Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2024 Mar 20;14(4):115. doi: 10.1007/s13205-024-03957-0

Rapid induction of dopaminergic neuron-like cells from human fibroblasts by autophagy activation with only 2-small molecules

Natchadaporn Sorraksa 1, Palakorn Kaokaen 1, Phongsakorn Kunhorm 1, Nudjanad Heebkaew 1, Wilasinee Promjantuek 1, Parinya Noisa 1,✉
PMCID: PMC10954591  PMID: 38524239

Abstract

The dopaminergic neurons are responsible for the release of dopamine. Several diseases that affect motor function, including Parkinson's disease (PD), are rooted in inadequate dopamine (DA) neurotransmission. The study's goal was to create a quick way to make dopaminergic neuron-like cells from human fibroblasts (hNF) using only two small molecules: hedgehog pathway inhibitor 1 (HPI-1) and neurodazine (NZ). Two small compounds have been shown to induce the transdifferentiation of hNF cells into dopaminergic neuron-like cells. After 10 days of treatment, hNF cells had a big drop in fibroblastic markers (Col1A1, KRT18, and Elastin) and a rise in neuron marker genes (TUJ1, PAX6, and SOX1). Different proteins and factors related to dopaminergic neurons (TH, TUJ1, and dopamine) were significantly increased in cells that behave like dopaminergic neurons after treatment. A study of the autophagy signaling pathway showed that apoptotic genes were downregulated while autophagy genes (LC3, ATG5, and ATG12) were significantly upregulated. Our results showed that treating hNF cells with both HPI-1 and NZ together can quickly change them into mature neurons that have dopaminergic activity. However, the current understanding of the underlying mechanisms involved in nerve guidance remains unstable and complex. Ongoing research in this field must continue to advance for a more in-depth understanding. This is crucial for the safe and highly effective clinical application of the knowledge gained to promote neural regeneration in different neurological diseases.

Keywords: Human fibroblasts, Transdifferentiation, Dopaminergic neuron-like cells, Parkinson's disease, Autophagy

Introduction

Parkinson's disease (PD) is the degeneration or death of dopaminergic neurons in the pars compacta region of the substantia nigra in the central brain. This leads to an impairment in the brain's ability to produce dopamine (DA) (Maiti et al. 2017; Rai and Singh 2020; Yadav et al. 2017), with a significant reduction ranging from 44 to 98% during the advanced stages of the disease (Kordower et al. 2013). This impacts approximately 1% of individuals aged 60 and above and between 1 and 3% of those aged 80 and above. It is crucial to note that these statistics do not account for undiagnosed cases (Driver et al. 2009; De Lau and Breteler 2006). The inability of the brain to direct the target organs to function correctly results in a variety of symptoms, including rest tremor, rigidity, flexed posture, slow motion (bradykinesia), and postural instability in patients with this disease (Surmeier 2018). This is due to the constant neurochemical imbalance. It was causing the expression of the enzyme tyrosine hydroxylase (TH) to decrease. TH is the rate-limiting enzyme in the production of DA and other catecholamines (Tabrez et al. 2012) and catalyzes the conversion of L-tyrosine to L-3,4-dihydroxyphenylalanine (Daubner et al. 2011; Wang et al. 2016). TH plays an important role in the neural transmission and hormonal function of catecholamines (CA) (Nagatsu 2006). TH is also involved in many neurological disorders, such as PD, Alzheimer's disease (AD), Zeimer, schizophrenia and dystonia; Therefore, (Peralta and Cuesta 2017) it has also been shown that abnormalities in the regulation of TH activity are a factor in the etiology of PD. The progressive loss of TH-positive markers in dopaminergic neurons is a characteristic of PD. In different visualization methods, utilizing the immunohistochemistry technique with a monoclonal TH antibody proves to be an effective and accurate approach for marking dopaminergic neurons in various cultured cells (Rausch et al. 2022). From the TH hypothesis of PD to modern strategies: a short historical overview.

Previous research found that transdifferentiation is a transformation whereby one mature cell type is transformed into another mature cell type without passing through neural progenitor or stem cell intermediates (Csordás et al. 2021; Shen et al. 2004; Graf and Enver 2009). To generate specific cells with new cellular phenotypes (Sisakhtnezhad and Matin 2012; Connell et al. 2015), cell fate manipulation can be performed. Through artificial or exogenous controls such as small molecules (Kalra et al. 2021), small molecules are widely used in cell reprogramming and differentiation, which can promote the efficiency of induction and serve as a potential tool to carry out cell replacement (Qin et al. 2017; Zentelytė et al. 2021).

It is well known that there is a crucial role in determining the characteristics of dopaminergic neurons, and growth is essential for the necessary differentiation of dopaminergic neurons directly from fibroblasts (Caiazzo et al. 2011; Pfisterer et al. 2011; Kim et al. 2011; Kim 2011). Small molecules have been investigated in conjunction with key decoding factors to generate functional neurons efficiently (Yoo et al. 2011; Yang et al. 2019; Xu et al. 2020). The expression of DA neuron markers at the gene and protein levels serves as evidence that this study's focus is on quickly inducing DA-like neurons from hNF cells using just two small molecules, HPI-1 and NZ. Previous research has shown that the use of small molecules, such as 1-azakenpaullone (1-AZA), 5-azacytidine (5-AZA), γ-secretase inhibitor (DAPT), and retinoic acid (RA), can enhance the induction of fibroblast cells into neurons by upregulating neural markers like Nestin, Sox2, Pax6, and Tuj1 (Rujanapun et al. 2019). However, these approaches have not successfully induced adult neurons.

The objective of the research was to screen a small-molecule cocktail together with HPI-1 and NZ, resulting in a chemical cocktail formula that could differentiate hNF cells into dopaminergic neuron-like cells by stimulation. Expression of dopamine markers.

Materials and methods

Chemicals and reagents

Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12), Neurobasal Medium (NB), Fetal Bovine Serum (FBS), N2-Supplement (N2), and Non-essential Amino Acids (NAA) were obtained from Gibco (Gibco, CA, USA), Penicillin Streptomycin (Pen Strep), Antibody TH, Neuron-specific Class III beta-tubulin (TUJ1), Collagen 1A1, Antibody Pax6 (Paired Box Protein 6), 5-AZA, 1-AZA, RA, HPI-1, and NZ were purchased from Merck (Merck KGaA, Darmstadt, Germany), 4,6-diamidino-2-phenylindole (DAPI), and dimethyl sulfoxide (DMSO) were purchased from Sigma–Aldrich Chemical Co. (St. Louis, MO), DA Elisa kit (Elabscience, Wuhan, Hubei, China).

Culture of normal and dopaminergic differentiation conditions

hNF cell lines were obtained from the American Type Culture Collection (ATCC®, Manassas, VA, USA). The cells in the untreated group were grown in normal medium that consists of DMEM/F12 and NB, which had penicillin-streptomycin, 10% FBS,

1% non-essential amino acids, 1% L-glutamine, 1% NAA, 1% penicillin-streptomycin, 10 µM RA, 10 µM 5-AZA, 10 µM 1-AZA, and 10 µM DAPT. The dopaminergic differentiation medium is the same as the normal medium, but 10 µM HPI-1 and 10 µM NZ were added. Cells were incubated at 37 °C in 5% (v/v) CO2. The medium was changed every other day for 10 days.

RNA isolation and reverse transcription (RT-PCR)

To determine the expression of neuronal markers, dopaminergic neuron-specific genes were assessed after the treatment. The hNF cells were seeded in

6-well plates at a density of 5 × 105 cells/well. The cells were treated with HPI-1 and NZ together for 10 days. Thereafter, the total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel, Dueren, Germany), according to the manufacturer’s protocol. Subsequently, 1 µg of RNA was used for complementary DNA (cDNA) synthesis by ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO CO., LTD., Japan). The PCR was done in a Biorad/C1000Touch Thermocycle (Biorad, CA, USA) with specific primers. The amplified cDNA products were found using a 1.5% agarose gel for electrophoresis. The gel was visualized using ethidium bromide staining and gel documentation. Using the GAPDH gene as an internal control, normalization allowed for the quantification of a target gene's relative expression level.

Immunofluorescence staining

The hNF cells were seeded in 24-well plates (with sterilized coverslips) at a density of 2 × 105 cells/well. The cells were then treated with either 10 µM HPI-1 or 10 µM NZ together for 10 days before further characterization. After 10 days, cells were fixed with 4% paraformaldehyde for 30 min at room temperature. Cells were washed with PBS twice and permeabilized with 3% bovine serum albumin (BSA) in 0.1% triton-X 100 of PBS for 20 min at 4 °C. After 20 min, cells were incubated with primary antibodies: TUJ1, LC3, and TH antibodies (1:1000) and Col1A1 antibodies (1:500) (Sigma-Adrich Co.). All incubations were performed overnight, and then the samples were incubated with the secondary antibody for 30 min. Nuclei were stained with DAPI. All samples were observed under the fluorescence microscope (ZOETM fluorescence cell imager, BioRad, USA).

Monodansylcadaverine (MDC)

Monodansylcadaverine (MDC) is a lysosomotropic compound and is useful for the identification of autophagic vacuoles. hNF cells were seeded in 24-well plates (with sterilized coverslips) at a density of 2 × 105 cells/well. The cells were then treated with either 10 µM HPI-1 or 10 µM NZ together for 10 days before further characterization. After 10 days, cells were fixed in 4% paraformaldehyde (PFA) for 30 min at 37 °C, and then the cells were washed with PBS. Cells were incubated with 50 µM MDC at 37 °C for 20 min. After 20 min, cells were washed with PBS three times, and then cells were observed under a fluorescent microscope (ZOETM fluorescence cell imager, BioRad, USA).

Chemiluminescent enzyme-linked immunosorbent assay (ELISA)

The hNF cells were seeded in 24-well plates (with sterilized coverslips) at a density of 2 × 105 cells/well. The amount of dopamine (DA) released was measured by taking the supernatant from cells that had not been treated and cells that had been treated with HPI-1 and NZ together for 10 days. The ELISA assay was then used to find the levels. The competitive-ELISA assay with the DA ELISA Kit (Elabscience, Wuhan, Hubei, China) was used to find the secretion level of DA. To put it simply, 50 µl of each sample and 1x biotinylated detection antibody solution were put into micro-ELISA plates that already had DA on them. The competing reaction was incubated at 37 °C for 45 min. After washing 2–3 times with washing buffer, horseradish peroxidase (HRP)-conjugated avidin solution was added to 100 µl/well and incubated at 37 °C for 30 min. Then, the TMB substrate solution was added, and the enzyme-substrate reaction was measured spectrophotometrically at a wavelength of 450 nm.

Statistical analysis

All experiments were performed in triplicate, and the data were expressed as mean ± SD (standard deviation) (Sdek et al. 2006). Statistical analysis was performed using SPSS (version 26.0, SPSS Inc., USA). Significant differences between the treatment and control were determined by one-way ANOVA analysis, followed by student T-tests, and *p < 0.05, **p < 0.01, and ***p < 0.001 were considered statistically significant.

Results

Neuronal Transdifferentiation of Human Neonatal Fibroblasts by NZ and HPI-1

To examine the neuro-promoting effect, hNF cells were treated with the small molecule HPI-1 or NZ alone in a normal medium for 10 days, after which RT-PCR was used to examine gene-level expression and check protein levels using immunofluorescence. The results showed that the cells in the HPI1-treated group had slender, fusiform, and branched cells similar to neurons compared to the day 0 and NZ groups (Fig. 1A). Both the HPI-1 or NZ groups showed that expression of the neural genes PAX6, SOX1, Tuj1 (Fig. 1D–E) and Tuj1 protein (Fig. 1F–G) was significantly increased compared to day 0, while there was a decrease in extracellular matrix genes such as elastin, KRT18, Col1A1 (Fig. 1B–C) and Col1A1 protein (Fig. 1F–G). These results suggest that groups receiving the small molecule HPI-1 or NZ were able to induce neural marker expression and found that HPI-1 had higher neural marker expression than the NZ group (Table 1).

Figure 1.

Figure 1.

Open in a new tab

Neurogenesis of fibroblasts by HPI-1 or NZ. The morphology of differentiated hNF cells on days 0, day 10 untreated, day 10 treated with 10 M HPI-1, and day 10 treated with 10 M NZ. A The expression of extracellular matrix genes (Col1A1, Col1A2, Col3A1, KRT18, and Elastin) was assessed by RT-PCR, and GAPDH was used as the internal control. B Relative expression (fold) of the extracellular matrix gene. C The expression of neural genes (Tuj1, Sox1, and Pax6) was assessed by RT-PCR. D Relative expression (fold) of a neural gene. E The expression of Tuj1 and Col1A1 proteins was observed by immunofluorescence. Scale bar = 100 µm. F The relative fluorescence intensity of Tuj1 and Col1A1 proteins in differentiated hNF cells was normalized with the undifferentiated control cells. G The staining cells were observed under a fluorescence microscope. Values are expressed as the mean ± SD (n = 3). Significance vs. control cells is indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.

Table 1.

The primer list used for real-time PCR experiments.

Gene Forward Reverse Size (bp) Temperature (Co)
Dopaminergic-specific genes
 TH TCATCACCTGGTCACCAAGTT GATATGgTCTTCCCGGTAGC 280 58
 EN1 CCCTGGTTTCTCTGGGACTT GCAGTCTGTGGGGTCGTATT 162 54
 Pixt3 ACTAGGCCCTACACAC TTTTTTTGACAGTCCGC 186 52
 Nurr1 TGCTGCCCTGGCTATGGTCA AATGCGCTGTAGCCCCTGTG 202 44
 Lmx1b AAGATGGGGACATGAAGCCG TCGATGTCATGGAAGATGGAGT 484 50
 Foxa2 CTGGTCGTTTGTTGTGGC AGTTCATGTTGGCGTAGGGG 449 48
Apoptosis genes
 BAX AAGCTGAGCGAGTGTCTCAAGCGC TCCCGCCACAAAGATGGTCACG 366 59
 BCL-2 CGCATCAGGAAGGCTAGAGT AGCTTCCAGACATTCGGAGA 189 53
 P53 CCCCTCCTGGCCCCTGTCATCTTC GCAGCGCCTCACAACCTCCGTCAT 265 64
Autophagy-related gene
 LC3 CTTCGCCGACCGCTGTAA GGTGCCTACGTTCTGATCTGTG 261 51
 ATG5 TGGCTGAGTGAACATCTGA AAGTAAGACCAGCCCAGTT 246 56
 ATG12 GAGACACTCCCATAATGAA GTAGGACCAGTTTACCATC 207 56
Neurogenesis genes
 TUJ1 GCTCAGGGGCCTTTGGACATCTCTT TTTTCACACACTCCTTCCGCACCA CATC 148 63
 PAX6 TAAGGATGTTGAACGGGCAG TGGTATTCTCTCCCCCTCCT 126 56
 SOX1 TCTGTTAACTCACCGGGACC ACTCCAGGGTACACACAGGG 148 68
Extracellular matrix-related genes
 Elastin AGCTCCAACCCCGTAAGTAGGAAT AGCTCCAACCCCGTAAGTAGGAAT 275 56
 Col1A1 GGGCAAGACAGTGATTGAATA ACGTCGAAGCCGAATTCCT 108 51
 KRT18 GCTGGAAGATGGCGAGGACTTT TGGTCTCAGACACCACTTTGCC 498 54
 GAPDH ACCTGACCTGCCGTCTAGAA TCCACCACCCTGTTGCTGTA 351 55
Open in a new tab

Cotreatment with the small molecules HPI-1 and NZ-induced neuronal-Like cells in human neonatal fibroblasts

When HPI-1 and NZ were used separately in the first experiments, it was found that the cells treated with HPI-1 had higher levels of Tuj1 protein expression than the cells treated with NZ. However, there was almost no neuronal cell transformation in the cell shape. Therefore, we combined HPI-1 and NZ in this experiment. For the differentiation of hNF cells into neuronal-like cells by supplementing the differentiation medium with small molecules of HPI-1 and NZ. The shape of cells that changed into neuronal-like cells was studied on days 0, 5, and 10 of culture in a differentiation medium when the cells were not treated, treated with HPI-1, or treated with NZ. The morphology of the cells changed slightly on day 5. The combined group of HPI-1 and NZ showed a bigger change from a spindle-shaped structure to a bipolar structure during the 10 days of induction (Fig. 2A). This was compared to cell cultures that were not treated and those that were treated with HPI-1 and NZ. In the HPI-1 and NZ-treated groups for 10 days, there was a substantial decrease in the number of fibroblast genes (CO1A1, KRT18, CO2A2, CO3A1, and Elastin) as compared to the untreated group on days 0, 5, and 10 (Fig. 2B-C). Comparing the HPI1- and NZ-treated groups to the untreated group, the expression of the neural gene was analyzed. A lot more TUJ1, SOX1, and PAX6 genes were expressed on day 10 in the HPI-1 and NZ groups than in the untreated group on days 0, 5, and 10 (Fig. 2D–E). According to immunofluorescence results from the HPI-1 and NZ groups on day 10, there was an increase in TUJ1 expression and a decrease in Col1A1 expression, which was consistent with the protein response (Fig. 2F-G). Over a 10-day period, small compounds (HPI-1 and NZ) were able to transform hNF cells into neuronal-like cells. This discovery implied that small chemicals can be utilized to stimulate the transdifferentiation of human fibroblast cells into neuronal-like cells.

Figure 2.

Figure 2.

Open in a new tab

Induction of neurons in human fibroblasts by concomitant small molecules HPI-1 and NZ. The morphology of differentiated hNF cells on days 0, day 10 untreated, day 5, and day 10 treated with concomitant 10 M HPI-1 and 10 M NZ. A The expression of extracellular matrix genes (Col1A1, Col1A2, Col3A1, KRT18, and Elastin) was assessed by RT-PCR, and GAPDH was used as the internal control. B Relative expression (fold) of the extracellular matrix gene. C The expression of neural genes (Tuj1, Sox1, and Pax6) was assessed by RT-PCR. D Relative expression (fold) of a neural gene E The expression of Tuj1 and Col1A1 proteins was observed by immunofluorescence. Scale bar = 100 µm. F The relative fluorescence intensities of Tuj1 and Col1A1 proteins. G The staining cells were observed under a fluorescence microscope. Values are expressed as the mean ± SD (n = 3). Significance vs. control cells is indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.

Dopaminergic neuron-like cells were produced by the co-treatment of only two small molecules, HPI-1 and NZ.

Our previous findings demonstrated that HPI-1 and NZ can activate hNF cells in neuron-like cells. To find out if HPI-1 and NZ could make dopaminergic neurons grow in fibroblast cells, 10 days of treatment with 10 µM HPI-1 and 10 µM NZ were used on hNF cells. The cells were then checked for dopaminergic neuron gene expression. RT-PCR analysis determined the upregulation of dopaminergic neuron genes, including TH, EN1, Nurr1, Foxa2, Lmx1b1, and Pitx3, as well as dopaminergic neuron-inducing activity with HPI-1 and NZ in hNF cells. This was followed by immunofluorescence analysis of dopaminergic neuronal proteins (Fig. 3A–B). As compared to days 0, 5, and 10 in the untreated groups, the data showed that HPI-1 and NZ increased the expression of Tuj1 and dopamine. To confirm the expression of DA protein using the DA Elisa kits, the HPI-1 and NZ combination groups demonstrated up to 7 pg/ml of dopamine protein. Still, the untreated control group was not detected (Fig. 3H). According to our findings, hNF cells changed into cells that looked like dopaminergic neurons and showed signs of being dopaminergic neurons 10 days after treatment when HPI-1 and NZ were given together. Notably, HPI-1 and NZ by themselves were not able to turn on the dopaminergic genes and proteins. This is why dopaminergic neurons in hNF cells needed a combined treatment to change types. Given that Parkinson's disease is a neurodegenerative disorder brought on by the death of dopaminergic brain neurons, this study raises the possibility that cotreating HPI-1 and NZ may be a promising therapeutic strategy.

Figure 3.

Figure 3.

Open in a new tab

Effect of HPI-1 and NZ enhanced dopaminergic neuron differentiation of hNF cells. The expression of dopaminergic neuron genes (TH, EN1, Nurr1, Foxa2, Lmx1b, and Pitx3) was assessed by RT-PCR, and GAPDH was used as the internal control. A Relative expression (fold) of the dopaminergic neuron gene. B The expression of TH and Tuj1 proteins was observed by immunofluorescence. Scale bar = 100 m. C The relative fluorescence intensity of the DAPI protein. D The relative fluorescence intensity of Tuj1 protein. E The relative fluorescence intensity of TH protein. F The percentage of DAPI, TH, and Tuj1 protein expression in differentiated hNF cells was normalized with the undifferentiated control cells. G The DA concentration was determined by the competitive-ELISA assay using the DA ELISA Kit. Values are expressed as the mean ± SD (n = 3). Significance vs. control cells is indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.

HPI-1 and NZ Transdifferentiated hNF Cells Toward Dopaminergic Neuron-Like Cells Through Autophagy

Since autophagy plays a part in development and differentiation (Mizushima and Levine 2010), this study looked at how HPI-1 and NZ affect autophagy to change the generation of cells that are like dopaminergic neurons. After 10 days, hNF cells received HPI-1 and NZ. Using RT-PCR, it was possible to examine the expression of autophagy gene markers. When compared to cells that did not receive HPI-1 and NZ, those that did showed a lot more of the autophagy genes ATG5, ATG12, and LC3 (Fig. 4A–B). As shown by the expression of autophagy protein by MDC (Fig. 4C–D) and LC3 protein by immunofluorescence (Fig. 4E–F), Apoptosis was investigated by evaluating the expression of apoptosis-related genes such as Bcl2, P53, and BAX using RT-PCR (Fig. 4G–H). It was found that there was no difference in The amounts of Bcl2, P53, and BAX between the HPI-1 and NZ treatment group and the HPI-1 and NZ nontreatment group, and in these two groups, increased Bcl2 gene expression was observed (Fig. 4G–H). This suggests that HPI-1 and NZ may be able to target the autophagy-mediated process of hNF cell differentiation.

Figure 4.

Figure 4.

Open in a new tab

HPI-1 and NZ enhanced the neural differentiation of hNF cells and altered autophagy activity. The expression of autophagy genes, ATG5, ATG12, and LC3, was measured by RT-PCR analysis after induced differentiation in various conditions for 10 days. A The relative expression values of ATG5, ATG12, and LC3 genes were assessed using GAPDH as the internal control. B MDC assays presented the level of autophagy activity of the differentiated cells at day 10, compared with the undifferentiated control cells. C The relative expression values of autophagy activity of the differentiated cells at day 10 by MDC assays. D The expression of LC3 protein was observed by immunofluorescence. E The relative fluorescence intensity of LC3 protein was normalized with the undifferentiated control cells. F The expression of apoptotic genes P53, BAX, and Bcl2 was measured by RT-PCR. G The relative expression values of the P53, BAX, and Bcl2 genes were assessed using GAPDH as the internal control. Values are expressed as the mean ± SD (n = 3). Significance vs. control cells is indicated as follows: *p < 0.05, **p < 0.01, and ***p < 0.001.

Discussion

The generation of neurons is a subject of significant interest in medical investigation, owing to the elevated likelihood of disorders associated with the degeneration of the nervous system. The mechanisms of the production and longevity of DA neurons are particularly intriguing. This is due to the dysfunction of these brain cells, which play a crucial role in the development of Parkinson's disease. Small-molecule compounds are being employed to activate particular categories of nerve cells across boundaries. Hence, employing tiny chemicals to guide the growth trajectory of nerve cells is a promising strategy for producing medically significant cell types without modifying genes. The growth factors of human fibroblasts are directly stimulated within nerve cells by the synergistic action of small molecules, HPI-1 and NZ, over 10 days. This stimulation aims to enhance the efficiency of neuronal differentiation and reduce the duration of induction, as demonstrated (Smith et al. 2016). The experimental findings demonstrate that hNF cells can convert these distinctions into cells that possess traits similar to dopaminergic neurons. This is demonstrated by the manifestation of particular genes in nerve cells, including TH, FOXA2, Nuur1, EN1, Pitx3, and LMX1B (Kou et al. 2008; Edsjö et al. 2003), as well as the presence of dopamine neuron proteins (TH and DA). It was discovered that these expressions were capable of generating elevated quantities of activated DA neurons. NZ is a compound that may enter cells and has three substituents on an imidazole ring. It is also known to promote the generation of new neurons in the brain (Williams et al. 2007). NZ can stimulate the growth of new nerve cells in both C2C12 myoblasts and fully developed human muscle cells. This is evident from the increased expression of genes associated with the nervous system, as observed in research conducted (Williams et al. 2007; Williams et al. 2008). Prior studies have demonstrated that NZ, a small chemical compound derived from imidazole, enhances the proliferation of neuronal cells. This study employed Western blot analysis and RT-PCR to examine this phenomenon. The findings indicated that in NZ-cultured cells, NZ enhanced the expression of neuron-specific genes including Tuj1, NF200, NSE, NeuroD, and MAP2 (Williams et al. 2007). The study findings suggest that the chemical NZ promotes nervous system growth in neuroblastoma cells by activating both the Wnt and Shh signaling pathways. Furthermore, in fibroblast cells, it predominantly activates the Wnt signaling pathway, hence playing a role in the formation of the neural system (Halder et al. 2015).

Previous investigations have demonstrated the essential role of the Wnt/β-catenin (WβC) signaling pathway in maintaining cellular balance from early development to adulthood. The WβC signaling system, as described (Ramakrishna et al. 2023), has an essential part in neurogenesis and cell proliferation. The PMID number is 37489441. The compound HPI-1 has also been the subject of discussion. It acts as a hedgehog (HH) pathway inhibitor, selectively blocking sonic hedgehog-mediated signaling, without significantly affecting WNT signaling (Hyman et al. 2009). The hedgehog signaling system is well-known for its role in the development of the neural tube and limb buds, and it also significantly affects brain formation (Antonellis et al. 2021). The Shh protein is involved in determining the characteristics of dopaminergic and serotoninergic neurons, which helps to establish the structure of the forebrain and midbrain (Ruiz i Altaba 2006). The aberrant activation of the HH signaling pathway has been linked to the onset of multiple types of cancer, such as prostate, lung, pancreatic, breast, brain, and skin cancers (Sheng et al. 2004; Bale and Yu 2001; Sheikh et al. 2012). Indeed, it is conceivable that neural progenitor cells may produce Shh, influencing both their own developmental trajectory and that of nearby cells in the complex network of cellular fate determination (Parga et al. 2008).

Autophagy is a vital mechanism in cell differentiation that significantly contributes to the maturation of nerve cells, the aging process (Adelipour et al. 2022; Valencia et al. 2021), and the recycling of breakdown products. Autophagy is a vital process that is necessary for the survival and upkeep of cells (Parzych and Klionsky 2014). Dysfunctions in this process play a role in the development of various human diseases, such as aging, cancer, diabetes, and neurodegenerative disorders like Alzheimer's, Parkinson's, and Huntington's (Parzych and Klionsky 2014; Golpich et al. 2017). The degradation of dopaminergic neurons has been linked to the presence of excessive free radicals, which lead to increased oxidative stress and inflammatory damage (Yadav et al. 2017). The nigrostriatal dopaminergic (DAergic) pathway breaks down because of these actions; this is shown by the selective death of DAergic neurons and a drop in the amount of dopamine present (Hisahara and Shimohama 2011). The development of the distinctive protein inclusions associated with PD and Lewy bodies serves as an example of the difficulty of protein misfolding and aggregation, which cellular degradation processes do not prevent (Gómez-Benito et al. 2020; Padilla-Godínez et al. 2021). Overexpression of autophagy-related genes, including LC3B, ATG5, and ATG12, improved mitochondrial membrane potential, boosted ATP generation, and inhibited apoptosis, whereas ROS levels remained the same and oxidized protein levels increased (Mai et al. 2012). It was also found that DNA damage increases p53 levels to induce repair or apoptosis in response to cell damage. In various systems, there is also Bcl-2, which protects against cell death by acting as an antioxidant (Cox and Hampton 2007; Liang et al. 2023), and another member of the family, BAX (Unnithan et al. 2023). Bcl-2 levels rose along with this, even though some research suggests that Bcl-2's significance in apoptosis is less than that in transdifferentiation. (Zhao et al. 2007; Zhou et al. 2011; Kitazawa et al. 2002).

This work suggests that the application of small-molecule cocktail screening with HPI-1 and NZ creates a chemical cocktail formula that can differentiate hNF cells into dopaminergic neuron-like cells by stimulation. Expression of dopamine markers reveals the importance of autophagy in regulating neuronal conductance. However, this research was a short-term experiment. Further long-term testing should be conducted in the future and to investigate in vivo mechanisms of small molecule-mediated neuronal reprogramming under physiological conditions. To increase the efficiency of cocktail screening Recommend drug formulations and identify safe and efficient delivery routes. To promote recovery and protect the nervous system. We sincerely hope that it will be useful and expand on future research and medical research (Fig. 5).

Figure 5.

Figure 5.

Open in a new tab

The diagram depicted the activities of HPI-1 and NZ small molecules to stimulate the development of dopaminergic neurons from hNF cells by activating autophagy.

Conclusions

By increasing the expression of neuronal and dopamine markers at the gene and protein levels, HPI-1 and NZ together were able to turn hNF cells into dopaminergic neurons. The two compounds may induce autophagy pathway activation and transdifferentiation. Continued research into regulatory systems will not only yield additional medication targets for Parkinson's disease but will also aid in the discovery of new PD treatments and the enhancement of future medical care. Understanding the underlying molecular pathways of Parkinson's disease is essential for the development of effective treatments. Consequently, these findings have significant implications for the development of new Parkinson's disease therapeutic techniques.

Acknowledgements

This work was supported by the Suranaree University of Technology (SUT) Research and Development Fund, Thailand Science Research and Innovation (TSRI), National Science, Research and Innovation Fund (NSRF) (project code 90464), and the NSRF via the Program Management Unit for Human Resources & Institutional Development, Research, and Innovation (PMU-B) (grant number B13F660133).

Abbreviations

PD

Parkinson's disease

DA

dopamine

TH

tyrosine hydroxylase

hNF

human fibroblasts

HPI-1

hedgehog pathway inhibitor 1

NZ

neurodazine

Data availability

The data analyzed in this study are available from the corresponding author on reasonable request.

Declarations

Conflict of interest

There was no conflict of interest.

Research involving human participants and/or animals

This work did not involve human participants and/or animals.

Informed consent

Informed consent was not applicable for this article.

References

  1. Adelipour M, Saleth LR, Ghavami S, Alagarsamy KN, Dhingra S, Allameh A (2022) The role of autophagy in the metabolism and differentiation of stem cells. Biochimica et Biophysica Acta (BBA)-Mol Basis Dis 1868(8):166412 [DOI] [PubMed]
  2. Antonellis PJ, Engle SE, Brewer KM, Berbari NF (2021) The hedgehog signaling pathway is expressed in the adult mouse hypothalamus and modulated by fasting. eNeuro 8(5) [DOI] [PMC free article] [PubMed]
  3. Bale AE, Yu K-p. The hedgehog pathway and basal cell carcinomas. Hum Mol Genet. 2001;10(7):757–762. doi: 10.1093/hmg/10.7.757. [DOI] [PubMed] [Google Scholar]
  4. Caiazzo M, Dell’Anno MT, Dvoretskova E, Lazarevic D, Taverna S, Leo D, Sotnikova TD, Menegon A, Roncaglia P, Colciago G. Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature. 2011;476(7359):224–227. doi: 10.1038/nature10284. [DOI] [PubMed] [Google Scholar]
  5. Connell JP, Kodali S, Cooke JP. Therapeutic transdifferentiation: a novel approach for ischemic syndromes. Methodist DeBakey Cardiovasc J. 2015;11(3):176. doi: 10.14797/mdcj-11-3-176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cox AG, Hampton MB. Bcl-2 over-expression promotes genomic instability by inhibiting apoptosis of cells exposed to hydrogen peroxide. Carcinogenesis. 2007;28(10):2166–2171. doi: 10.1093/carcin/bgm093. [DOI] [PubMed] [Google Scholar]
  7. Csordás G, Gábor E, Honti V. There and back again: the mechanisms of differentiation and transdifferentiation in Drosophila blood cells. Dev Biol. 2021;469:135–143. doi: 10.1016/j.ydbio.2020.10.006. [DOI] [PubMed] [Google Scholar]
  8. Daubner SC, Le T, Wang S. Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 2011;508(1):1–12. doi: 10.1016/j.abb.2010.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. De Lau LM, Breteler MM. Epidemiology of Parkinson's disease. Lancet Neurol. 2006;5(6):525–535. doi: 10.1016/S1474-4422(06)70471-9. [DOI] [PubMed] [Google Scholar]
  10. Driver JA, Logroscino G, Gaziano JM, Kurth T. Incidence and remaining lifetime risk of Parkinson disease in advanced age. Neurology. 2009;72(5):432–438. doi: 10.1212/01.wnl.0000341769.50075.bb. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Edsjö A, Lavenius E, Nilsson H, Hoehner JC, Simonsson P, Culp LA, Martinsson T, Larsson C, Påhlman S. Expression of trkB in human neuroblastoma in relation to MYCN expression and retinoic acid treatment. Lab investig. 2003;83(6):813–823. doi: 10.1097/01.LAB.0000074895.48776.D8. [DOI] [PubMed] [Google Scholar]
  12. Golpich M, Amini E, Mohamed Z, Azman Ali R, Mohamed Ibrahim N, Ahmadiani A. Mitochondrial dysfunction and biogenesis in neurodegenerative diseases: pathogenesis and treatment. CNS Neurosci Therapeutics. 2017;23(1):5–22. doi: 10.1111/cns.12655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gómez-Benito M, Granado N, García-Sanz P, Michel A, Dumoulin M, Moratalla R. Modeling Parkinson’s disease with the alpha-synuclein protein. Front Pharmacol. 2020;11:356. doi: 10.3389/fphar.2020.00356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Graf T, Enver T. Forcing cells to change lineages. Nature. 2009;462(7273):587–594. doi: 10.1038/nature08533. [DOI] [PubMed] [Google Scholar]
  15. Halder D, Kim G-H, Shin I. Synthetic small molecules that induce neuronal differentiation in neuroblastoma and fibroblast cells. Mol BioSyst. 2015;11(10):2727–2737. doi: 10.1039/C5MB00161G. [DOI] [PubMed] [Google Scholar]
  16. Hisahara S, Shimohama S. Dopamine receptors and Parkinson’s disease. Int J Med Chem. 2011;2011:403039. doi: 10.1155/2011/403039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hyman JM, Firestone AJ, Heine VM, Zhao Y, Ocasio CA, Han K, Sun M, Rack PG, Sinha S, Wu JJ. Small-molecule inhibitors reveal multiple strategies for Hedgehog pathway blockade. Proc Natl Acad Sci. 2009;106(33):14132–14137. doi: 10.1073/pnas.0907134106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ruiz i Altaba A. How the hedgehog outfoxed the crab. In: Ruiz i Altaba A, editor. Hedgehog-gli signaling in human disease. MA: Springer US, Boston; 2006. pp. 1–22. [Google Scholar]
  19. Kalra RS, Dhanjal JK, Das M, Singh B, Naithani R. Cell transdifferentiation and reprogramming in disease modeling: insights into the neuronal and cardiac disease models and current translational strategies. Cells. 2021;10(10):2558. doi: 10.3390/cells10102558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim J, Su SC, Wang H, Cheng AW, Cassady JP, Lodato MA, Lengner CJ, Chung C-Y, Dawlaty MM, Tsai L-H. Functional integration of dopaminergic neurons directly converted from mouse fibroblasts. Cell stem cell. 2011;9(5):413–419. doi: 10.1016/j.stem.2011.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kim H-J (2011) Stem cell potential in Parkinson's disease and molecular factors for the generation of dopamine neurons. Biochimica et Biophysica Acta (BBA)-Mol Basis Dis 1812(1):1-11 [DOI] [PubMed]
  22. Kitazawa M, Wagner JR, Kirby ML, Anantharam V, Kanthasamy AG. Oxidative stress and mitochondrial-mediated apoptosis in dopaminergic cells exposed to methylcyclopentadienyl manganese tricarbonyl. J Pharmacol Exp Therapeutics. 2002;302(1):26–35. doi: 10.1124/jpet.302.1.26. [DOI] [PubMed] [Google Scholar]
  23. Kordower JH, Olanow CW, Dodiya HB, Chu Y, Beach TG, Adler CH, Halliday GM, Bartus RT. Disease duration and the integrity of the nigrostriatal system in Parkinson’s disease. Brain. 2013;136(8):2419–2431. doi: 10.1093/brain/awt192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kou W, Luchtman D, Song C. Eicosapentaenoic acid (EPA) increases cell viability and expression of neurotrophin receptors in retinoic acid and brain-derived neurotrophic factor differentiated SH-SY5Y cells. Eur J Nutr. 2008;47:104–113. doi: 10.1007/s00394-008-0703-1. [DOI] [PubMed] [Google Scholar]
  25. Liang Z, Chen Y, Gu R, Guo Q, Nie X (2023) Asiaticoside prevents oxidative stress and apoptosis in endothelial cells by activating ROS-dependent p53/Bcl-2/Caspase-3 signaling pathway. Curr Mol Med [DOI] [PubMed]
  26. Mai S, Muster B, Bereiter-Hahn J, Jendrach M. Autophagy proteins LC3B, ATG5 and ATG12 participate in quality control after mitochondrial damage and influence lifespan. Autophagy. 2012;8(1):47–62. doi: 10.4161/auto.8.1.18174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Maiti P, Manna J, Dunbar GL. Current understanding of the molecular mechanisms in Parkinson's disease: targets for potential treatments. Transl Neurodegener. 2017;6:1–35. doi: 10.1186/s40035-017-0099-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mizushima N, Levine B. Autophagy in mammalian development and differentiation. Nat Cell Biol. 2010;12(9):823–830. doi: 10.1038/ncb0910-823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nagatsu T. The catecholamine system in health and disease—relation to tyrosine 3-monooxygenase and other catecholamine-synthesizing enzymes. Proc Jpn Acad Ser B. 2006;82(10):388–415. doi: 10.2183/pjab.82.388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Padilla-Godínez FJ, Ramos-Acevedo R, Martínez-Becerril HA, Bernal-Conde LD, Garrido-Figueroa JF, Hiriart M, Hernández-López A, Argüero-Sánchez R, Callea F, Guerra-Crespo M. Protein misfolding and aggregation: the relatedness between Parkinson’s disease and hepatic endoplasmic reticulum storage disorders. Int J Mol Sci. 2021;22(22):12467. doi: 10.3390/ijms222212467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Parga J, Rodriguez-Pallares J, Blanco V, Guerra M, Labandeira-Garcia J. Different effects of anti-sonic hedgehog antibodies and the hedgehog pathway inhibitor cyclopamine on generation of dopaminergic neurons from neurospheres of mesencephalic precursors. Dev Dyn. 2008;237(4):909–917. doi: 10.1002/dvdy.21481. [DOI] [PubMed] [Google Scholar]
  32. Parzych KR, Klionsky DJ. An overview of autophagy: morphology, mechanism, and regulation. Antioxidants Redox Signal. 2014;20(3):460–473. doi: 10.1089/ars.2013.5371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Peralta V, Cuesta MJ. Motor abnormalities: from neurodevelopmental to neurodegenerative through “functional”(neuro) psychiatric disorders. Schizophrenia Bull. 2017;43(5):956–971. doi: 10.1093/schbul/sbx089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Björklund A, Lindvall O, Jakobsson J, Parmar M. Direct conversion of human fibroblasts to dopaminergic neurons. Proc Natl Acad Sci. 2011;108(25):10343–10348. doi: 10.1073/pnas.1105135108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Qin H, Zhao A, Fu X. Small molecules for reprogramming and transdifferentiation. Cell Mol Life Sci. 2017;74:3553–3575. doi: 10.1007/s00018-017-2586-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rai SN, Singh P. Advancement in the modelling and therapeutics of Parkinson’s disease. J Chem Neuroanatomy. 2020;104:101752. doi: 10.1016/j.jchemneu.2020.101752. [DOI] [PubMed] [Google Scholar]
  37. Ramakrishna K, Nalla LV, Naresh D, Venkateswarlu K, Viswanadh MK, Nalluri BN, Chakravarthy G, Duguluri S, Singh P, Rai SN. WNT-β catenin signaling as a potential therapeutic target for neurodegenerative diseases: current status and future perspective. Diseases. 2023;11(3):89. doi: 10.3390/diseases11030089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rausch W-D, Wang F, Radad K. From the tyrosine hydroxylase hypothesis of Parkinson’s disease to modern strategies: a short historical overview. J Neural Transm. 2022;129(5–6):487–495. doi: 10.1007/s00702-022-02488-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rujanapun N, Heebkaew N, Promjantuek W, Sotthibundhu A, Kunhorm P, Chaicharoenaudomrung N, Noisa P. Small molecules re-establish neural cell fate of human fibroblasts via autophagy activation. In Vitro Cell Dev Biol Anim. 2019;55:622–632. doi: 10.1007/s11626-019-00381-0. [DOI] [PubMed] [Google Scholar]
  40. Sdek P, Zhang Z, Cao J, Pan H, Chen W, Zheng J. Alteration of cell-cycle regulatory proteins in human oral epithelial cells immortalized by HPV16 E6 and E7. Int J Oral Maxillofac Surg. 2006;35(7):653–657. doi: 10.1016/j.ijom.2006.01.017. [DOI] [PubMed] [Google Scholar]
  41. Sheikh A, Alvi AA, Aslam HM, Haseeb A. Hedgehog pathway inhibitors–current status and future prospects. Infect Agents Cancer. 2012;7(1):1–2. doi: 10.1186/1750-9378-7-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Shen C-N, Burke ZD, Tosh D. Transdifferentiation, metaplasia and tissue regeneration. Organogenesis. 2004;1(2):36–44. doi: 10.4161/org.1.2.1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sheng T, Li C, Zhang X, Chi S, He N, Chen K, McCormick F, Gatalica Z, Xie J. Activation of the hedgehog pathway in advanced prostate cancer. Mol Cancer. 2004;3(1):1–13. doi: 10.1186/1476-4598-3-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sisakhtnezhad S, Matin MM. Transdifferentiation: a cell and molecular reprogramming process. Cell Tissue Res. 2012;348:379–396. doi: 10.1007/s00441-012-1403-y. [DOI] [PubMed] [Google Scholar]
  45. Smith DK, Yang J, Liu M-L, Zhang C-L. Small molecules modulate chromatin accessibility to promote NEUROG2-mediated fibroblast-to-neuron reprogramming. Stem Cell Rep. 2016;7(5):955–969. doi: 10.1016/j.stemcr.2016.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Surmeier DJ. Determinants of dopaminergic neuron loss in Parkinson's disease. FEBS J. 2018;285(19):3657–3668. doi: 10.1111/febs.14607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tabrez S, Jabir N, Shakil S, Greig N, Alam Q, Abuzenadah A, Damanhouri G, Kamal M (2012) A synopsis on the role of tyrosine hydroxylase in Parkinson's disease. CNS Neurol Disord-Drug Targets (Formerly Current Drug Targets-CNS & Neurological Disorders) 11(4):395-409 [DOI] [PMC free article] [PubMed]
  48. Unnithan A, Das S, Nadipanna SP. Expression of BAX and Bcl-2 gene in prostate carcinoma and its correlation with gleason score. Adv Hum Biol. 2023;13(4):344–349. doi: 10.4103/aihb.aihb_46_23. [DOI] [Google Scholar]
  49. Valencia M, Kim SR, Jang Y, Lee SH. Neuronal autophagy: Characteristic features and roles in neuronal pathophysiology. Biomol Therapeutics. 2021;29(6):605. doi: 10.4062/biomolther.2021.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang X, Yang H, Wang X, Du Y. Effect of siRNA-induced silencing of cellular prion protein on tyrosine hydroxylase expression in the substantia nigra of a rat model of Parkinson’s disease. Genet Mol Res. 2016;15(2):gmr7406. doi: 10.4238/gmr.15027406. [DOI] [PubMed] [Google Scholar]
  51. Williams DR, Lee M-R, Song Y-A, Ko S-K, Kim G-H, Shin I. Synthetic small molecules that induce neurogenesis in skeletal muscle. J Am Chem Soc. 2007;129(30):9258–9259. doi: 10.1021/ja072817z. [DOI] [PubMed] [Google Scholar]
  52. Williams DR, Kim G-H, Lee M-R, Shin I. Fluorescent high-throughput screening of chemical inducers of neuronal differentiation in skeletal muscle cells. Nat Protocols. 2008;3(5):835–839. doi: 10.1038/nprot.2008.47. [DOI] [PubMed] [Google Scholar]
  53. Xu Z, Su S, Zhou S, Yang W, Deng X, Sun Y, Li L, Li Y. How to reprogram human fibroblasts to neurons. Cell Biosci. 2020;10:1–25. doi: 10.1186/s13578-020-00476-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yadav SK, Rai SN, Singh SP. Mucuna pruriens reduces inducible nitric oxide synthase expression in Parkinsonian mice model. J Chem Neuroanatomy. 2017;80:1–10. doi: 10.1016/j.jchemneu.2016.11.009. [DOI] [PubMed] [Google Scholar]
  55. Yang Y, Chen R, Wu X, Zhao Y, Fan Y, Xiao Z, Han J, Sun L, Wang X, Dai J. Rapid and efficient conversion of human fibroblasts into functional neurons by small molecules. Stem Cell Rep. 2019;13(5):862–876. doi: 10.1016/j.stemcr.2019.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. MicroRNA-mediated conversion of human fibroblasts to neurons. Nature. 2011;476(7359):228–231. doi: 10.1038/nature10323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zentelytė A, Žukauskaitė D, Jacerytė I, Borutinskaitė VV, Navakauskienė R. Small molecule treatments improve differentiation potential of human amniotic fluid stem cells. Front Bioeng Biotechnol. 2021;9:623886. doi: 10.3389/fbioe.2021.623886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhao D-L, Zou L-B, Lin S, Shi J-G, Zhu H-B. Anti-apoptotic effect of esculin on dopamine-induced cytotoxicity in the human neuroblastoma SH-SY5Y cell line. Neuropharmacology. 2007;53(6):724–732. doi: 10.1016/j.neuropharm.2007.07.017. [DOI] [PubMed] [Google Scholar]
  59. Zhou J, Li Y, Yan G, Bu Q, Lv L, Yang Y, Zhao J, Shao X, Deng Y, Zhu R. Protective role of taurine against morphine-induced neurotoxicity in C6 cells via inhibition of oxidative stress. Neurotoxicity Res. 2011;20:334–342. doi: 10.1007/s12640-011-9247-x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data analyzed in this study are available from the corresponding author on reasonable request.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES