Abstract
In the last few decades, mesenchymal stem cells (MSCs)-based regenerative therapies in clinical applications have gradually become a hot topic due to their long-term self-renewal and multilineage differentiation ability. In this scenario, placenta (p) has been considered as a good source of MSCs. As a tissue of fetal origin with abundant number of stem cells compared to other sources, their non-invasive acquisition, strong immunosuppression, and lack of ethical concerns make placenta an indispensable source of MSC in stem cell research and therapy. The mesenchymal stem cells were derived from human term placenta (p-MSCs) in xenofree condition using platelet lysate (PL) as a suitable alternative to fetal bovine serum (FBS). Upon isolation, p-MSCs showed plastic adherence with spindle-shaped, fibroblast-like morphology under microscope. p-MSCs flourished well in PL-containing media. Immunophenotyping showed classical MSC markers (> 90%) and lack expression of hematopoietic and HLA-DR (< 1%). Surprisingly, differentiation study showed differentiation of p-MSCs to mature adipocytes in both induced cells and control (spontaneous differentiation), as observed via oil red staining. This is in line with gene expression data where both control and induced cells were positive for visfatin and leptin. Thus, we propose that p-MSCs can be used for clinical applications in the treatment of various chronic and degenerative diseases.
Keywords: Mesenchymal stem cells, Placenta, Platelet lysate, Adipocyte differentiation
Introduction
Stem cells can be found from the very early stages of human development to the end of life (Ullah et al. 2015). Stem cells are unspecialized cells that are capable of self-renewal and also possess the ability to differentiate into specific cell types upon defined induction (Nanjwade et al. 2016). MSCs are a subset of adult stem cells that hold great promise in regenerative medicine and cell based therapies (Gao et al. 2016; Lukomska et al. 2019). It is intensively investigated since their initial discovery by Alexander Friedenstein in the 1970s (Friedenstein et al. 1970). MSCs are multipotent, exhibiting high proliferation and self-renewal capabilities (Sheng 2015). Adding to that, MSCs have been shown to suppress immune responses and regulate immune properties via interaction with immune cells in both innate and adaptive immune systems (Li and Hua 2017; Jiang and Xu 2020). Human MSCs were first isolated from bone marrow (Baker et al. 2015) and they have been also been obtained from other tissues such as adipose tissue (Ghorbani et al. 2014), muscle (Čamernik et al. 2019) and fetal tissues including umbilical cord (Nagamura-Inoue 2014), Wharton jelly (Satheesan et al. 2020), amniotic membrane (Zeng et al. 2011), amniotic fluid (Spitzhorn et al. 2017). Commonly, fetal bovine serum (FBS) is used for the expansion of human mesenchymal stem cells (hMSC) as a supplement. However, there is concerning evidences that FBS contains xenogeneic antigens and endotoxins that may alter phenotype of MSCs (Fani et al. 2016) and cause immunological reactions in the host (Silva-Carvalho et al. 2020). Furthermore, batch to batch variation, ethical concerns of animal welfare, cost and to avoid risk factors, recent research has focused human substitutes such as platelet lysate as a xenofree growth supplements in cell culture expansion as an alternative to FBS (Antoninus et al. 2015; Viau et al. 2016; Tancharoen et al. 2019). The composition of PL includes a large number of growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin-like growth factor (IGF), transforming growth factor (TGF), and fibroblast growth factor 2 (FGF 2) with mitogenic action (Shih and Burnouf 2015). It also contains cytokines and chemokines like interleukins, tumor necrosis factor (TNF)-α and interferon (IFN)-γ (Pourgholaminejad et al. 2016). The source for preparing platelet lysate is the platelet concentrate, which could be derived from platelet-rich plasma or buffy coat. The frequent preparation methods include direct platelet activation by calcium chloride (Pesarini et al. 2018), repeated freeze/thaw cycles (Patel et al. 2020), and many more like sonication (Amirkhani et al. 2016). Human PL shows great promotion and immune privileged than FBS (Palombella et al. 2022).
In this work, the birth-associated tissue placenta was used as a source of mesenchymal stem cells due to its availability, non-invasive method, and lack of ethical concerns due to its classification as birth waste. In clinical applications, placental-derived mesenchymal stem cells have demonstrated promising results in regenerative medicine due to their superior migration and homing abilities into injured tissues (Zachar et al. 2016). It is a preliminary study of establishing MSC from placenta and their differentiation into adipocyte stem cells repair chronic illness. Also, the mesenchymal stem cell can differentiate into other adult cells like chondrocyte, osteocyte.
Materials
Platelet lysate preparation
At least two single platelet concentrates of AB positive donor were obtained from a registered blood bank after running a panel of test for potential viral and other hazardous diseases. The obtained platelet concentrates were then pooled and activated with calcium chloride (10% w/v) to a final concentration of 20 mM. The platelet concentrate was incubated for an hour at 37 °C followed by overnight incubation at 4 °C. The coagulated product was then filtered, centrifuged at 5000 rpm for 20 min and the supernatant was filter sterilized with 0.2 µm syringe filter, aliquoted and frozen at − 20 °C until use.
Procurement of human placenta
The human placenta was aseptically collected from a healthy donor mother after getting informed consent. These were obtained from the selective cesarean sections at Trichy Medical Centre & Hospital, Trichy. The tissue was immersed in antibiotic saline solution and kept under 4 °C until processed.
Tissue processing and ex vivo expansion of p-MSC
The human placenta tissues were processed using enzymatic digestion method. Briefly, deciduous placental tissue was washed with Dulbecco’s phosphate buffer saline (DPBS) and antibiotics to remove residual RBC contaminants. The tissue was minced and digested using enzyme Collagenase Type 1 (1 mg/1 ml) (Gibco, Invitrogen, USA) for 90 min. Following this, the digested tissues were diluted with PBS to reduce viscosity, filtered using 70 µm cell strainer (Himedia, India) and centrifuged at 2500 rpm for 10 min. The mononuclear cells in the pellet were separated and resuspended in mesenchymal stem cell’s complete media containing 89% Dulbecco’s modified eagle medium (DMEM) with high glucose (Himedia, India), 10% platelet lysate, AB+ve seronegative and 1% antibiotic–antimycotic solution (Himedia, India). The single nucleated cells in complete media were seeded in T175 culture flask. Primary cultures were incubated in a 37 °C humidified 5% CO2 incubator (Eppendorf, Germany). Cells were allowed to adhere in surface and non-adherent cells were washed off by replacing the media. Media changes were carried out every 48–72 h thereafter. Upon reaching 70–80% of confluence, cells were harvested via trypsinization. The adherent cells were detached with 0.25% Trypsin EDTA (Himedia, India) and neutralized with media. They were washed with DPBS (w/o Ca2+and Mg2+) (Himedia, India), by centrifugation at 1500 rpm for 5 min and the pellets were re-plated at 1:3 under same culture conditions. Part of cells from every passage were allocated for cryopreservation and banking for future uses. Cells (~ 1–1.5 million cells/ml) were cryopreserved in the freezing media containing 85% DMEM-high glucose, 5% human serum albumin (Reliance, India), 10% DMSO, and cell culture tested (Himedia, India) and stored at − 80 °C overnight and kept at − 196 °C in liquid nitrogen with proper labeling. The harvested cells were used for downstream experiments.
Immunophenotyping of p-MSC
Surface antigen expression was examined by flow cytometric analysis using BD Stem flow hMSC Analysis Kit as per the manufacturer’s instruction. Briefly, cells were harvested at 70–80% confluency and resuspended at approximately 1.0 × 106 cells/ml and aliquoted in 9 reaction tubes. 100 µl of cells from each tube was labeled with the following antibodies: anti-CD90-FITC, anti-CD44-PE, anti-CD105-PerCP-Cy5.5, anti-CD-APC (positive cocktail), anti-CD-73, anti-CD45, CD34, CD11b, CD19, HLA-DR-PE (negative cocktail) with appropriate FITC, PE, PerCP-Cy5.5 labeled isotype control mAbs. The labeled cells were incubated in the dark for 30 min. Then, the cells were washed with PBS and resuspended in 500 µl of PBS and analyzed in BD FACS Verse flow cytometer. The computed data were analyzed using CellQuest software provided by the manufacture (BD, Bioscience).
Adipogenic differentiation assay
Adipogenic differentiation was induced using commercially available HiAdipoXL Adipocyte differentiation kit which is provided with supplements (Cat No: AL521, HiMedia, India) as per the manufacturer’s instruction. Briefly, the cells were seeded at 10,000 cells/cm2 in 12 well plate. Upon reaching 70–80% confluence, the growth medium was replaced with adipocyte induction medium and cells were cultured for 21 days. Media replenishment was done every 2–3 days until the period of culture. Cells without induction media served as control. Differentiation was confirmed by Oil O Red staining using EZ Stain Adipocyte staining kit (HiMedia, India).
RNA extraction and cDNA synthesis
Total RNA was isolated using the HELINI Biomolecules Total RNA isolation kit following the manufacturer instructions. Totally, 60 µl of extracts were eluted and collected in the collection tube. In this elution, 1 µg/10 µl of RNA was converted into cDNA following manufacturer’s instruction.
Extracted RNA was reverse transcribed using the protocol outlined in the High-Capacity cDNA Reverse Transcription Kit (Applied biosystem, USA). 20 µl of reaction sample in polymerase chain reaction (PCR) tube was set in the thermal cycler with the following settings: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, and 4 °C for 5 min. The newly formed cDNA (20 µl) was stored at − 20 °C. For PCR analysis, 1:20 dilution was used as a template.
Quantitative reverse transcription-PCR (qRT-PCR) analysis
cDNA (50 ng/well) was used as a template in qPCR reactions with oligonucleotides specific for the gene of interest such as visfatin (forward primer: 5′AGCCGAGTTCAACATCCTCC3′ and reverse primer: 3′AACTTTGCTTGTGTTGGGTGG5′), leptin (forward primer: 5′AGGGAGACCGAGCGCTTTC3′ and reverse primer: 3′TGCATCTCCACACACCAAACC5′). The RNA sample with induction medium (Test) and without induction medium (Control) were analyzed. All qPCR reactions were performed and the resultant values being combined into an average cycle threshold (CT). Relative quantification was determined using a 7500 Real-Time PCR system (Applied Biosystems, Bedford, MA) measuring SYBR green fluorescence (Lightcycler® 480 SYBR Green I Master). For normalizing the data, GAPDH (forward primer: 5′TTAGCACCCCTGGCCAAGG3′ and reverse primer: 3′CTTACTCCTTGGAGGCCATG 5′) was used as a house-keeping gene.
Results
Isolation and culture of adherent cells from placenta
In testing several methods to prepare viable cells from the placenta after birth, the good result was obtained with combination of both dissection and digestion process (Tong et al. 2011). The schematic isolation protocol of cells from the placental tissue is depicted in Fig. 1. Formation of monolayer, adherence, and fibroblast-like cells spindle-shaped was observed which is referred to as characteristic feature of mesenchymal stem cells. With the digestive process, the isolated p-MSC cells required an average of 13 days to attain confluence stage. The initial growth of cell cultures at passage 0 (P0) showed presence of 20% fibroblast-like cells with plastic adherence ability, while remaining cells were round in shape. In addition, floaters (RBC and epithelial cells) were found in the culture flask. Upon trypsinization and sub-culturing, the RBC content and floaters were washed out from the media and the MSC were maintained with no contamination in subsequent passages. The appearance of cell outgrowth from explant culture was routinely monitored by observation under inverted microscope. In subsequent passages P1 and P2, the growth of cells was faster and attains confluence at an earlier stage like, in P1 at day 9 and P2 at day 3. The homogenous population of PL-MSC were maintained in passage 2 and ready for experimental work. Cells were preserved from each passage (Fig. 2 Panels A, B, C, and D) and maintained in liquid nitrogen.
Fig. 1.
Scheme representing the derivation of mesenchymal stem cells from placenta tissue. Collagenase enzyme is used for digestion to obtain stem cells
Fig. 2.
Sub-culturing of mesenchymal stem cells derived from placenta tissue. Cells were seeded in T175 flask and observed for growth and confluence under 40 × magnifications. Panel A: Passage 0 (a. 3rd day, b. 7th day, c. 14th day, d. 21st day), Panel B: Passage 1 (a. 0th day, b. 3rd day, c. 5th day, d. 7th day), Panel C: Passage 2 (a. 0th day, b. 1st day, c. 3rd day, d. 5th day)
Characterization and expression profile of p-MSCs
Immunophenotyping of p-MSCs was performed in Passage 2 to check the minimal criteria of International Standard for Cellular Therapy (ISCT) committee. The expression profile was determined by flow cytometry. The isolated cells were positive for MSC markers such as CD44, CD73, CD90, and CD105 which showed as a separate peak from the control. The percentage of positive cells found to be more than 95% in these selective adhesion MSC markers. The cells were also negative for CD45, CD34, CD11b, CD19 and also major histocompatibility class-II (HLA-DR) markers which indicated that these cells were not of hematopoietic origin (data not shown). It had shown that less than 2% in which the peaks were seen overlapping with control (Fig. 3). Based on the results of cell surface markers expression, the isolated cells from the placental source were regarded as mesenchymal stem cells.
Fig. 3.
Characterization of p-MSC. Flow cytometric analysis of MSC-positive surface markers (CD44, CD73, CD90 and CD105) with > 98% expression
Differentiation potential of isolated p-MSCs
The standard protocol for characterizing MSCs is their ability to differentiate into multiple lineages. Our results showed that isolated MSCs from placenta source were readily differentiated into adipogenic cell types. After 21 days of culture in adipogenic medium, the induction resulted in the formation of lipid inclusion which stained with Oil Red O staining. In our results, the p-MSC without adipogenic induction medium (Control) also showed the spontaneous differentiation of adipocyte. It was observed under phase contrast microscope with 40× magnification (Fig. 4a, b, and c).
Fig. 4.
Adipogenic differentiation of p-MSCs a Control unstained cells b Control stained with Oil O red c p-MSCs were grown in adipocyte differentiation medium stained with Oil O red
Gene expression of adipogenic differentiated p-MSC cells
qRT-PCR analysis revealed the mRNA expression levels of visfatin and leptin genes in the adipogenic differentiated p-MSC cells (Fig. 5). Visfatin gene has the significantly reduced expression (0.029 ± 95% CI of 0.9225–0.7615) when compared to GAPDH (0.158-fold change) expression as opposed to onefold in control, whereas leptin gene has been significantly upregulated, i.e., 2.114-fold increase in expression (0.041 ± 95% CI of 1.007–1.22) when compared to control. Experiments were done in triplicates and taken as mean value with ± standard error.
Fig. 5.
Gene expressions of adipogenic differentiated p-MSCs were analyzed using qPCR. Experiment was done in triplicated. Data are expressed as mean values with standard deviations (***P > 0.0001)
Discussion
Recently, stem cell research not only improved the understanding of basic development processes but also provided promising opportunities for the use of stem cells in several areas such as biotechnology, pharmaceutics, cell therapy, regenerative medicine, and applications in tissue engineering. Even though pluripotent embryonic stem cells (ESC) shows the great promise of regenerative medicine, it would be complicated due to the ethical concerns to derive human embryos, teratoma formation, and xenograft rejection (Shufaro and Reubinoff 2004). Alternatively, the induced pluripotent stem cells (iPSC) were derived from adult cells but it also faced the similar problem like ESC besides some technical issues. Moreover, iPSCs may not be genetically stable thus limiting in its therapeutic use. Scientists are researching for stable, safe and highly accessible stem cell source with great potential for regenerative medicine. Isolation of stem cells has been reported from various organs and postnatal tissues. Adult multipotent stem cells were derived from many sources such as bone marrow (Siegel et al. 2013; Ratajczak 2015), adipose tissue (Zhou et al. 2013; Mattar and Bieback 2015; De Castro et al. 2017) and muscle tissue (Talele et al. 2015; Klimczak and Kozlowska 2016; Wosczyna et al. 2019).
Recently, mesenchymal stem cells which were derived from adult stem cells have been used to treat various diseases and concentrated on exploring therapies for chronic diseases viz. autoimmune disorders (Maria et al. 2017; Chen et al. 2019), inflammatory disorders (Shi et al. 2018; Fan et al. 2019), diabetes (Moreira et al. 2017; Päth et al. 2019), neurodegenerative disease (Volkman and Offen 2017; Yao et al. 2020), cardiovascular disease (Yun and Lee 2019; Chen et al. 2020; Poomani et al. 2022), and even cancer (Hmadcha et al. 2020; Timaner et al. 2020), but the scientific basis for these applications has not yet been established or widely accepted. MSC has gained attention of researchers due to limited ethical concern compared to embryonic stem cells and also for its great aspect of immunomodulatory features. MSCs have been isolated in the past, both from fetal tissues (Brown et al. 2019) and also from many adult tissues (Neirinckx et al. 2013; Zheng et al. 2013; Souza et al. 2014; Caplan 2015; Macrin et al. 2017; Klimczak et al. 2018; Samsonraj et al. 2018). The birth-associated tissues such as umbilical cord (Ding et al. 2015), amniotic membrane (Navas et al. 2018) have been used as primitive sources for mesenchymal stem cells. Likewise, the placenta which is considered as a birth waste is used as an essential and nascent source to derive mesenchymal stem cells (Komaki et al. 2017).
In our study, the placental tissue was preferred due to their good proliferation and differentiation potentials owing to the multifaceted structure and function of the placenta (Liao et al. 2016). Since the placenta is composed of MSCs and several other types of cells, MSCs was clonally isolated based on its adherent property and requisite morphological feature for MSCs and a part of it was preserved for future use. MSCs have to fulfill the guidelines such as fibroblast-like structure and plastic adherence, to be positive for MSC markers and should be negative for hematopoietic markers (HLA-DR), should differentiate into adipocytes, chondrocytes, and osteocytes (Horwitz et al. 2005; Dominici et al. 2006). The surface marker analysis and their ability of multipotency were scored as a reliable way to identify the populations of MSC (da Silva Meirelles et al. 2008). As shown in the results, these phenotypes represent mesenchymal stem cells features and strongly suggest that the isolated cells from the tissue term placenta were indeed mesenchymal stem cells in nature. Some other cells also adhere to the plastic plate during isolation of MSCs from the placenta, but on sub-culturing, these cells get washed away, leaving only adherent fibroblast-like cells. Platelet lysate (PL), a source of growth factors and bio-active molecules which have been suggested as a substitute for FBS, helps in ex vivo expansion of MSC culture. PL displayed good results such as typical plasticity, immunophenotype, immunomodulatory property, and chromosomal ability (Becherucci et al. 2018; Kandoi et al. 2018).
For defining MSCs, Several surface markers have been suggested to be present or absent. In commonly, the positive expression for CD105, CD90, and CD73 and absence for several surface molecules such as CD34, hematopoietic CD45, and HLA-DR are detailed (Dominici et al. 2006). Our data mostly corroborate with the findings. A total of 9 surface markers were analyzed; MSCs derived from placenta demonstrated CD73 (5′ nucleotidase), CD90 (Thy-1), CD105 (Endoglin), and CD44 (H-CAM) which are highly expressed as surface markers. CD73 showed the high percentage of about 99.54%, while CD105 expressed as 99.52%. The negative expression of hematopoietic markers CD34, CD45 alongside CD11b, CD19, and HLA-DR was lower in percentages (> 2%) and defined the characteristics of placental-derived mesenchymal stem cells.
To assess the differentiation ability of p-MSC, the cells were grown in adipocyte differentiation media. Surprisingly, upon adipogenic induction for p-MSCs (P3) for about 21 days with HiAdipo differentiation media, not only cells induced toward adipocytes, but also cells from control well, stained positive for Oil Red O staining, as evident from the image (Fig. 4b) suggesting spontaneous differentiation of placental mesenchymal stem cells toward adipocytes. The plausible explanations are hypothesized as:
The post confluent culture of adipose-derived MSCs is shown to spontaneously express fibroblastic, osteogenic, chondrogenic, and adipogenic biomarkers (Consulting et al. 2015). Likewise in our study, the cells in the control might have entered post confluent stage and started secreting extracellular matrix favorable of adipogenic differentiation.
The spontaneous differentiation of pre-adipocytes into fat clusters due to the presence of fetal calf serum (FCS; 10% alone) was found to be dose dependent (Miettinen et al. 2008). Here, the platelet lysate (10%) as a supplement of PL-MSC may behave same like FCS and could have caused the spontaneous differentiation.
MSCs from placenta have the ability to undergo robust proliferation and spontaneous differentiation toward mesodermal lineage without any induction, because of its fetal origin. This is corroborated by a similar study that fetal rat circulatory blood cells (FCBCs) spontaneously differentiated toward both chondrogenic and osteogenic lineages in the presence of serum (FBS) alone in the absence of any external induction stimulus. They speculated that it is FBS that influenced this process (Naruse et al. 2004).
Extended/serial passaging and seeding density may also justify the spontaneous differentiation process. In this line, Liu group found that serial passaging (up to P12) and/or seeding at low density (1000 cells/cm2) spontaneously differentiated adipose-derived mesenchymal stem cells into osteocytes (Liu et al. 2016). Our experiments done with earlier passage (P3) cells with low seeding density could have caused spontaneous differentiation toward adipocytes.
Adipokines such as visfatin and leptin are adipocyte-derived factors with immunomodulatory properties and might influence the differentiation of placenta-derived mesenchymal stem cells into adipocytes (Tsiklauri et al. 2018). Thus, the presence of adipokines in the adipogenic differentiated mesenchymal stem cells were analyzed using quantitative PCR on 21st-day differentiation. In adipogenic differentiation, visfatin gene expression was low compared to leptin. This novel adipokine was found to be strongly expressed in osteogenic differentiation. According to Yue, leptin gene promotes adipogenic differentiation and tends to reduce osteogenesis (Yue et al. 2016). Likewise in our study, leptin gene expression was upregulated.
Taken in concert, our results demonstrated that mesenchymal stem cells can be derived from birth-associated tissue, i.e., placenta with platelet lysate instead of fetal bovine serum and characterized according to ICST minimal criteria and adipokine gene expression for visfatin and leptin were analyzed using qPCR.
Acknowledgements
Not applicable.
Funding
No funding available.
Declarations
Conflict of interest
The authors declare that they have no conflict of interest.
References
- Amirkhani MA, Mohseni R, Soleimani M, et al. A rapid sonication based method for preparation of stromal vascular fraction and mesenchymal stem cells from fat tissue. BioImpacts. 2016;6:99–104. doi: 10.15171/bi.2016.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Antoninus AA, Widowati W, Wijaya L, et al. Human platelet lysate enhances the proliferation of Wharton’s jelly-derived mesenchymal stem cells. Biomark Genomic Med. 2015;7:87–97. doi: 10.1016/j.bgm.2015.06.001. [DOI] [Google Scholar]
- Baker N, Boyette LB, Tuan RS. Characterization of bone marrow-derived mesenchymal stem cells in aging. Bone. 2015;70:37–47. doi: 10.1016/j.bone.2014.10.014. [DOI] [PubMed] [Google Scholar]
- Becherucci V, Piccini L, Casamassima S, et al. Human platelet lysate in mesenchymal stromal cell expansion according to a GMP grade protocol: a cell factory experience. Stem Cell Res Ther. 2018;9:1–10. doi: 10.1186/s13287-018-0863-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown C, McKee C, Bakshi S, et al. Mesenchymal stem cells: cell therapy and regeneration potential. J Tissue Eng Regen Med. 2019;13:1738–1755. doi: 10.1002/term.2914. [DOI] [PubMed] [Google Scholar]
- Čamernik K, Mihelič A, Mihalič R, et al. Skeletal-muscle-derived mesenchymal stem/stromal cells from patients with osteoarthritis show superior biological properties compared to bone-derived cells. Stem Cell Res. 2019 doi: 10.1016/j.scr.2019.101465. [DOI] [PubMed] [Google Scholar]
- Caplan AI. Adult mesenchymal stem cells: when, where, and how. Stem Cells Int. 2015;2015:1. doi: 10.1155/2015/628767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen Y, Yu Q, Hu Y, Shi Y. Current research and use of mesenchymal stem cells in the therapy of autoimmune diseases. Curr Stem Cell Res Ther. 2019;14:579–582. doi: 10.2174/1574888X14666190429141421. [DOI] [PubMed] [Google Scholar]
- Chen C, Lou Y, Li XY, et al. Mapping current research and identifying hotspots on mesenchymal stem cells in cardiovascular disease. Stem Cell Res Ther. 2020;11:1–16. doi: 10.1186/s13287-020-02009-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Consulting CG, Diamond B, Lake S. Standards, policies, protocols, and regulations for cell-based therapies concise review: making and using clinically compliant pluripotent stem cell lines. Bone. 2015;74:381–388. doi: 10.5966/sctm.2014-0202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- da Silva ML, Caplan AI, Nardi NB. In search of the in vivo identity of mesenchymal stem cells. Stem Cells. 2008;26:2287–2299. doi: 10.1634/stemcells.2007-1122. [DOI] [PubMed] [Google Scholar]
- De Castro LL, Xisto DG, Kitoko JZ, et al. Human adipose tissue mesenchymal stromal cells and their extracellular vesicles act differentially on lung mechanics and inflammation in experimental allergic asthma. Stem Cell Res Ther. 2017;8:1–12. doi: 10.1186/s13287-017-0600-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding DC, Chang YH, Shyu WC, Lin SZ. Human umbilical cord mesenchymal stem cells: a new era for stem cell therapy. Cell Transplant. 2015;24:339–347. doi: 10.3727/096368915X686841. [DOI] [PubMed] [Google Scholar]
- Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy. 2006;8:315–317. doi: 10.1080/14653240600855905. [DOI] [PubMed] [Google Scholar]
- Fan XL, Zhang Z, Ma CY, Fu QL. Mesenchymal stem cells for inflammatory airway disorders: promises and challenges. Biosci Rep. 2019;39:1–13. doi: 10.1042/BSR20182160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fani N, Ziadlou R, Shahhoseini M, Baghaban Eslaminejad M. Comparative epigenetic influence of autologous versus fetal bovine serum on mesenchymal stem cells through in vitro osteogenic and adipogenic differentiation. Exp Cell Res. 2016;344:176–182. doi: 10.1016/j.yexcr.2015.10.009. [DOI] [PubMed] [Google Scholar]
- Friedenstein AJ, Chailakhjan RK, Lalykina KS. The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Prolif. 1970;3:393–403. doi: 10.1111/j.1365-2184.1970.tb00347.x. [DOI] [PubMed] [Google Scholar]
- Gao F, Chiu SM, Motan DAL, et al. Mesenchymal stem cells and immunomodulation: current status and future prospects. Cell Death Dis. 2016 doi: 10.1038/cddis.2015.327. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghorbani A, Jalali SA, Varedi M. Isolation of adipose tissue mesenchymal stem cells without tissue destruction: a non-enzymatic method. Tissue Cell. 2014;46:54–58. doi: 10.1016/j.tice.2013.11.002. [DOI] [PubMed] [Google Scholar]
- Hmadcha A, Martin-Montalvo A, Gauthier BR, et al. Therapeutic potential of mesenchymal stem cells for cancer therapy. Front Bioeng Biotechnol. 2020;8:1–13. doi: 10.3389/fbioe.2020.00043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horwitz EM, Le Blanc K, Dominici M, et al. Clarification of the nomenclature for MSC: the international society for cellular therapy position statement. Cytotherapy. 2005;7:393–395. doi: 10.1080/14653240500319234. [DOI] [PubMed] [Google Scholar]
- Jiang W, Xu J. Immune modulation by mesenchymal stem cells. Cell Prolif. 2020 doi: 10.1111/cpr.12712. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kandoi S, Praveen Kumar L, Patra B, et al. Evaluation of platelet lysate as a substitute for FBS in explant and enzymatic isolation methods of human umbilical cord MSCs. Sci Rep. 2018;8:1–12. doi: 10.1038/s41598-018-30772-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klimczak A, Kozlowska U, Kurpisz M. Muscle stem/progenitor cells and mesenchymal stem cells of bone marrow origin for skeletal muscle regeneration in muscular dystrophies. Arch Immunol Ther Exp (warsz) 2018;66:341–354. doi: 10.1007/s00005-018-0509-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klimczak A, Kozlowska U. Mesenchymal stromal cells and tissue-specific progenitor cells: their role in tissue homeostasis. Stem Cells Int. 2016 doi: 10.1155/2016/4285215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Komaki M, Numata Y, Morioka C, et al. Exosomes of human placenta-derived mesenchymal stem cells stimulate angiogenesis. Stem Cell Res Ther. 2017;8:1–12. doi: 10.1186/s13287-017-0660-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li N, Hua J. Interactions between mesenchymal stem cells and the immune system. Cell Mol Life Sci. 2017;74:2345–2360. doi: 10.1007/s00018-017-2473-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liao Y, Ivanova L, Plumer T, et al. Potential use of human placenta derived stem cell (HPDSCs) as a novel stem cell source for the treatment of recessive dystrophic epidermolysis bullosa (RDEB) Biol Blood Marrow Transpl. 2016;22:S422–S423. doi: 10.1016/j.bbmt.2015.11.964. [DOI] [Google Scholar]
- Liu Y, Zhang Z, Zhang C, et al. Adipose-derived stem cells undergo spontaneous osteogenic differentiation in vitro when passaged serially or seeded at low density. Biotech Histochem. 2016;91:369–376. doi: 10.1080/10520295.2016.1175026. [DOI] [PubMed] [Google Scholar]
- Lukomska B, Stanaszek L, Zuba-Surma E, et al. Challenges and controversies in human mesenchymal stem cell therapy. Stem Cells Int. 2019 doi: 10.1155/2019/9628536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Macrin D, Joseph JP, Pillai AA, Devi A. Eminent sources of adult mesenchymal stem cells and their therapeutic imminence. Stem Cell Rev Rep. 2017;13:741–756. doi: 10.1007/s12015-017-9759-8. [DOI] [PubMed] [Google Scholar]
- Maria ATJ, Maumus M, Le Quellec A, et al. Adipose-derived mesenchymal stem cells in autoimmune disorders: state of the art and perspectives for systemic sclerosis. Clin Rev Allergy Immunol. 2017;52:234–259. doi: 10.1007/s12016-016-8552-9. [DOI] [PubMed] [Google Scholar]
- Mattar P, Bieback K. Comparing the immunomodulatory properties of bone marrow, adipose tissue, and birth-associated tissue mesenchymal stromal cells. Front Immunol. 2015;6:1–8. doi: 10.3389/fimmu.2015.00560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miettinen S, Sarkanen J-R, Ashammakhi N (2008) Adipose tissue and adipocyte differentiation: molecular and cellular aspects and tissue engineering applications prognostications and cancer view project TEKES funded multifunctional biomaterials view project
- Moreira A, Kahlenberg S, Hornsby P. Therapeutic potential of mesenchymal stem cells for diabetes. J Mol Endocrinol. 2017;59:R109–R120. doi: 10.1530/JME-17-0117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nagamura-Inoue T. Umbilical cord-derived mesenchymal stem cells: their advantages and potential clinical utility. World J Stem Cells. 2014;6:195. doi: 10.4252/wjsc.v6.i2.195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nanjwade BK, Sudulaguntla A, Gurung S, Tamang JK. A review: stem cells and classification of stem cells based on their origin. Sudulaguntla Al World J Pharm Pharm Sci. 2016;5:534. doi: 10.20959/wjpps201611-7994. [DOI] [Google Scholar]
- Naruse K, Urabe K, Mukaida T, et al. Spontaneous differentiation of mesenchymal stem cells obtained from fetal rat circulation. Bone. 2004;35:850–858. doi: 10.1016/j.bone.2004.05.006. [DOI] [PubMed] [Google Scholar]
- Navas A, Magaña-Guerrero FS, Domínguez-López A, et al. Anti-inflammatory and anti-fibrotic effects of human amniotic membrane mesenchymal stem cells and their potential in corneal repair. Stem Cells Transl Med. 2018;7:906–917. doi: 10.1002/sctm.18-0042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neirinckx V, Coste C, Rogister B, Wislet-Gendebien S. Concise review: adult mesenchymal stem cells, adult neural crest stem cells, and therapy of neurological pathologies: a state of play. Stem Cells Transl Med. 2013;2:284–296. doi: 10.5966/sctm.2012-0147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Palombella S, Perucca Orfei C, Castellini G, et al. Systematic review and meta-analysis on the use of human platelet lysate for mesenchymal stem cell cultures: comparison with fetal bovine serum and considerations on the production protocol. Stem Cell Res Ther. 2022;13:1–31. doi: 10.1186/s13287-022-02815-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Patel DK, Jin B, Dutta SD, Lim KT. Osteogenic potential of human mesenchymal stem cells on eggshells-derived hydroxyapatite nanoparticles for tissue engineering. J Biomed Mater Res Part B Appl Biomater. 2020;108:1953–1960. doi: 10.1002/jbm.b.34536. [DOI] [PubMed] [Google Scholar]
- Päth G, Perakakis N, Mantzoros CS, Seufert J. Stem cells in the treatment of diabetes mellitus—focus on mesenchymal stem cells. Metabolism. 2019;90:1–15. doi: 10.1016/j.metabol.2018.10.005. [DOI] [PubMed] [Google Scholar]
- Pesarini JR, de Oliveira EJT, Pessatto LR, et al. Calcitriol combined with calcium chloride causes apoptosis in undifferentiated adipose tissue-derived human mesenchymal stem cells, but this effect decreases during adipogenic differentiation. Biomed Pharmacother. 2018;108:914–924. doi: 10.1016/j.biopha.2018.09.083. [DOI] [PubMed] [Google Scholar]
- Poomani MS, Mariappan I, Perumal R, et al. Mesenchymal stem cell (MSCs) therapy for ischemic heart disease: a promising frontier. Glob Heart. 2022;17:1. doi: 10.5334/gh.1098. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pourgholaminejad A, Aghdami N, Baharvand H, Moazzeni SM. The effect of pro-inflammatory cytokines on immunophenotype, differentiation capacity and immunomodulatory functions of human mesenchymal stem cells. Cytokine. 2016;85:51–60. doi: 10.1016/j.cyto.2016.06.003. [DOI] [PubMed] [Google Scholar]
- Ratajczak MZ. A novel view of the adult bone marrow stem cell hierarchy and stem cell trafficking. Leukemia. 2015;29:776–782. doi: 10.1038/leu.2014.346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Samsonraj RM, Paradise CR, Dudakovic A, et al. Validation of osteogenic properties of cytochalasin D by high-resolution RNA-sequencing in mesenchymal stem cells derived from bone marrow and adipose tissues. Stem Cells Dev. 2018;27:1136–1145. doi: 10.1089/scd.2018.0037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Satheesan L, Soundian E, Kumanan V, Kathaperumal K. Potential of ovine Wharton jelly derived mesenchymal stem cells to transdifferentiate into neuronal phenotype for application in neuroregenerative therapy. Int J Neurosci. 2020;130:1101–1108. doi: 10.1080/00207454.2020.1725510. [DOI] [PubMed] [Google Scholar]
- Sheng G. The developmental basis of mesenchymal stem/stromal cells (MSCs) BMC Dev Biol. 2015;15:26–31. doi: 10.1186/s12861-015-0094-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi Y, Wang Y, Li Q, et al. Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases. Nat Rev Nephrol. 2018;14:493–507. doi: 10.1038/s41581-018-0023-5. [DOI] [PubMed] [Google Scholar]
- Shih DTB, Burnouf T. Preparation, quality criteria, and properties of human blood platelet lysate supplements for ex vivo stem cell expansion. New Biotechnol. 2015;32:199–211. doi: 10.1016/j.nbt.2014.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shufaro Y, Reubinoff BE. Therapeutic applications of embryonic stem cells. Best Pract Res Clin Obstet Gynaecol. 2004;18:909–927. doi: 10.1016/j.bpobgyn.2004.07.002. [DOI] [PubMed] [Google Scholar]
- Siegel G, Kluba T, Hermanutz-Klein U, et al. Phenotype, donor age and gender affect function of human bone marrow-derived mesenchymal stromal cells. BMC Med. 2013 doi: 10.1186/1741-7015-11-146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Silva-Carvalho AÉ, Neves FAR, Saldanha-Araujo F. The immunosuppressive mechanisms of mesenchymal stem cells are differentially regulated by platelet poor plasma and fetal bovine serum supplemented media. Int Immunopharmacol. 2020;79:106172. doi: 10.1016/j.intimp.2019.106172. [DOI] [PubMed] [Google Scholar]
- Souza CMCO, Mesquita LAF, Souza D, et al. Regeneration of skin tissue promoted by mesenchymal stem cells seeded in nanostructured membrane. Transplant Proc. 2014;46:1882–1886. doi: 10.1016/j.transproceed.2014.05.066. [DOI] [PubMed] [Google Scholar]
- Spitzhorn LS, Rahman MS, Schwindt L, et al. Isolation and molecular characterization of amniotic fluid-derived mesenchymal stem cells obtained from caesarean sections. Stem Cells Int. 2017 doi: 10.1155/2017/5932706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Talele NP, Fradette J, Davies JE, et al. Expression of α-smooth muscle actin determines the fate of mesenchymal stromal cells. Stem Cell Rep. 2015;4:1016–1030. doi: 10.1016/j.stemcr.2015.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tancharoen W, Aungsuchawan S, Pothacharoen P, et al. Human platelet lysate as an alternative to fetal bovine serum for culture and endothelial differentiation of human amniotic fluid mesenchymal stem cells. Mol Med Rep. 2019;19:5123–5132. doi: 10.3892/mmr.2019.10182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Timaner M, Tsai KK, Shaked Y. The multifaceted role of mesenchymal stem cells in cancer. Semin Cancer Biol. 2020;60:225–237. doi: 10.1016/j.semcancer.2019.06.003. [DOI] [PubMed] [Google Scholar]
- Tong CK, Vellasamy S, Tan BC, et al. Generation of mesenchymal stem cell from human umbilical cord tissue using a combination enzymatic and mechanical disassociation method. Cell Biol Int. 2011;35:221–226. doi: 10.1042/CBI20100326. [DOI] [PubMed] [Google Scholar]
- Tsiklauri L, Werner J, Kampschulte M, et al. Visfatin alters the cytokine and matrix-degrading enzyme profile during osteogenic and adipogenic MSC differentiation. Osteoarthr Cartil. 2018;26:1225–1235. doi: 10.1016/j.joca.2018.06.001. [DOI] [PubMed] [Google Scholar]
- Ullah I, Subbarao RB, Rho GJ. 2015. Human mesenchymal stem cells—current trends and future prospective. Biosci Rep. [DOI] [PMC free article] [PubMed]
- Viau S, Chabrand L, Eap S, et al. Human platelet lysate pathogen reduced through additive-free short-wave UV light irradiation retains its optimal efficacy for the expansion of human bone marrow mesenchymal stem cells. Cytotherapy. 2016;18:S131–S132. doi: 10.1016/j.jcyt.2016.03.255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Volkman R, Offen D. Concise review: mesenchymal stem cells in neurodegenerative diseases. Stem Cells. 2017;35:1867–1880. doi: 10.1002/stem.2651. [DOI] [PubMed] [Google Scholar]
- Wosczyna MN, Konishi CT, Perez Carbajal EE, et al. Mesenchymal stromal cells are required for regeneration and homeostatic maintenance of skeletal muscle. Cell Rep. 2019;27:2029–2035.e5. doi: 10.1016/j.celrep.2019.04.074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yao P, Zhou L, Zhu L, et al. Mesenchymal stem cells: a potential therapeutic strategy for neurodegenerative diseases. Eur Neurol. 2020;83:235–241. doi: 10.1159/000509268. [DOI] [PubMed] [Google Scholar]
- Yue R, Zhou BO, Shimada IS, et al. Leptin receptor promotes adipogenesis and reduces osteogenesis by regulating mesenchymal stromal cells in adult bone marrow. Cell Stem Cell. 2016;18:782–796. doi: 10.1016/j.stem.2016.02.015. [DOI] [PubMed] [Google Scholar]
- Yun CW, Lee SH. Enhancement of functionality and therapeutic efficacy of cell-based therapy using mesenchymal stem cells for cardiovascular disease. Int J Mol Sci. 2019 doi: 10.3390/ijms20040982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zachar L, Bačenková D, Rosocha J. Activation, homing, and role of the mesenchymal stem cells in the inflammatory environment. J Inflamm Res. 2016;9:231–240. doi: 10.2147/JIR.S121994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng G, Wang G, Guan F, et al. Human amniotic membrane-derived mesenchymal stem cells labeled with superparamagnetic iron oxide nanoparticles: the effect on neuron-like differentiation in vitro. Mol Cell Biochem. 2011;357:331–341. doi: 10.1007/s11010-011-0904-4. [DOI] [PubMed] [Google Scholar]
- Zheng YH, Xiong W, Su K, et al. Multilineage differentiation of human bone marrow mesenchymal stem cells in vitro and in vivo. Exp Ther Med. 2013;5:1576–1580. doi: 10.3892/etm.2013.1042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou Z, Chen Y, Zhang H, et al. Comparison of mesenchymal stromal cells from human bone marrow and adipose tissue for the treatment of spinal cord injury. Cytotherapy. 2013;15:434–448. doi: 10.1016/j.jcyt.2012.11.015. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Citations
- Ullah I, Subbarao RB, Rho GJ. 2015. Human mesenchymal stem cells—current trends and future prospective. Biosci Rep. [DOI] [PMC free article] [PubMed]





