The pH-responsive SmrR-SmrT system modulates C. difficile antimicrobial resistance, spore formation, and toxin production

ABSTRACT

Clostridioides difficile is an anaerobic gastrointestinal pathogen that spreads through the environment as dormant spores. To survive, replicate, and sporulate in the host intestine, C. difficile must adapt to a variety of conditions in its environment, including changes in pH, the availability of metabolites, host immune factors, and a diverse array of other species. Prior studies showed that changes in intestinal conditions, such as pH, can affect C. difficile toxin production, spore formation, and cell survival. However, little is understood about the specific genes and pathways that facilitate environmental adaptation and lead to changes in C. difficile cell outcomes. In this study, we investigated two genes, CD2505 and CD2506, that are differentially regulated by pH to determine if they impact C. difficile growth and sporulation. Using deletion mutants, we examined the effects of both genes (herein smrR and smrT) on sporulation frequency, toxin production, and antimicrobial resistance. We determined that SmrR is a repressor of smrRT that responds to pH and suppresses sporulation and toxin production through regulation of the SmrT transporter. Further, we showed that SmrT confers resistance to erythromycin and lincomycin, establishing a connection between the regulation of sporulation and antimicrobial resistance.

IMPORTANCE

Clostridioides difficile is a mammalian pathogen that colonizes the large intestine and produces toxins that lead to severe diarrheal disease. C. difficile is a major threat to public health due to its intrinsic resistance to antimicrobials and its ability to form dormant spores that are easily spread from host to host. In this study, we examined the contribution of two genes, smrR and smrT, on sporulation, toxin production, and antimicrobial resistance. Our results indicate that SmrR represses smrT expression, while production of SmrT increases spore and toxin production, as well as resistance to antibiotics.

INTRODUCTION

Clostridioides difficile is a leading cause of antibiotic-associated diarrhea throughout the world (1, 2). Infections by C. difficile are easily transmitted due to the ability of the bacterium to form spores during transit through the host intestine. The spore form provides C. difficile extraordinary protection from the effects of oxygen, most disinfectants, and antibiotics (3–5). However, the conditions within the host and the bacterial factors that activate C. difficile spore formation are poorly understood.

One known environmental trigger of C. difficile sporulation is pH. C. difficile resides and replicates within the large intestine, where the pH can range from 5.2 to 7.8 (6). The pH of the colon can also vary with the health and diet of the host (6, 7). C. difficile can adapt to the changing pH of the intestine and can even modulate host pH (8, 9). Conditions of both relatively high and low physiological pH values can prompt sporulation in different C. difficile strains (10). However, it is less clear which factors encoded by C. difficile respond to changes in pH to affect sporulation initiation.

In this study, we investigated the effects of two C. difficile genes that are regulated in response to changes in pH, CD2505 and CD2506, which encode a transcriptional regulator and an associated transporter. We tested the hypothesis that these genes are involved in pH-dependent sporulation responses and examined the functions of both factors. We determined that CD2505 regulates the expression of both genes and suppresses sporulation by repressing expression of the CD2506 transporter. In addition, we found that the CD2506 transporter confers resistance to antibiotics, thereby linking antibiotic resistance and spore formation. Based on these results, we renamed the genes SmrR and SmrT for their respective roles as a repressor and transporter that modulate sporulation and macrolide/lincosamide resistance.

RESULTS

Expression of the smr operon is regulated by pH

In a prior investigation, we found that C. difficile sporulation frequency increased with corresponding increases in the environmental pH (10). In addition to sporulation, changes in growth rate, motility, and toxin expression were observed, suggesting widespread changes in transcription. One locus that changed considerably with pH variation was a predicted two-gene operon, CD2505-CD2506 (smrR-smrT), which demonstrated a significant decrease in expression as pH increased (Fig. 1). SmrR is annotated as a putative AcrR-like transcriptional regulator of the TetR family, while SmrT is predicted to encode an LmrB-like transporter of the major facilitator superfamily MFS. AcrR-like regulators are transcriptional repressors that respond to a variety of toxic substances and ions, and often repress the expression of antimicrobial transporters (11–14). The LmrB subfamily of transporters are drug/H⁺ antiporters that can confer resistance to a wide range of toxic substances (15–18).

Fig 1.

Expression of smrR is pH-dependent. Quantitative reverse-transcription PCR (qRT-PCR) analysis of smrR (CD2505; TetR-like regulator) expression in 630∆erm grown on 70:30 sporulation agar at pH values of 5.5, 6.5, 7.5, and 8.5 and sampled after 12 h, respectively. Expression levels were analyzed by one-way analysis of variance (ANOVA) and Dunnett’s multiple comparisons test compared to the pH 5.5. **P ≤ 0.01, ***P ≤ 0.001.

Based on the proximity and arrangement of smrR and smrT, we predicted that these genes constitute a dicistronic operon (Fig. S1). To examine co-transcription of smrR-smrT, we used cDNA generated from C. difficile strain 630∆erm grown on sporulation medium and tested for transcriptional linkage by PCR. A product was amplified across the smrR-smrT open reading frames, indicating that these genes are co-transcribed (Fig. S1).

SmrR suppresses sporulation of C. difficile

As both spore formation and smrRT expression correlate with changes in pH, we hypothesized that SmrR and/or SmrT may affect sporulation in C. difficile. To test this, we created deletion mutants in smrR and smrT by allelic exchange (19) (Fig. S2). The resulting mutants were then examined for the ability to produce spores in a modified 70:30 sporulation broth (pH 7.2) without Tris, to reduce buffering capacity (20–22). As shown in Fig. 2, the ∆smrR regulator mutant (MC1681) exhibited significantly greater sporulation frequency than the parent strain (WT, 630∆erm), while the ∆smrT transporter mutant (MC1682) had no change in sporulation. The ∆smrR phenotype was fully complemented when smrRT was reintroduced and expressed on an extrachromosomal plasmid, implicating SmrR as a suppressor of sporulation (Fig. S3).

Fig 2.

The smrR mutant has increased spore formation. Sporulation frequency of the wild type (630∆erm), the CD2505 mutant (MC1681), and the CD2506 mutant (MC1682) grown in 70:30 broth (pH 7.2) for 24 h. The means, individual data points, and standard deviations are shown for four independent replicates. Data were analyzed by one-way ANOVA and Dunnett’s multiple comparison test comparing the mutant strains to 630Δerm. *P ≤ 0.05; ns: not significant.

To determine if the increase in sporulation observed for the 630∆erm smrR mutant extends to other C. difficile isolates, we examined the impact of smrR on sporulation in the epidemic UK1 strain (027 ribotype). Using a CRISPR interference (CRISPRi) approach (23, 24), we knocked-down transcription of the smrR ortholog in UK1 (CDR20291_2397) As illustrated in Fig. S4, when smrR transcript level was decreased by CRISPRi, a dramatic increase in sporulation frequency was observed relative to the control strain, indicating that SmrR comparably impacts sporulation in divergent C. difficile strains.

SmrR exclusively regulates the smrRT operon

Since SmrR encodes an apparent transcriptional regulator, we considered that it likely regulated the transcription of another factor(s) to effect changes in sporulation. To determine the SmrR regulon, we assessed transcription during growth in sporulation broth by RNA sequencing (RNA-seq) for the smrR null mutant, relative to the parent strain (Table 1). We observed differential expression of one transcript in the smrR mutant—smrT—which was more than 6-fold greater in the smrR mutant. Given that no additional transcripts were differentially expressed in the smrR mutant, we concluded that SmrR represses only the smrR-smrT transcription under the conditions tested.

TABLE 1.

Genes differentially expressed in the ∆smrR mutant by RNA-seq

Locus taga	Predicted product	smrR/WT Log2 ratio	smrR/WT Fold change	P valueb
CD630_25060	Transporter, MDR family	2.63	6.18	4.20E-18

^a Genes associated with the selectable marker for the mutant were excluded.

^b P values were determined by Student’s t test compared to the parent strain.

To further define regulation of the smrRT operon, a transcriptional reporter fusion of the smr promoter and the alkaline phosphatase (AP) gene was constructed (Psmr::phoZ) and expression was assessed in the wild-type and ∆smrR strains grown in unbuffered sporulation medium at pH 6.2 (Fig. 3). Reporter expression from Psmr was pronounced in the parent strain carrying the fusion, in agreement with the transcription results for smrR under acidic conditions (Fig. 1). However, reporter expression was markedly higher in the ∆smrR mutant, which exhibited 8.9-fold greater activity than the parent strain. The difference in reporter expression from Psmr for the smrR mutant and parent strain (Fig. 3) was similar to the increased smrT expression that was observed for the ∆smrR mutant by RNA-seq (Table 1). Psmr::phoZ activity was unchanged by growth stage in the parent strain, suggesting that transcriptional repression by SmrR is not subject to regulation by stationary phase conditions or factors (Fig. S5). Together, these data are consistent with SmrR acting as the primary transcriptional regulator that represses expression of the smrRT operon.

Fig 3.

SmrR represses expression from the smr promoter. AP activity of the Psmr::phoZ fusion in C. difficile strain 630∆erm (WT, MC1775), the smrR mutant (∆smrR, MC1777), and respective promoterless control strains (WT, MC448 and ∆smrR, and MC1776). Strains were grown in 70:30 broth, pH 6.2 with 1 µg/mL thiamphenicol, and samples were taken during logarithmic growth (OD₆₀₀ 0.5). The means, individual data points, and standard deviations are shown for three independent replicates. Data were analyzed by two-way ANOVA with Tukey’s multiple comparison test. *P ≤ 0.05; ns: not significant.

Over-expression of the SmrT transporter increases spore formation and toxin production

Because smrT was the only transcript differentially regulated in the ∆smrR mutant, we considered that the basis for increased sporulation of the ∆smrR strain was over-expression of the transporter, SmrT. To test this hypothesis, we generated a construct to express smrT under a nisin-inducible promoter in the wild-type background (MC2508; 630∆erm, Pcpr::smrT). Sporulation frequency was then assessed in the smrT over-expressing strain and vector control (Fig. 4). Over-expression of smrT resulted in ~7.3-fold increase in spore formation relative to the control. These results suggest that increased transport of substrates and/or ions via SmrT triggers C. difficile to sporulate.

Fig 4.

Over-expression of smrT increases spore formation. Sporulation frequency of the wild-type control with vector (MC282; 630∆erm, pMC211) and over-expressing smrT (MC2508; 630∆erm, pMC1282). Strains were grown in 70:30 broth, pH 7.2 with 1 µg/mL thiamphenicol and 0.1 µg/mL nisin, and assessed for spore formation by phase contrast microscopy. The means, individual data points, and standard deviations are shown for three independent replicates. Data were analyzed by paired student’s T test. *P ≤ 0.05.

The initiation of sporulation and the production of the toxins TcdA and TcdB are often concurrent due to overlapping regulation (25, 26). Although no difference in toxin expression was observed in the ∆smrR mutant during exponential growth in sporulation medium (Table 1), expressions of both tcdA and tcdB were decreased in the ∆smrR mutant at stationary phase in the standard toxin quantification medium, TY (T4; Fig. 5A). However, toxin accumulation was significantly increased in the supernatant following 24 h of growth in TY, suggesting that either the timing of toxin expression is different in ∆smrR or the mutant releases more toxins due to lysis (Fig. 5B). Transcription of sporulation and toxin genes were not observed in the ∆smrR mutant during active growth in sporulation medium (Table 1), suggesting that a greater fraction of the population sporulates in response to elevated SmrT, but sporulation and toxin production do not occur prematurely. These data suggest that however increased SmrT perturbs the cell to increase toxin production, and it follows shared regulation that leads to increased sporulation.

Fig 5.

The smrR mutant has differential regulation and production of toxins. (A) qRT-PCR analysis of tcdA and tcdB expressions in TY broth at 4 h after the start of stationary phase (T4) for the ∆smrR mutant relative to 630∆erm (WT). (B) Quantification of TcdA and TcdB from supernatants of 630∆erm (WT) and the smrR mutant (MC1681) grown in TY for 24 h. The means, individual data points, and SEM (A) or SD (B) are shown for four (A) or three (B) independent replicates and analyzed by paired Student’s T test. *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

SmrT confers resistance to macrolide and lincosamide antibiotics

SmrT is an LmrB-like drug/H⁺ antiporter, which are known to confer resistance to a variety of antimicrobial compounds. SmrT shares 61% similarity/38% identity with LmrB of Bacillus subtilis (BLASTp); however, SmrT has not been implicated in C. difficile resistance to antimicrobials and its function is unverified. We examined resistance of the smrR and smrT mutants to several antimicrobials that are associated with similar transporters, including lincomycin, erythromycin, spectinomycin, and ethidium bromide (18, 27–29). The minimal inhibitory concentration (MIC) of the ∆smrR mutant for lincomycin (a lincosamide) was more than 20-fold greater, while the MIC for erythromycin (a macrolide) was more than 645-fold more than the parent strain (Table 2). Surprisingly, the inverse was not true for the ∆smrT mutant, which exhibited no apparent change in MIC for any of the antimicrobials tested. No change in resistance to spectinomycin or ethidium bromide was observed for either mutant. Thus, the absence of SmrT had negligible impact on antimicrobial resistance, but over-expression of the transporter dramatically increased C. difficile resistance to both lincomycin and erythromycin. These results are similar to the effects observed for sporulation with smrT deletion and over-expression.

TABLE 2.

MIC values for ∆smrR and ∆smrT mutants

Antimicrobial	WT	∆smrR	∆smrT
Lincomycin	25–50	1,000	25–50
Erythromycin	3.1	>2,000	3.1
Spectinomycin	1,000	1,000	1,000
Ethidium bromide	25	25	25

The increase in antimicrobial resistance for the ∆smrR mutant suggested that SmrR may respond to antimicrobials directly to regulate expression of the smrRT operon. To this end, we further investigated the transcription from the smr promoter in an assortment of antimicrobials using the Psmr::phoZ reporter (Fig. S6). While the wild type showed modest increases in activity in the presence of erythromycin and lincomycin, the differences were not significant when adjusted for multiple comparisons. No differences in activity were observed with any substance for the ∆smrR mutant, again supporting SmrR as the primary regulator of smrRT expression.

DISCUSSION

The primary objective of this work was to determine if the smrRT system functions as a link between the response of C. difficile to pH variation and sporulation. However, the results we obtained indicate that SmrRT not only connects sporulation to environmental pH but also links resistance to the lincosamide/macrolide antimicrobials with these physiological responses. We found that increased levels of SmrT promote sporulation, while SmrR reduces sporulation through repression of smrRT expression. Despite the increase in sporulation when SmrT was over-expressed, sporulation was not significantly impacted by removal of smrT, indicating that SmrT can promote sporulation, but is not needed for sporulation to occur. Further, growth and adaptation to pH (data not shown) was not affected in either the ∆smrR or the ∆smrT mutant, suggesting that the smr locus is not involved in altering the extracellular pH.

C. difficile is well known for resistance to a wide variety of therapeutic antimicrobials including tetracyclines, ß-lactams, aminoglycosides, macrolides, lincosamides, and fluoroquinolones (30–34). Despite the considerable impact of antimicrobial resistance on the spread of C. difficile infection (CDI), C. difficile antibiotic resistance profiles are rarely tested in clinical settings and the resistance mechanisms to non-CDI antimicrobials are understudied. While C. difficile strains are often associated with resistance to macrolides and lincosamides, the only resistance determinants known to confer significant resistance to these antibiotics in C. difficile are the erm (MLS) family elements that act via ribosomal methylation (35–37). Prior to the development of C. difficile genetic manipulation techniques, the predicted C. difficile efflux gene, cme, was examined for resistance functions in heterologous hosts, but resistance to erythromycin by Cme was negligible (38). The same study attempted to determine if SmrT (annotated as LinCD and lind) provided resistance to macrolides; however, they were unable to test its function due to lack of expression of the gene in Escherichia coli, Enterococcus faecalis, or Staphylococcus aureus (38). Resistance to macrolides by efflux has been proposed for strains that do not encode apparent erm mechanisms, but the genetic elements involved were not identified (39). Our data suggest that the robust resistance to macrolides and lincosamides observed in the ∆smrR mutant could account for high-level resistance observed in C. difficile isolates that lack erm/MLS resistance genes. Macrolide and lincosamide treatments may select for mutations in smrR or the SmrR-binding region of Psmr, which would relieve repression of smrRT, since increased expression of SmrT would confer significant resistance.

Several questions remain about SmrRT, including how it effects sporulation in the host and how the intestinal environment affects smrRT regulation. We observed robust expression of smrR in low pH conditions, suggesting that low intestinal pH could trigger SmrR derepression of the smr promoter. Since expression from the smr promoter was not significantly increased by either erythromycin or lincomycin, these antibiotics probably do not impact the typical regulation of this operon in the intestine. In addition to regulation by pH, data from other studies suggest that smrRT expression may be influenced by nutritional availability. Expression of smrR-smrT was found to increase 4- to 6-fold in the presence of glucose and was partially repressed by the carbon catabolite regulator, CcpA (40). In addition, expression of smrRT decreased about 5-fold in a codY mutant, suggesting that the availability of branched-chain amino acids or GTP may promote transcription and activity of the transporter (41). CcpA and CodY each repress toxin and sporulation, which are both impacted by SmrT, but how SmrR-SmrT would impact regulation through these regulators is not apparent. Further study is needed to understand function of SmrR and SmrT in the host, as well as their roles in pathogenesis.

MATERIALS AND METHODS

Bacterial strains and growth conditions

Bacterial strains and plasmids used in this study are listed in Table 3. An anaerobic chamber (Coy Laboratory Products) was used to cultivate C. difficile in an atmosphere of 10% H₂, 5% CO₂, and 85% N₂, at 37°C (42, 43). Strains were routinely grown fresh from stock in brain heart infusion supplemented with 0.5% yeast extract (Βecton Dickinson Company) broth or agar plates. Cultures were supplemented with 0.1% taurocholate to induce germination and 0.2% fructose to prevent sporulation, whenever needed. Strains were grown in the presence of 1–5 µg/mL thiamphenicol, 2–5 µg/mL erythromycin, or 100 ng/mL anhydrotetracycline (ATc), when needed for plasmid maintenance or selection (Sigma-Aldrich). E. coli was grown at 37°C in LB medium with 100 µg/mL ampicillin and/or 20 µg/mL chloramphenicol (Sigma-Aldrich), as needed for plasmid maintenance. Growth and pH were measured using a spectrophotometer and a portable pH/ORP meter (HI98190; HANNA instruments), respectively.

TABLE 3.

Bacterial strains and plasmids

Plasmid or strain	Relevant genotype or features	Source, construction, or reference
Strains
E. coli
DH5α Max Efficiency	F− Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk−, mk+) phoA supE44 λ−thi−1 gyrA96 relA1	Invitrogen
HB101 pRK24	F− mcrB mrr hsdS20(rB− mB−) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20	B. Dupuy
C. difficile
630Δerm	ErmS derivative of strain 630 (ribotype 012)	Nigel Minton, (44)
UK1	Clinical isolate (ribotype 027)	(45)
MC282	630Δerm pMC211	(21)
MC310	630Δerm spo0A::erm	(21)
MC324	630Δerm pMC123	(21)
MC448	630Δerm pMC358	(46)
MC855	630Δerm spo0A::erm pMC123	(47)
MC1681	630Δerm ΔsmrR::ermB	This study
MC1682	630Δerm ΔsmrT	This study
MC1771	MC1681 ΔsmrR pMC123	This study
MC1775	630Δerm pMC1019	This study
MC1776	630Δerm ΔsmrR pMC358	This study
MC1777	630Δerm ΔsmrR pMC1019	This study
MC1861	MC1681 ΔsmrR pMC1059	This study
MC2186	UK1 pMC1123	This study
MC2263	UK1 pMC1178	This study
MC2508	630Δerm pMC1282	This study
Plasmids
pIA33	Pxyl::dCas9-opt Pgdh::sgRNA-rfp catP	(23)
pJIR1457	ermB oriCP oriEC oriT	(48)
pMSR	pseudo-suicide plasmid used for allelic exchange	(19)
pRK24	Tra+, Mob+; bla, tet	(49)
pMC123	E. coli-C. difficile shuttle vector; bla, catP	(50)
pMC211	pMC123 with cprA promoter, bla catP	(21)
pMC358	pMC123::phoZ	(46)
pMC914	pMSR with flanking homology for CD2506 deletion	This study
pMC946	pMSR with CD2505 homology regions flanking ermB	This study
pMC1019	pMC123 with Psmr::phoZ	This study
pMC1059	pMC123 with PsmrRT	This study
pMC1123	PcprA::dCas9-opt Pgdh::sgRNA-neg catP	(24)
pMC1178	PcprA::dCas9-opt Pgdh::sgRNA-CDR20291_2397 catP	This study
pMC1282	pMC211 with Pcpr::smrT	This study

Strain and plasmid construction

Primer design and the template for PCR reactions were based on C. difficile strain 630, unless otherwise noted (GenBank accession NC_009089.1). Genomic DNA (gDNA) was isolated from C. difficile strains using a modified Bust ‘N’ Grab protocol (51, 52). The Benchling CRISPR Guide RNA Design tool was used to create the sgRNA targeting CDR20291_2397, which was generated by PCR (23, 24). The details of vector construction are provided in Table S1. The oligonucleotide primers used in this study are listed in Table 4. Plasmids were introduced to C. difficile by conjugation with E. coli, as previously described (53). After conjugation with C. difficile, E. coli was counterselected using 100 µg/mL kanamycin and gene deletions were selected and screened for as previously described (19, 54).

TABLE 4.

Oligonucleotides

Primer	Sequence (5’→3’)a	Use/locus tag/reference
oMC44	CTAGCTGCTCCTATGTCTCACATC	rpoC qPCR (50)
oMC45	CCAGTCTCTCCTGGATCAACTA	rpoC qPCR (50)
oMC2185	TAGAAATACGGTGTTTTTTGTTACCCTAAGTTTAAACCCTGAGGAGAATAATCTTTGGGC	Forward primer for upstream smrR, Gibson assembly into pMSR with PmeI site
oMC2186	ATAATCTCATGACCAAAATCCCTTAACGTTTAT TATCTCCTTTCACGCAAAAACGTTTAG	Reverse primer for upstream smrR, Gibson assembly with ermB
oMC2187	CTAAACGTTTTTGCGTGAAAGGAGATAATAAACGTTAAGGGATTTTGGTCATGAGATTAT	Forward primer for ermB cassette, Gibson assembly with 5’ smrR
oMC2188	CCTTTTTTATTGTTACTTTGGGTTTCCATAATCTCCTTGGAAGCTGTCAGTAGTATACCT	Reverse primer for ermB cassette, Gibson assembly with 3’ smrR
oMC2189	AGGTATACTACTGACAGCTTCCAAGGAGATTATGGAAACCCAAAGTAACAATAAAAAAGG	Forward primer for 3’ smrR, Gibson assembly with ermB
oMC2190	TTTTGGTCATGAGATTATCAAAAAGGAGTTTAAACCTAACCATCCTGATAAAGTTGGACC	Reverse primer for 3’ smrR, Gibson assembly into pMSR with PmeI site
oMC2321	CCTGACTTTTGAGCATCTTTATTC	∆smrR screening
oMC2324	TTTTTGAGTTTCCCCAACATTTC	∆smrR screening
oMC2362	AGTTAAACAGAAAGATAATTGCTGTATGG	smrR qPCR
oMC2363	ACTTGTAGCCTTACGTTGTTCTTC	smrR qPCR
oMC2366	GAAATACGGTGTTTTTTGTTACCCTAAGTTTAAACCTGAAGAACAACGTAAGGCTACAAG	Forward primer for upstream of smrT, Gibson assembly into pMSR with PmeI site
oMC2367	AATCAATTAAAAAAGGAGACGTTATAAATTTACAGAAAAGGAGTTATCCTATGAACAATTTA	Forward primer for downstream of smrT, Gibson assembly to upstream fragment
oMC2368	TAAATTGTTCATAGGATAACTCCTTTTCTGTAAATTTATAACGTCTCCTTTTTTAATTGATT	Reverse primer for upstream of smrT, Gibson assembly to downstream fragment
oMC2369	TTTTGGTCATGAGATTATCAAAAAGGAGTTTAAACGCAGTGAATATCCCTTGTAGGC	Reverse primer for downstream smrT, Gibson assembly into pMSR with PmeI site
oMC2541	GAAAATAATGACATTCCATCATCAGA	∆smrT screening
oMC2544	AGGTATTAAATGATGGTATGGGAC	∆smrT screening
oMC2620	TTCTGGTTCTCTAATGCCACTTT	smrT qPCR
oMC2621	GCTGGAGCAAATCCTACTGTAATA	smrT qPCR
oMC2624	TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGACTGAGGAGAATAATCTTTGGGC	Forward primer for PsmrRT complementation
oMC2627	ACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCGGAGTTATCACAGAGCAAACT	Reverse primer for PsmrRT complementation
oMC2692	GGCGAATTCGAGCAAAAATTATTGCTACACAAA	Forward primer for Pcd2505::phoZ
oMC2693	GCCGGATCCTTTATTATCTCCTTTCACGCAAA	Reverse primer for Pcd2505::phoZ
oMC3088	TTGCAATAAAGTGTGCTATAATTAAACTGTAAATGGCCA	Forward primer to Gibson assemble CRISPRi sgRNAs into pMC1123
oMC3089	CCTTTTCTATTTAAAGTTTTATTAAAACTTATAGGATCCGCGGCCGC	Reverse primer to Gibson assemble CRISPRi sgRNAs into pMC1123
oMC3139	AATTAAACTGTAAATGGCCAATAAAAAAATTATACGTCGAGTTTTAGAGCTAGAAATAGC	Forward primer for sgRNA – CDR2397 fragment
4084	AACTTATAGGATCCGCGGCCGCTAGTCAGACATCATGCTGATCTAGA	(23)

^a Restriction sites used for cloning and sgRNA retargeting sequences are underlined.

Quantitative reverse-transcription PCR (qRT-PCR)

C. difficile cultures were grown on 70:30 sporulation agar (−Tris) at pH values of 5.5, 6.5, 7.5, and 8.5, respectively; harvested after 12 h (H12) into ice-cold water:ethanol:acetone (3:1.5:1.5); and stored at −70°C. RNA isolation, DNase I treatment, and cDNA synthesis was performed as previously explained (21, 50, 55). qRT-PCR was performed in technical triplicate with 50 ng of cDNA per reaction using the SensiFAST SYBR & Fluorescein Kit from Bioline, on a Roche Lightcycler 96. Samples containing RNA without the addition of reverse transcriptase were used to control for contaminating gDNA. Assay results (Ct values) were averaged and analyzed by the comparative cycle threshold method with the housekeeping rpoC transcript as a normalizer (56). The data are presented as the means, individual values, and standard deviation of the means for at least three independent biological replicates. For expression by pH condition, a one-way analysis of variance (ANOVA) and Dunnett’s test were performed for statistical comparison to pH 5.5 using GraphPad Prism version 10.0.2.

Sporulation assays

Sporulation assays were performed as previously described in 70:30 sporulation medium, without the addition of Tris base and pH adjusted as previously noted (22, 57). UK1 sporulation assays were performed on standard 70:30 agar supplemented with 2 µg/mL thiamphenicol and 1 µg nisin for plasmid maintenance and induction of expression, respectively. Sporulation frequency was determined by ethanol resistance and/or phase contrast microscopy (22, 57). A spo0A mutant (strain MC310; sporulation defective) was used as a negative sporulation control in all assays. Statistical significance was determined by one-way ANOVA with Dunnett’s or Sidak’s post-test, or Student’s t test, as indicated for the specified comparison using GraphPad Prism version 10.0.2.

RNA sequencing analysis

C. difficile strain 630∆erm and the smrR mutant (MC1681) were grown in 70:30 sporulation broth (−Tris, pH 7.2) and harvested during logarithmic growth for RNA, as described for qRT-PCR. Following DNase I treatment, samples were submitted to the Microbial Genomics Sequencing Center for library preparation using the Illumina Stranded Total RNA prep Ligation with Ribo-Zero Plus kit and 10 bp IDT for Illumina indices. Sequencing of the RNA was performed using a NextSeq2000 instrument to yield 2 × 50 bp reads. Demultiplexing, quality control, and adapter trimming were performed with bcl-convert (v3.9.3; Illumina). Geneious Prime v2022.2.2 was used to map the reads to the reference genome (630; NC_009089.1). The expression levels were calculated and then subsequently compared using DESeq2 (58). DESeq2 utilizes the Wald test to calculate P values that are then adjusted using the Benjamini-Hochberg test (58). RNA-seq raw sequence read files were deposited to the NCBI Sequence Read Archive BioProject PRJNA1017478.

AP reporter assays

C. difficile strains containing the AP transcriptional reporter fusions were grown in 70:30 medium (−Tris) at pH 6.2 and cells were harvested during logarithmic or stationary phase, as indicated. AP assays were performed as previously described (46), without chloroform. Technical duplicates were averaged for each sample, and the results provided as the individual data, mean, and standard deviation of the mean for three biological replicates. Statistical significance was determined by either a one-way ANOVA or a two-way ANOVA with Tukey’s multiple comparison’s test or Student’s t test, as indicated for the specified comparison, using GraphPad Prism version 10.0.2.

MIC

MICs for antimicrobials against C. difficile strains were performed by microdilution assay in Mueller Hinton broth (BD Difco), as previously described (59, 60). Briefly, active cultures were grown to mid-logarithmic phase in MH broth (OD₆₀₀ of 0.45), diluted 1:10, and 15 µL inoculated into pre-reduced U-bottom microtiter plates containing 135 µL of antimicrobials at 2-fold dilutions in MH broth. Antimicrobials tested included lincomycin (Sigma), erythromycin (Sigma), spectinomycin (Thermo-Scientific), and ethidium bromide (Sigma). Each assay was performed in technical duplicate. Negative and positive controls for contamination and growth, respectively, were included. Assays were performed for a minimum of three biological replicates and the MIC was recorded as the lowest concentration of an antimicrobial for which no visible growth was observed.

Detection of C. difficile toxins A and B

Strains were grown in BHIS broth to an OD₆₀₀ of 0.5 and diluted 1:10 into TY medium (pH 7.4). After 24 h, cells were harvested and the supernatant was assayed using a kit for the simultaneous detection of C. difficile toxins A and B from TGCbiomics (catalog no. TGC-E001-1), according to the manufacturer’s instructions. Technical duplicates were averaged and normalized per milliliter of supernatant. The results represent three independent experiments and are presented as the individual data, the means, and the standard deviation of the means. Statistical significance was determined using a two-tailed Student’s t test comparing the mutant to the parent strain using GraphPad Prism version 10.0.2.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/iai.00461-23.

Supplemental material. iai.00461-23-s0001.pdf.

Figures S1 to S6 and Table S1.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.