12 months of treatment, no adverse side effects were reported. Based on this, together with the previously reported safety of systemically applied hLF1-11 [22], the treatment can be considered safe. We followed the visual outcome from the treatment with both peptide concentrations wherein the peptide is applied to the eponychium and/or proximal nail fold. The growth of nails starts in the nail root, hidden under the cuticle. When new cells at the nail’s root grow, the new nail cells push out the old nail cells. These old cells flatten and harden thanks to keratin, a protein these cells make [39]. The newly formed nail then slides along the nail bed, the flat surface that protects nails. Without being bound by theory, it is thought that the antimicrobial peptide hLF1-11, when applied to the eponychium and/or the proximal nail fold, is incorporated in the newly formed nail and protects it from infection. Cell Penetrating Peptides (CPPs), such as hLF1-11, can penetrate through barriers like skin, cornea, and the blood-brain barrier (BBB). However, it is difficult to rank the efficacy of CPPs because transport efficiency and tissue selectivity depend not only on the CPP itself but also on the tissue itself. The antifungal effect of hLF1-11 also relates to direct interaction with the fungal surface and allows the killing of yeast cells [23,40].

Visible effects were already observed 3-4 weeks after the onset of treatment. When applied regularly, e.g., daily, the antimicrobial peptide will be continuously added to the new nail, protecting the growing nail from infection by fungi and/or bacteria. This evidence for an effective treatment is because there was a visual improvement in the nail appearance of an onychomycotic toenail, and thick nails became thinner and shinier as a response to the treatment as determined by a certified pedicurist.

Each volunteer visited the pedicurist once a month during the treatment period. Four outcome measures were followed during treatment: pain, infection, function/color of the toe (nail and skin), and the volunteer’s perception. 29% of volunteers reported relief of pain and discomfort and improved well-being as a considerable improvement. At the end of the period, 72% of the volunteers reported skin improvement and an 85% reduction in the thickness of the nails (Table 5). All fungal isolates obtained from the clipped toenails responded in vitro well to the antimicrobial activity of hLF1-11. The two volunteers that showed no antifungal effects with the peptide were proposed to use a concentration of 100 µg/mL per drop twice a day for the next set of months. For both these volunteers, a positive effect resulting in improved toenails was established within three months after the onset of this higher treatment regime. For three volunteers who received a low dose, only one yielded a culture of C. parapsilosis, and the other two subjects likely contained toenail infections with non-culturable microorganisms. From the nail samples in this study, 52.8% yielded a culture in concordance with the literature [6,36,41]. Ghannoum et al. discussed that reassessing the definition of an onychomycosis cure is critical [42]. In most investigations, many toenail samples collected from subjects contained visible fungal hyphae that subsequently failed to grow upon culture, and it was difficult to differentiate between “live” and “dead” fungi. It has been proposed that if there is no response to topical treatment for infected toenails, the length of treatment should be extended up to 18 months.

Many people suffering from onychomycosis do not have the discipline to complete a longitudinal treatment. With an average nail growth of about 1 mm per month (nail growth rate varies per person from 0.9-1.3 mm), treating onychomycosis should last at least 9 to 12 months. In volunteers receiving a low dose, the treatment showed an improvement after 4-7 months, whereas volunteers treated with the highest dose showed an improvement after 3-6 months. After 12 months, the big toe (hallux; digitus primus pedis) visual improvements were achieved in approximately 89% of the subjects. In addition, our study showed that hLF1-11 is highly effective in vitro against all fungi tested.

This study’s limitations were the arbitrary endpoint chosen based on the cure of the toenail infection, but we did not study re-infections in the long term. The cure outcome cannot be defined because multiple factors contribute to many people dealing with fungal re-infections of toenails. In addition to the medical background (e.g., genetic predisposition to fungal nails) [12], diabetes, or immune status, many of these patients were not evaluated separately [43]. Visual inspection by a pedicurist will be beneficial in determining treatment effectiveness. Moreover, regular visits to a pedicurist will improve foot hygiene, and toenail filing may improve therapeutical outcomes and reduce cross-contamination. Cross-infection can occur from materials (shoes and socks) directly contacting microorganisms growing on feet, including nails [4].

The stability of peptides might be a problem in making products to treat onychomycosis. In general, pharmacological conditions must be applied for convenient storage. Especially with a low concentration of peptides, they often lose activity during storage at room temperature (RT). The shelf life of a peptide formulation could be limited, especially when peptides contain amino acids like cysteine, tryptophan, and glutamine. The various heat treatments did not affect modified hLF1-11, as indicated by HPLC, mass spectrometry, and antibacterial and antifungal activity. The present formulation of hLF1-11 into PBS is stable enough to permit storage at room temperature for at least two years.

Conclusions

This study showed that a commercially available product containing the antimicrobial peptide hLF1-11 could be applied to treat onychomycosis effectively. The results showed the high efficacy of the hLF1-11 peptide in reducing fungal growth in the nails of volunteers with diagnosed onychomycosis within a few weeks of the treatment. No adverse effects were reported by any of the study participants, which suggests a promising application of this innovative formula. Fortunately, the formulation is stable enough to permit storage for at least two years.

Disclosure of conflict of interest

CB and MR are co-founders of CBMR Scientific Inc.