Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Mar 1.
Published in final edited form as: Exp Cell Res. 2024 Feb 9;436(1):113961. doi: 10.1016/j.yexcr.2024.113961

scaRNA20 promotes pseudouridylatory modification of small nuclear snRNA U12 and improves cardiomyogenesis

Selene Perales 1,*, Vinoth Sigamani 1,*, Sheeja Rajasingh 1, Narasimman Gurusamy 1, Douglas Bittel 2, Andras Czirok 3, Marko Radic 5, Johnson Rajasingh 1,4,5,**
PMCID: PMC10964393  NIHMSID: NIHMS1968902  PMID: 38341080

Abstract

Non-coding RNAs, particularly small Cajal-body associated RNAs (scaRNAs), play a significant role in spliceosomal RNA modifications. While their involvement in ischemic myocardium regeneration is known, their role in cardiac development is unexplored. We investigated scaRNA20's role in iPSC differentiation into cardiomyocytes (iCMCs) via overexpression and knockdown assays. We measured scaRNA20-OE-iCMCs and scaRNA20-KD-iCMCs contractility using Particle Image Velocimetry (PIV), comparing them to control iCMCs. We explored scaRNA20's impact on alternative splicing via pseudouridylation (Ψ) of snRNA U12, analyzing its functional consequences in cardiac differentiation. scaRNA20-OE-iPSC differentiation increased beating colonies, upregulated cardiac-specific genes, activated TP53 and STAT3, and preserved contractility under hypoxia. Conversely, scaRNA20-KD-iCMCs exhibited poor differentiation and contractility. STAT3 inhibition in scaRNA20-OE-iPSCs hindered cardiac differentiation. RNA immunoprecipitation revealed increased Ψ at the 28th uridine of U12 RNA in scaRNA20-OE iCMCs. U12-KD iCMCs had reduced cardiac differentiation, which improved upon U12 RNA introduction. In summary, scaRNA20-OE in iPSCs enhances cardiomyogenesis, preserves iCMC function under hypoxia, and may have implications for ischemic myocardium regeneration.

Keywords: Cardiomyocytes, Differentiation, Induced pluripotent stem cells, Pseudouridylation, Small Cajal-body associated RNA

Introduction

Ischemic heart disease (IHD) is a leading cause of death for people worldwide, affecting approximately 126 million individuals, which accounts for 1.72% of the global population, and contributing to 9 million deaths globally [1]. A recent report by the World Health Organization (WHO) reveals that around 17.9 million deaths each year due to cardiovascular diseases (CVDs). The ultimate goal of cardiac regenerative medicine is to restore the injured myocardium by repopulating the lost cardiomyocytes. Human-induced pluripotent stem cells (iPSCs) offer a promising cell source for cell-based therapy and engineered cardiac tissue for repairing ischemic heart conditions [2, 3].

Non-coding RNAs (ncRNAs) play a significant role in molecular biology. Various types of ncRNAs have been identified and characterized in numerous biological processes, including development, differentiation, growth, and metabolism during normal and disease conditions [46]. However, a subset of small nucleolar RNAs (snoRNAs) known as small Cajal body-associated RNAs (scaRNAs) remain relatively unexplored. These ncRNAs are typically 60–300 base pairs in length and are classified as C/D box or H/ACA box snoRNAs based on their conserved sequence and biochemical functions. C/D box snoRNAs are involved in rRNA and pre-mRNA processing and also expand the repertoire of splicing regulators [7, 8]. On the other hand, H/ACA box scaRNAs mediate the post-transcriptional modifications through pseudouridylation or 2`-O-methylation in various spliceosomal small nuclear RNAs (snRNAs), including U2-type snRNPs (U1, U2, U4, U5, U6, and the U12-type snRNPs U11, U12, U4atac, and U6atac) [912]. While U2-type introns although less abundant, play a significant role in human disease development and impact multiple cellular processes [13].

RNA pseudouridylation is a prevalent RNA modification with a substantial impact on RNA metabolism and gene expression. The modification involves the conversion of UTP to ΨTP by a nitrogen-carbon glycosidic bond with a carbon-carbon bond providing an extra hydrogen bond donor at the N1 position of uracil. Pseudouridylation can occur through both RNA-dependent and RNA-independent mechanisms. In RNA-dependent pseudouridylation, the H/ACA box scaRNAs along with core proteins, form a binding pocket where the target substrate RNA binds through complementary base pairing, facilitating the pseudouridylation reaction. In RNA-independent pseudouridylation, the enzyme pseudouridine synthase (PUS) acts as a guide RNA to direct pseudouridylation in mRNA, rRNA, spliceosomal snRNAs, and various other ncRNAs. This modification may activate the ribosome by altering rRNA interaction and folding [14, 15]. The sno/scaRNAs follow a unique pathway as they travel from the nucleoli to the Cajal bodies, depending on the binding of Cajal body chaperones and telomerase proteins such as TCAB1, WRAP53, SMN, and COILIN. These proteins play a significant role in the biogenesis of small Cajal body-specific ribonucleoproteins (scaRNPs) and telomerase [16, 17]. The scaRNPs for H/ACA RNAs include dyskerin (DKC1), NHP2, NOP10 and GAR1. Notably, in yeast models, the depletion of core proteins DKC1, NHP2, and NOP10 destabilizes H/ACA RNAs, but not GAR1 [18, 19]. The scaRNPs are involved in the pre-rRNA processing, telomeric DNA synthesis, and various cellular processes, including mRNA splicing, protein synthesis, and genome integrity maintenance [11, 20]. Remarkably, there are conserved spatial and temporal transitions in transcripts splicing during fetal and postnatal development of the vertebrate heart [21, 22].

Recently, a study has revealed that levels of scaRNA in cardiomyocytes have a significant impact on alternative splicing patterns, thereby influencing heart development and CVD [23, 24]. snoRNAs/scaRNAs are closely linked to spliceosomal RNA targeting, function, and heart development. In samples from individuals with tetralogy of Fallot (TOF), a congenital heart condition, 44 out of 229 genes associated with heart development displayed significant changes in their expression. Furthermore, it was observed that 51% of genes related to cardiac development exhibit splicing variants in myocardial tissue in children with TOF [25]. Importantly, recent research by Patil and colleagues reported that alterations in the levels of scaRNA targeting spliceosomal RNAs are responsible for splicing changes in cardiac regulatory genes. In their study, they specifically targeted scaRNA1 and snord94 which affect U2 and U6 snRNAs respectively in zebrafish embryos. This manipulation resulted in splice isoform changes in 13 out of 39 members of the Wnt pathway and significant changes in exon maintenance of cardiac regulatory genes when these targeted ncRNAs were downregulated [26]. The disruption of sno/scaRNAs signaling pathways can have implications for various pathologies, including neuromuscular disorder, congenital heart anomalies, and other malignancies [4]. The scaRNA-mediated modification of snRNAs play a crucial role in regulating mRNA splice isoforms of genes involved in heart development, such as (GATA4, DAAM1, DICER1, NOTCH2, MBNL1, and MBNL2) [26]. Disturbance in splicing patterns during the early embryonic stages can lead to a lack of communication between the first and second heart systems, resulting in congenital cardiac malformations, as observed in TOF cases [26].

The main function of snoRNAs is to target specific nucleotides in rRNA and spliceosomal RNA for biochemical modifications, mainly pseudouridylation. Levels of pseudouridylation in spliceosomal RNA U2 are dependent on the expression level of scaRNA1 [12]. A previous study has indicated that in vitro transcribed RNA containing 5-Fluorouridine 5’-triphosphate (5-FUTP) can inhibit pseudouridylation [27]. Changes in the expression of scaRNAs can result in alterations in the expression, transcript splicing, and translation of important genes during cardiac development, ultimately resulting in cardiac defects [25]. In this study, we have investigated the role of scaRNAs during cardiomyocyte differentiation and based on our ncRNA sequencing results, we have identified scaRNA20 as a key player in the process of cardiomyogenesis. scaRNA20 is known to interact with spliceosomal snRNA U12, facilitating biochemical modifications, specifically pseudouridylation at position U28 according to the snoRNABase interaction database (ID: SR0000247). Given these facts, we have hypothesized that scaRNA20 plays a significant role in cardiomyogenesis, primarily through the direct pseudouridylation of spliceosomal snRNA U12. Therefore, overexpressing scaRNA20 in iPSCs could potentially enhance cardiomyogenesis and improve the endurance properties of cardiomyocyte, enabling them to maintain contractility under hypoxic conditions.

Materials and Methods

Antibodies and Reagents

We used primary antibodies Cardiotroponin I (TNNI3, Santa Cruz Biotechnology, #SC-133117), Actin (Santa Cruz Biotechnology, #SC-1616), Cardiotroponin T (TNNT2, Abcam, #ab8295), GATA Binding Protein 4 (GATA4, Abcam, #ab134057), Phospho-TP53(S46) (NeoMarker, #RB-10617-P1), TP53 (Santa Cruz Biotechnology, #SC-6243), pSTAT3(Y705) (Cell Signaling, #9145T), STAT3 (Cell Signaling, #4904S) for immunostaining and western blot. For immunostaining, we used secondary antibodies to anti-goat, anti-rabbit, and anti-mouse (Jackson Immunology Research) and for western blot analysis, LI-COR secondary antibodies were used. Additionally, we used ProLong Gold Antifade Mountant with DAPI (Invitrogen, #P36935) for immunostaining. For cell culture, reprogramming, differentiation and collection we used Corning® Matrigel® Matrix (Corning, #354277), NutriStem hPSC XF Medium (ReproCELL, #01–0005), RPMI-1640 medium (sigma #R8758), DMEM: F12 (ATCC #30–2006), L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (L-AA2P) (Sigma, #A8960) TrypLE Express Enzyme (1X) (Gibco #12604013), ReLeSR (Stemgent, #05872), 1X Dulbecco′s Phosphate Buffered Saline (Sigma, #D8537), TRIzol Reagent (Invitrogen, # 15596026), Cucurbitacin I (Calbiochem CAS 2222–07-3), CHIR99021 (Sigma, #SML1046 ), and WntC59 (Tocris Bioscience, #5148). Then, we used mirVana miRNA Isolation Kit, with phenol (Ambion, #AM1560) SuperScript IV Reverse transcriptase (SSIV-RT) (Invitrogen, CAT# 18,091,050), HotStarTaq Plus DNA Polymerase (Qiagen, #203603), PowerUp SYBR Green Master Mix (Applied Biosystems, #A25777), Precision plus protein dual color standards ( Bio-Rad, #161–0374), Lipofectamine® RNAiMax Reagent (Invitrogen #2281162), Lipofectamine® LTX & Plus Reagent (Invitrogen, #1176202), siRNA U12 (Invitrogen, #n265245), siRNA for scaRNA20 (Millipore, SASI_Hs02_0037–7622), N-Cyclohexyl-N′-(2-morpholinoethyl) carbodiimide metho-p-toluene-sulfonate (CMCT) (Santa Cruz Biotechnology, #CAS2491–17-0), 5-Fluorouridine 5’-triphosphate (5-FUTP) (Benchchem, #B1244545).

Cell Culture

The iPSCs were reprogrammed from skin fibroblast using a non-viral method previously established in our laboratory [3, 28]. These iPSCs were cultured on Matrigel-coated plates in NutriStem medium at 37°C with humidified air in a 5% CO2 incubator for iCMC differentiation. After differentiation, the iCMCs were maintained in RPMI complete medium (RPMI+S) supplemented with L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (L-AA2P) and human serum albumin (0.05%) at 37°C with humidified air in a 5% CO2 incubator [3, 29]. H9C2 were cultured using DMEM F12 with 1% pen/strep and 10% FBS. For hypoxia conditions the iCMCs were incubated at 37°C with humidified air of 3% O2, 5% CO2, and 92% N2 for 24 hrs. The iPSCs were passaged using ReLeSR and the iCMCs were collected by using TrypLE Express.

Differentiation of iPSC into induced cardiomyocytes (iCMC)

To differentiate iCMCs, the iPSCs were grown in a Matrigel-coated four-well plate in the presence of 5% of CO2 in a 37°C incubator. At 80% confluence, iPSCs were differentiated into iCMCs as shown by us earlier [3, 28]. First, the iPSCs were treated with RPMI+S medium with 213 µg/ml of L-AA2P and 5 µM/ml GSK inhibitor (CHIR99021) for two days, followed by RPMI+S medium containing 2 µM/ml Wnt inhibitor (Wnt C59). We observed the beating colonies of iCMC under the microscope from day six onwards [3, 28, 29]. Then, the cells were collected to analyze the expression of the cardiac-specific genes and protein markers by qRT-PCR, immunostaining, and western blot as described earlier [3, 29, 30].

Non-Coding RNA Sequencing Analysis

The day zero iPSC, day seven iCMC, and day fifteen iCMC cell pellets were collected and sent to our collaborator Dr. Bittel for RNA sequencing. Bulk RNA was extracted using MirVana (Thermo Fisher) kit according to the manufacturer’s protocol. 0. 1 mg of total RNA was submitted for RNA-Seq analysis at the Genome Center at Children’s Mercy Hospital. For library preparation, TruSeq Stranded Total RNA Sample Prep Kit (#RS-122–2201, Illumina, San Diego, CA) was used and 2×101 paired-end sequencing of high output run mode was performed using the HiSeq 1500 instrument according to protocol. The resulting base calling files (.bcl) were converted into FASTQ files by Illumina’s bcl2fastq v.2.17.14 software. The FASTQ files were imported into Partek Flow analytical software (Partek Inc., St. Louis, MO) for further analysis. After pre-alignment, quality assessment, and trimming of the bases with a Phred quality score of less than 20, the reads were aligned to the hg38 reference genome using the STAR algorithm with the whole genome as the alignment index. The generated aligned reads were annotated with Ensemble100 as reference allowing 95 percent of the read feature to overlap the genomic feature and minimum read coverage set up to 5 reads for transcripts to be present. A Noise Reduction Filter was used to exclude features with a maximum value of less than 1 read for all samples. The data then underwent Transcripts Per Million reads mapped (TPM) normalization and were quantified using annotation from the Ensembl model. The results of the differential expression analysis were further validated by qRT-PCR.

Knockdown of scaRNA20 and U12 during iCMC Differentiation

siRNA oligos (designed from Sigma) were used to suppress the scaRNA20 during iCMC differentiation. Briefly, the iPSCs were grown in a NutriStem medium on a four-well plate coated with matrigel at a 5% level of CO2 at 37° C [3, 28]. Once iPSCs reached 80% confluence, they were transfected with siRNA (scaRNA20 or U12) with the help of Lipofectamine RNAiMax Reagent according to the modified manufacturer’s protocol. For control, we used MISSION® siRNA Universal Negative Control #1 (CAT #SIC001). Briefly, the transfection protocol involved diluting 6 µl of RNAiMax reagent with 125 µl of serum-free Opti-MEM medium and 30nM si-scaRNA20 or 25pm si-U12 or control siRNA diluted with another 125 µl of serum-free Opti-MEM in a separate centrifuge tube. Both tubes were incubated for 5 mins. Then, they were mixed and incubated for 20 mins at room temperature. Finally, the mixture was added drop by drop to the cells. Repeated transfection was performed at the time of every medium change during iCMC differentiation. Once the cells started beating, the scaRNA20-KD-iCMC and control iCMC were examined by microscope to see the morphological changes and to count the number of beating colonies. Then, the cells were collected to perform qRT-PCR, Western Blot, and PIV as described earlier [3, 29, 30], to determine the scaRNA20 knockdown efficiency.

Overexpression of scaRNA20 during iCMC Differentiation

The ncRNA of interest (scaRNA20) was selected based on our non-coding sequencing RNA analysis and the sequence was retrieved from NCBI Gene Database (Accession No. NC_000017.11). To validate the importance of scaRNA20 in cardiac development, we performed overexpression experiments. The CAG-GFP is an MMLV-based retro-viral mammalian expression vector that was selected and bought from addgene (Plasmid #16664 ) [31]. Cloning of scaRNA20 into the CAG-GFP vector (CAG-scaRNA20) was done by double digestion at BamHI and PmeI sites. The cloning confirmation and plasmid expansion are shown in the CAG-scaRNA20 vector map (Figure S2B-F). To overexpress scaRNA20, we have transfected the CAG-scaRNA20 plasmid into iPSCs using Lipofectamine LTX, then differentiated them into iCMCs, as described by us earlier [3, 28]. In brief, iPSCs were grown in a Matrigel-coated four-well slide with an iPSC medium under 5% CO2 in the 37°C incubator [3, 28]. Once iPSCs reached 80% confluence, the scaRNA20-containing plasmid was transfected with Lipofectamine LTX & Plus Reagent according to the modified manufacturer’s protocol. For control, we used an empty, CAG-GFP vector. Briefly, 4.6 µl Lipofectamine LTX was diluted with 100 µl of serum-free Opti-MEM medium. Then, 1 µg of CAG-scaRNA20 or control CAG-GFP plasmid was diluted with 100 µl of serum-free Opti-MEM medium added along with 3 µl of Plus Reagent. The diluted plasmid and reagent mixture were incubated separately for 5 mins at room temperature. Then, both solutions were combined and incubated for 10 mins at room temperature. Finally, the mixture was added to iPSCs grown in a 4-well plate and incubated under 5% of CO2 at 37°C for 4 hrs. After the incubation, the transfection medium was changed to NutriStem medium, and the cells were incubated overnight. Afterward, the iPSCs were differentiated into iCMCs. Once the cells started beating, the scaRNA20-OE-iCMCs and control iCMCs were examined by microscope to see the morphological changes and to count the number of beating colonies. We collected the cells based on the need to perform in vitro analysis to see the scaRNA20 overexpression efficiency during cardiomyogenesis. To show how ischemic cardiomyopathy affects CMC contractility, the iCMCs and scaRNA20-OE-iCMCs were subjected to hypoxic conditions (3% O2) for 24 hrs. In the pre- and post- hypoxia conditions, the beating colonies were video recorded by using CellSens standard software under an inverted fluorescence microscope (Olympus IX71). Then, we characterized the beating pattern of iCMCs and scaRNA20-OE-iCMCs by using the particle image velocimetry (PIV) method as described earlier [3, 32, 33].

To investigate the molecular mechanism of scaRNA20 in regulating cardiac differentiation through STAT3, we subjected normal iPSCs and scaRNA20-OE-iPSCs to treatment with the STAT3-specific inhibitor cucurbitacin I at a concentration of 50 ng/ml. For this, we began the normal process of iPSC differentiation towards iCMCs and on day 3, the cells were treated with cucurbitacin I. The treatment duration was 24 hours, following which we continued the differentiation process into cardiomyocytes. On Day 7 after differentiation, the cells were harvested, and their gene expression profiles were analyzed. We performed a qRT-PCR analysis to measure the expression levels of STAT3 and the cardiac-specific markers, namely TNNT2 and GATA4. This analysis allowed us to assess the impact of STAT3 inhibition on cardiac differentiation in these cell lines.

Particle image velocimetry (PIV) analysis

To study the functional characteristics of differentiated iCMCs using PIV analysis, we used 20× objectives, both in phase contrast and bright field modes to record high frame rate (10 frames/sec) movies in a temperature-controlled microscope. A movement pattern captured on a pair of images was analyzed using velocity field, beat patterns and average waveform methods described by us earlier [3, 33]. The PIV analysis evaluated the spatial and temporal information regarding the contractility pattern using an image cross-correlation algorithm. As the calculated beat patterns give the average displacement of the entire field of view relative to a resting reference state, it can be used to extract beat amplitudes and rates of contraction and relaxation. First, we identify individual contraction cycles as time periods between two consecutive minima of the beat pattern, encompassing a single peak. The beat amplitude is the mean value of the differences between the maximal and minimal displacements within each contraction cycle. Contraction and relaxation rates are calculated from the numerical time derivative, v(t), of the beat pattern function. The maximal contraction and relaxation rates correspond to the maximal and minimal observed values of v(t), within each contraction cycle. In the manuscript we present the mean and standard deviation values, calculated from the pooled contraction cycles.

Immunostaining

We performed the immunostaining analysis to characterize the protein of interest as previously described by us earlier [3, 29, 30]. Briefly, the cells were washed with 1X dPBS and fixed with 4% paraformaldehyde at room temperature for 4 mins. Then, the cells were washed with 1X dPBS three times at one-min intervals. After washing, the fixed cells were permeabilized with 1% TritonX-100 at room temperature for 3 mins. Then, the cells were blocked with 5% donkey serum for 30 mins at room temperature and followed by the addition of 1/100 dilution of primary antibodies. The cells were incubated overnight at 4°C. Further, the cells were washed with 1X dPBS three times at one-min intervals and incubated with 1/100 dilution secondary antibodies at 37°C for 1 hr. After incubation, the cells were washed three times with 1X dPBS. Finally, a drop of DAPI was placed over the cells and the slide was covered with a glass coverslip. All immunofluorescence staining was photographed using either a confocal or immunofluorescence microscope.

Western Blot Analysis

We performed the western blot analysis for the proteins of interest as described by us earlier [3, 29, 30]. Briefly, the proteins were collected by adding 30µl of lysis buffer per well of 4 well-plate and centrifuged at 13300g for 20 mins at 4°C. The supernatants were collected into fresh centrifuge tubes, and the total protein was quantified by Bradford’s assay in the Accuris instrument (Smartreader 96) at 595nm. All proteins were stored at - 80°C until used for further analysis. For sample preparation, 30µg of extracted proteins were denatured by boiling with 6 µl of 6X loading dye (Laemmli buffer) for 5 mins. The proteins were resolved on 12% SDS-PAGE along with a pre-stained protein ladder at 90 volts for stacking gel and changed to 110 volts for separating gel. After completing SDS-PAGE, the proteins from the gel were transferred to a 0.45µm PVDF membrane at a constant of 110 Volts for a minimum of 90 mins in the presence of 1X transfer buffer (methanol, Tris-glycine, and distilled water). The PVDF membrane was washed with 1X wash buffer (Tris-buffered saline (TBS) and 1% Tween20). The residual binding sites in the membrane were blocked by incubation with blocking buffer (Licor Blocking solution + Wash buffer) for 1 hour at room temperature. After blocking, the PVDF membrane was washed three times for 5 mins each in wash buffer. Then, the PVDF membrane was incubated with a specific primary antibody (1:1000 dilution in blocking buffer) at 4°C overnight. The next day, the PVDF membrane was washed three times with wash buffer and incubated with secondary antibody (LI-COR) 1:10000 dilution in the blocking buffer at room temperature for one hr. Finally, the blot was washed three times with wash buffer, and was developed using LI-COR Phosphoimager (Odyssey). The blot was analyzed and quantified by using Image Studio Lite software.

RNA Extraction

Total RNA extraction was performed using the mirVana miRNA isolation kit according to the modified manufacturer’s protocol. Briefly, the cell pellet was collected in a 1.5 mL centrifuge tube using TrypLE Express. Then,500 µL of Lysis/Binding Solution was added to the cell pellet, and it was vortexed vigorously to completely lyse the cells, followed by the addition of 50 µL of miRNA homogenate additive. The mixture was vortexed well and incubated on ice for 10 min. After incubation, 300 µL of Acid-Phenol: Chloroform was added to the cell lysate, and the solution was vortexed for 45 s followed by centrifugation at 10,000g for 5 min at room temperature. The aqueous phase, containing the RNA, was carefully removed, and transferred to a fresh 1.5 mL tube. Then, 1.25 volumes of room-temperature ethanol were added to the aqueous phase and mixed. A filter cartridge was placed into a collection tube and the mixture was transferred to the filter cartridge and centrifuged for 15 s at 10,000g to allow the mixture to pass through the filter. After centrifugation, the flow-through was discarded and 700 µL of miRNA wash solution 1 was added to the filter cartridge, followed by centrifugation for 10 s at 10,000g. The flow-through was discarded and 500 µL of wash solution 2/3 were added to the column followed by centrifugation for 10 s at 10,000 * g, and flow-through was discarded; this wash step was done twice. The filter cartridge was added to the same collection tube and centrifuged for 1 min empty spin at 10,000g to remove the residual fluid. The filter cartridge was then transferred to a new collection tube and 22 µL of pre-warmed (95 °C) nuclease-free water was added to the center of the filter cartridge and centrifuged for 30 sec at 10,000g. The RNA concentration was measured in the Nanodrop 8000 Spectrophotometer (Thermo Fisher) and was stored at − 80 °C for further experiments.

Pseudouridine (Ψ) Modification

To modify Pseudouridine (Ψ) in RNA samples, we treated previously extracted RNA with N-Cyclohexyl-N′-(2-morpholinoethyl) carbodiimide metho-p-toluene-sulfonate (CMCT) according to [12, 34, 35] with slight modifications. Briefly, a total of 1.5 µg of RNA were taken and diluted in 30 µL which were divided into two samples of 18 µL and 12 µL for the CMCT treated RNA (+ CMCT), and non-treated RNA (−CMCT) mock respectively, both samples were then brought up to 20 µL with nuclease-free water. To those samples, 2.9 µL of 40 mM EDTA (pH 8.0) was added. Then, the samples were briefly centrifuged, put into a shaking water bath for 3 mins at 80 °C, and then immediately placed on ice. Fresh 0.4 M CMC was prepared in BEU buffer (50 mM bicine pH-8.5, 4 mM EDTA, and 7 M urea) and added 100 µL to (+ CMCT), while in (−CMCT) 100 µL BEU buffer alone was added. The samples were briefly centrifuged to pull down and incubated at 40 °C for 45 min in a shaking water bath. RNA was then precipitated using 0.3 µL of glycogen (Ambion, CAT# 9510), 50 µL of 3 M sodium acetate (pH 5.2), and 1000 µL of ice-cold 100% ethanol. Then, the samples were incubated at −80 °C for 30 min and centrifuged at 16,000g for 30 min at 4 °C. The supernatant was carefully poured out and the RNA pellet was washed twice with 500 µL of ice-cold 70% ethanol and centrifuged at 16,000g for 10 min at 4 °C. After wash, the samples were air-dried for 2 min. To reverse the binding of CMCT to U and G residues, RNA was resuspended in 30 µL of sodium carbonate buffer (50 mM sodium carbonate pH 10.4 and2 mM EDTA) and then incubated for 2 h at 50 °C in a shaking water bath. RNA was then precipitated using 0.3 µL of glycogen, 3.5 µL of 3 M sodium acetate (pH 5.2), and 90 µL of ice-cold 100% ethanol. Then the samples were incubated at −80 °C for 30 min and centrifuged at 16,000g for 30 min at 4 °C. The supernatant was carefully poured out and the RNA pellet was washed twice with 500 µL of ice-cold 70% ethanol and centrifuged at 16,000g for 10 min at 4 °C. The RNA pellet was allowed to air dry for 5 min. The RNA was resuspended in 12 µL of nuclease-free water. The RNA concentration was measured in the NanoDrop 8000 Spectrophotometer and was stored at −80 °C for further experiments. We used 0.3 µg of treated RNA for first-strand cDNA synthesis.

RNA Immunoprecipitation of Pseudouridylated RNAs (RIP-PsU RNAs)

The RNA was immunoprecipitated by pseudouridine-specific monoclonal antibody (mAb-PsU) (Diagenode, CAT# C15200247) according to the Abcam protocol with slight modification.[36, 37] Briefly, a total of 5 µg of RNA were taken and diluted in 400 µL RIP buffer containing 150 mM KCl, 25 mM Tris (pH 7.4), 5mM EDTA, and 0.5 mM DTT, 0.5% NP40. Additionally, 100U/ml RNAase inhibitor and 1X protease inhibitor were added freshly to the RNA samples. Then, 5ug of mAb-PsU was added and the mixtures were incubated at 4 °C overnight with gentle rotation. The IgG was used as a negative control. After incubation, 40 µl of activated protein A-Sepharose CL-4B beads (GE Healthcare, CAT#17–0780-01) were added and the samples were incubated at 4 °C for 1 hour with gentle rotation. The unbound materials were washed out with RIP buffer thrice and once with PBS by centrifuging the beads at 600 g for 30 seconds at 4 °C. The co-precipitated RNAs were isolated by Trizol Reagent. Briefly, the beads were resuspended with the Trizol reagent mixed by pipetting up and down and stored at -80°C. For isolating RNA, the samples were thawed at room temperature, and each sample was shaken for 15 seconds after adding 200 µl of chloroform and incubated for 2–3 min at room temperature. The samples were centrifuged at 12,000 rpm for 15 min at 4°C for phase separation. The aqueous phase was collected into a sterile 1.5 ml tube, and the RNA was precipitated by adding 500 µl of cold 100% isopropanol along with 0.3 µL of glycogen (Ambion, CAT# 9510), and 50 µL of 3 M sodium acetate (pH 5.2) and incubated at -80°C for 20 min. The precipitated RNAs were pelleted by centrifuging at 12,000 rpm for 10 min at 4°C. Then, the pellets were vortexed briefly with 1ml of 75% ice-cold ethanol and washed by centrifuging at 7500 rpm for 5 min at 4°C. Finally, the pellet was air-dried and resuspended with 12 µl of DEPC water and incubated at 55–60°C for 5 min. Then, the samples were directly used for first-strand cDNA synthesis.

Reverse Transcription (RT)

The first-strand cDNA was synthesized using SuperScript IV Reverse transcriptase (SSIV-RT). Briefly, 1 µg of template RNA was reverse transcribed using a modified manufacturer’s protocol. First, the template RNA was mixed with 1 µl of 50 ng/µl of random hexamers, 1µl of 10mM dNTPs, and nuclease-free water up to 13 µl followed by incubation at 65 °C for 5 min and placed immediately on ice for a min after incubation. Then, 7 µl of RT reaction mix (4 µl of 5X SSIV Buffer, 1 µl 100mM DTT, 1 µl of 40U/µl Ribonuclease Inhibitor, 1 µl of 200U/µl SSIV-RT) was added to each sample. The total 20 µl reaction mix was incubated at 23 °C for 10 min, followed by 53 °C for 10 min. The reaction was then inactivated by incubating at 80 °C for 10 min. In the case of pseudouridylation quantification, the final reaction mix incubation was slightly modified according to prior studies [12, 35]. Briefly, the reaction mix was incubated at 23 °C for 1 hour, followed by 53 °C for 1 hour, and the inactivation of the reaction was at 80 °C for 10 min. Finally, the volume of cDNA was increased to 50 µl with nuclease-free water, whereas the cDNA of RIP-PsU RNAs was directly used without any dilution. The cDNAs were stored at − 20 °C for further experiments.

Thermal Cycler - Polymerase Chain Reaction (PCR)

The Polymerase Chain Reaction (Applied Biosystems – Veriti 96-well Thermocycler) was performed by using HotStarTaq Plus DNA Polymerase. Briefly, the total reaction volume of 10 µl was prepared with the composition of 0.5 µl of cDNA template, 2 µl of 5 pM forward and reverse primer mix (Forward – 5`-ATGCCTTAAACTTATGAG-3`; Reverse – 5`-CAGGCATCCCGCAAAGTAG -3`), 1 µl of 10 mM dNTP, 1 µl of 10X buffer, 1U of Taq polymerase and nuclease-free water up to 10 µl final volume. The reaction was amplified by initial denaturation of 95° C for 5 min and followed by 35 cycles at 94° C for 1 min, 53° C for 1min, and 72° C for 1min followed by a final extension cycle at 72° C for 10 min. The PCR products were resolved on 2% agarose dissolved in 0.5X TBE buffer with the addition of ethidium bromide. Then, the gel was visualized by the ENDURO GDS Labnet system and the band intensity was analyzed by using the ImageJ software to compare the samples.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

We performed the qRT-PCR by using PowerUp SYBR Green Master Mix as described by us earlier [3, 29, 30]. Briefly, the total reaction volume of 10 µl was prepared with the composition of 0.5 µl of cDNA, 1 µl of 5 pM forward and reverse primer mix, 5 µl of SYBR Green, and 3.5 µl of nuclease-free water, and the reaction was amplified using QuantStudio 6 Pro qRT-PCR (Applied Biosystems). The thermal cycling condition was set up with the UDG activation for 50 °C for 2 mins, then dual-lock DNA polymerase at 95°C for 2 mins followed by 40 cycles at 95° C for 1 s and 60° C for 30 sec and finalizing with melt curve. The point at which the intensity level crossed the threshold (Ct) was used to compare samples. The relative mRNA expression of target genes was normalized with skin fibroblast (SF). We used the endogenous control 18S rRNA for mRNA, in the case of ncRNA we used RNU48 (Table 1 for primer details). The results were expressed as fold changes in expression and values were calculated as a ratio of induced expression-to-control expression.

Table 1:

List of primers

Gene Forward Reverse
18S rRNA 5` - CTACCACATCCAAGGAAGCA - 3` 5` - TTTTTCGTCACTACCTCCCCG - 3`
ACTN2 5` - CAAACCTGACCGGGGAAAAAT - 3` 5` - CTGAATAGCAAAGCGAAGGATGA - 3`
GATA4 5` - TACATCAGCTTCCGGAACCACCAA - 3` 5` - GGAGGAACTGTCGCGAAGATCAAA - 3`
NKX2.5 5` - TCTATCCACGTGCCTACAGC - 3` 5` - AGATCTTGACCTGCGTGGAC - 3`
TNNT2 5` - GGCAGCGGAAGAGGATGCTGAA -3` 5` - GAGGCACCAAGTTGGGCATGAACGA - 3`
MYH7 5` - GGAGTTCACACGCCTCAAAGAG -3` 5` - TCCTCAGCATCTGCCAGGTTGT -3`
scaRNA20 5` - GGTCCCTGTTCTCCTTAG -3` 5` - TGTCTGAGGCAGGAAAAC -3`
RNU48 5` - AGTGATGATGACCCCAGGTAA -3` 5` - TGATGGCATCAGCGACACACTC-3`
GAR1 5` - GTGGAAGAGGAGCACTATTGCG -3` 5` - CACCACGAAGAACAGCCATAGG-3`
DKC1 5` - AGTTGTGAGGCTGGCACCTACA -3` 5` - ACAGCCACTGAGCATCAAGCAC-3`
NHP2 5` - CCTCACGCGGAAGCTCTACAAA -3` 5` - CAGTGTGTCTCCTGCCAAAACC -3`
NOP10 5` - GATGGGGACTCAACCGTTAGC -3` 5` - TTAAGGGACCCTCAGAGGACAG -3`
WRAP53 5` - TTTGGAGACTCAACCGTTAGA-3` 5` - CGGTGGCATCAGTTCAGAG -3`
ATF4 5` - TTCTCCAGCGACAAGGCTAAGG -3` 5` - CTCCAACATCCAATCTGTCCCG -3`
EPAS1 5` - GTGCTCCCACGGCCTGTA -3` 5` - TTGTCACACCTATGGCATATCACA-3`
HIF1α 5` - CCACAGGACAGTACAGGATG -3` 5` - TCAAGTCGTGCTGAATAATACC -3`
COIL 5` - GAGACGGTTAGGCTACGGC -3` 5` - GACGACTCGGCATCTGTTCAA -3`
T7-U12 5` - TAATACGACTCACTATAGATGCCTTA AACTTATGAG -3` 5` - CGGGCAGATCGCAACTCCCAGG -3`
Rt_T7-U12 5` - TAATACGACTCACTATAGATGCCTTA AACTTATGAG -3` 5` - CGGGCAGATCGCGTTACCTAGG -3`
Rt_GATA4 5` - CGCCTTCATGCACAGTGC -3` 5` - GTGTAAGCGGCTCCCTCAG -3`
Rt_TNNT2 5` - CCAAGGAGCTATGGCAGAGT -3` 5` - GGTGACTTTGGCCTTCCCAC -3`

Quantification of Pseudouridylation of scaRNA20 targeted at U28 in snRNA U12

To quantify the pseudouridylation of scaRNA20 at targeted site U28 in snRNA U12, we followed the approach with our target of interest as previously described [12]. The post-CMCT treated sample gained a long bulk side chain at Ψ28 which hindered reverse transcriptase activity, while this did not happen at the U28 in snRNA U12. To measure this hindrance, we designed an inner and outer primer concerning position U28 (Table 1). This will result in the loss of the outer fragment at Ψ28 in the CMCT treated sample during amplification, while the short fragment will be not impacted, representing the loss of efficiency. The +CMCT treatment was compared to the -CMCT treated samples, reflecting the amount of Ψ present in the RNA sample.

To determine the amount of Ψ, the ratio (R) of the relative fold change between outer fragments pre- and post CMCT treatment concerning the relative fold change in inner fragments pre- and post CMCT treatment was calculated according to the ratio equation previously described [12]. The equation is a semi-quantitative representation of the differences between multiple samples. The equation is as follows:

R=EouterfragmentΔCtouterfragmentMEANCMCTMEAN+CMCTEinnerfragmentΔCtinnerfragmentMEANCMCTMEAN+CMCT

where R represents the ratio, E represents the assay efficiency, and ΔCt represents the differences between the averages of the CMCT treated samples and the +CMCT treated samples. In a perfect reaction E=210, therefore we set E=2 in our calculations.

We have calculated the ratio (R) by using the threshold (Ct) of qRT-PCR, while in the case of a thermal cycler, the band intensity value was used to compare samples. The ratio (R) value depends on the quantitative values of each fragment that is present before and after CMCT treatment. A higher ratio (R) value represents more U28 in spliceosomal snRNA U12 due to less pseudouridylation by scaRNA20. A lower ratio (R) value represents the opposite, more Ψ28 in spliceosomal snRNA U12 due to more pseudouridylation by scaRNA20. To represent graphically, we inverted the ratio (R) to 1/R, with the units being “Relative Ψ Units” to relate scaRNA20 levels to the relative pseudouridylation level.

U12 gain or loss of function study by T7 in vitro synthesized RNA with modified uridines

To strengthen our hypothesis that snRNA U12 pseudouridylation upregulates cardiac-specific genes, we performed U12 gain or loss of function by T7 in vitro synthesized RNA. First, the genomic DNA was isolated from SF or H9C2 (rat cardiac cell line, myoblast) by using DNeasy Blood & Tissue Kit (Qiagen, #69504) as described by manufacture protocol. The U12 RNA was transcribed in vitro using PCR to amplify the U12 transcript with the T7 promoter by using forward and reverse primers (Table 1) designed with the T7 promoter and to amplify the full length (150 bp + 18bp of T7 promoter) of U12. The U12 sequences were retrieved from NCBI, human ID 267010 and rat ID 120100491. Then, 2.5 µl of 10 mM dNTP, 5 µl of 10X buffer, 1U of Taq polymerase, and nuclease-free water up to 50 µl final volume were used to set the U12 amplification reaction. The reaction was amplified by initial denaturation of 95° C for 5 min and followed by 35 cycles at 94° C for 1 min, 53° C for 1min, and 72° C for 1min followed by a final extension cycle at 72° C for 10 min. Then, the PCR product was purified using MinElute (Qiagen, #28004). Afterwards, we used 100 ng of PCR product to synthesize the standard (UTP) or modified with 5FUTP RNA using Hiscribe T7 (NEB, #E2040). Briefly, for each reaction we mixed 1.5 µl of 10X buffer, 1.5 µl of 100 mM ATP, GTP, UTP or 5FUTP and CTP, and 1.5 µl of T7 RNA polymerase mix and nuclease-free water up to 20 µl final volume. The reaction was incubated overnight at 37° C in a thermal cycler. To remove the PCR template, we added 70 µl of nuclease-free water, then 10 µl of 10X DNase I buffer and 2 µl of DNase I mix slowly and incubated for 15 mins at 37° C in a thermal cycler. Then, the RNA was purified by using a Monarch RNA cleanup kit (NEB, # T2050) according to the manufacturer’s protocol. The Ψ modified RNA was converted by using Sce PUS1 (NEB, #M0526). Briefly, we took 1 µg of purified standard T7 transcribed RNA (synthesized using UTP) in an RNase-free 0.5 µl centrifuge tube, then 10 µl of 10X NEBuffer 1.1 and 100 pmoles of Sce PUS were added and nuclease-free water up to 100 µl final volume. The reaction was incubated at 30° C for 2 hrs. Then, 800U of proteinase K was added to the sample and incubated again at 37° C for 15 mins to stop the reaction. The resulting RNA was purified by using Monarch RNA cleanup kit according to the manufacturer’s protocol.

To study the U12 gain or loss of function, the iPSCs were grown in Matrigel. Once the cell reached 80% confluency, they were differentiated into iCMC. The cells were transfected with 25pM of siRNA U12 (Cat. No. 4390771, ThermoFisher) on day 0 of the differentiation process. Then, on day 1, the U12-KD was recovered by either 25pM T7 transcribe standard RNA (containing UTP), or the modified RNA (containing ΨTP or 5FUTP). 25pM of MISSION® siRNA Universal was used as a negative control. On day 2 the cells were allowed to recover. Again, on day 3, the cells were knocked down with U12 siRNA and on day 4 recovered by T7 U12 RNAs. Then, the cells were observed every day by changing the iCMC differentiation medium. Once the cells started beating, they were examined by microscope to see the morphological changes and to count the number of beating colonies. Then, the cells were collected to perform qRT-PCR.

Protein network

To predict the specific interaction between the known proteins, we submitted the protein ID to the STRING server (https://string-db.org/), which is a database that provides computational direct protein-protein interactions and their indirect functional associations [38, 39].

Statistical Analyses

All experiments were carried out at least 3 times with similar results. Results are presented as means±SEM. Comparisons were performed by ANOVA (Graphpad Prism) or χ2 test or T-test for percentages. All tests were 2-sided, and a probability value of <0.05 was considered statistically significant.

Results

Generation and characterization of iCMC differentiated from iPSC

The iPSCs were differentiated into iCMC using a previously described protocol by us [3, 28]. Notably, we observed the emergence of beating colonies in culture starting from day six, with increased efficiency of beating colonies noted after day 10. A series of microscopic images captured the sequential changes in iCMCs during the differentiation of iPSCs (Figure S1A). The functionality of the day 14 iCMCs was confirmed through video image analysis (Video S1). To characterize the differentiated cells, we harvested day 14 iCMCs and tested them for the expression of cardiac-specific mRNAs and proteins. Our qRT-PCR analysis showed a significant increase in the mRNA expression of cardiac genes, including GATA4, NKX2.5, ACTN2, MYH7, and TNNT2, in iCMCs compared to iPSCs with normalization against SF. (Figures 1A, B). The enhanced mRNA expression was further validated through protein analysis. Immunostaining data demonstrated high expression of ACTN2 and TNNT2 in iCMCs (Figure 1C). Western blot analysis further confirmed the presence of cardiac proteins GATA4 and TNNI3 in the differentiated iCMCs, with β-actin serving as a loading control (Figure 1D). These findings collectively support the notion that the generated iCMCs, derived from iPSCs, function as true cardiomyocytes.

Figure 1: Characterization of iPSCs derived cardiomyocytes (iCMC).

Figure 1:

(A-B) mRNA expression of cardiac specific genes GATA4, NKX2.5, ACTN2, MYH7 and TNNT2 were significantly increased in iCMCs when compared to normal skin fibroblast (SF) when examined by qRT-PCR. **p < 0.01; ****p < 0.0001, SF vs iCMC. Fold expression was calculated as the ratio of iCMCs expression-to-parent control cells. (C) Protein expression was analyzed by immunofluorescence staining of TNNT2 (Green), and ACTN2 (Red). DAPI staining was done to visualize the nucleus (Blue). The immunofluorescence microscopic images show that most of the cells are double postive for TNNT2 and ACTN2 and possess well organized sarcomers in the merge panel. (D) Western blotting analysis for the expression of GATA4 and TNNI3. β-ACTIN in Western blotting was used as loading control. Western blot analysis data show that significantly high expression of GATA4 and TNNI3 in iCMCs when compared to SF or iPSCs. (E) Heat map for differential expressed scaRNAs and snoRNAs. (F) P-value table for the differential expressed scaRNAs and snoRNAs. (G) qRT-PCR validation of scaRNA20 expression in two different clones of iCMC (iCMC_1 and iCMC_2) for day 7 and day14. **p < 0.01; ***p < 0.001; ****p < 0.0001, SF vs iCMC. Each bar represents the mean ± SEM of three replicated experiments.

Small non-coding RNA analysis

Based on our ncRNA sequencing analysis, we identified a total of 16 scaRNAs with statistically significant alterations in expression across the three time points analyzed. Among these scaRNAs, the differential gene expression analysis in the form of a heatmap revealed that the most prominent changes were observed in scaRNA2, scaRNA9, scaRNA16, scaRNA22, snoRD67, and snoRD94, all of which were downregulated. Conversely, scaRNA20 exhibited a significant progressive upregulation during iCMC differentiation (Figure 1E, F). The expression pattern of scaRNA20 during iCMC differentiation was further validated by qRT-PCR using two different clones of iPSCs (Figure 1G). These results provide clear evidence that scaRNA20 plays an important role in the process of cardiomyogenesis.

Knockdown of scaRNA20 fails to differentiate iPSC into functional iCMC

To determine the importance of scaRNA20 in cardiac development, we performed a knockdown experiment during the process of iCMC differentiation. We utilized two different siRNAs, and it was observed that si-scaRNA20–1 (7626) achieved a more effective knockdown than si-scaRNA20–2 (7628, Figure S2A). We observed that scaRNA20-KD-iCMC failed to mature into functional iCMCs when compared with normal iCMC. Additionally, the number of beating colonies of scaRNA20-KD-iCMC on day 14 was significantly reduced (Figure 2A). To investigate the impact of scaRNA20 knockdown on cardiac gene expression in scaRNA20-KD-iCMCs, we harvested the day 14 iCMCs for qRT-PCR analysis. Our data showed a significant downregulation of scaRNA20 expression in scaRNA20-KD-iCMC when compared to control iCMCs with normalization using SF (Figure 2B). Furthermore, our qRT-PCR analysis demonstrated a significant decrease in the mRNA expressions of cardiac genes, including ACTN2, MYH7 GATA4, and NKX2.5, in scaRNA20-KD-iCMC when compared to control iCMC normalized with SF (Figure 2C-E). Notably, non-cardiac-specific genes such as OCT4 (iPSC-specific), CD105, and CD73 (mesenchymal-specific), did not exhibit significant alterations due to scaRNA20 knockdown (Figure S3A-C). In addition, Western blotting analysis showed a significant reduction in the expression of GATA4 protein in the scaRNA20-KD-iCMC when compared to the control (C)-iCMC (Figure 2F-G). Furthermore, functional defects of scaRNA20-KD-iCMCs were investigated through PIV analysis, revealing impaired contractility compared to control iCMC. The displacement images displayed irregular and faster contractions, with an increased frequency of beats per second (bps) and a decrease in relative power in scaRNA20-KD-iCMC compared to C-iCMC (Figure 2H, Videos S2-4). Divergence images showed greater displacement (warmer colors) in C-iCMC compared to the scaRNA20-KD-iCMC-1. As scaRNA20-KD-iCMC-1 yielded more effective knockdown results, it was chosen for further experiments. Overall, the results indicate that scaRNA20-KD leads to defective iCMC differentiation, highlighting the crucial role of scaRNA20 in proper cardiac function and cardiac differentiation.

Figure 2: Knockdown of scaRNA20 fails to differentiate iPSC into functional iCMC.

Figure 2:

(A) Significantly reduced number of beating colonies in scaRNA20-KD-iCMC when compared to normal iCMCs in 4-well plate. (B) qRT-PCR data show a reduced expression of scaRNA20 in scaRNA20-KD-iCMCs when compared to iCMCs. **p < 0.01, C-iCMC vs scaRNA20-KD-iCMC. (C-E) Significantly low levels of mRNA expression of cardiac-specific genes GATA4, NKX2.5, ACTN2, MYH7 and TNNT2 in scaRNA20-KD-iCMC when compared to normal iCMCs. *p < 0.05 ****p < 0.0001, C-iCMC vs scaRNA20-KD-iCMC. (F) Western blotting analysis data show the GATA4 expression was significantly lower in scaRNA20-KD-iCMCs when compared to control iCMCs. GAPDH in Western blotting was used as a loading control. (G) Protein quantification graph shows the GATA4 protein expression. ****p < 0.0001, C-iCMC vs scaRNA20-KD-iCMC. Each bar represents the mean ± SEM of three replicated experiments. (H) The contractility of CMCs was examined by particle image velocimetry (PIV) analysis under scaRNA20 knockdown (scaRNA20-KD-iCMC) using two different siRNAs. The displacement image shows the magnitude of contraction over time. The Fourier analysis shows the frequency of contraction in beats per second. In the divergence image, the warmer colors indicate higher displacement or contractility magnitudes, respectively. Each bar represents the mean ± SEM of three replicated experiments.

Overexpression of scaRNA20 enhanced the differentiation of iPSC into iCMC

The onset of beating colonies in scaRNA20-OE-iCMC was observed earlier than in normal iCMCs. Microscopic images captured various stages of scaRNA20-OE-iCMC differentiation and displayed the beating functionality of scaRNA20-OE-iCMC on day 7 (Figure S1B, Video S5). The number of beating colonies in scaRNA20-OE-iCMC on day 7 increased significantly when compared to control iCMC (Figure 3A). To investigate mRNA and protein expression at an early stage, we harvested the day 7 iCMCs from both control and scaRNA20-OE groups. Our qRT-PCR analysis demonstrated a significant increase in scaRNA20 expression upon overexpression (Figure 3B), promoting cardiac differentiation. Furthermore, the mRNA expressions of cardiac-specific genes such as GATA4, MYH7, ACTN2, NKX2.5, and TNNT2, were significantly upregulated in scaRNA20-OE-iCMCs compared to control iCMC. (Figure 3C-D). Importantly, the non-cardiac-specific genes such as OCT4 (iPSC specific), CD105, and CD73 (Mesenchymal specific), showed no significant alterations due to scaRNA20 overexpression (Figure S3D-E). This enhanced mRNA expression was further corroborated by protein analysis. Our Western blot analysis showed a significant increase in GATA4 protein expression in scaRNA20-OE-iCMCs compared to control iCMC (Figure 3E-F). These findings collectively indicate that the overexpression of scaRNA20 in iPSCs enhances cardiac differentiation.

Figure 3: Overexpression of scaRNA20 enhanced the differentiation of iPSC into iCMC.

Figure 3:

(A) Increased number of beating colonies observed in scaRNA20-OE-iCMC when compared to normal iCMCs in 4-well plate. (B) qRT-PCR data show an increased expression of scaRNA20 in scaRNA20-OE-iCMC when compared to normal iCMCs by qRT-PCR analysis. ****p < 0.0001, C-iCMC vs scaRNA20-OE-iCMC. (C, D) mRNA expression of cardiac-specific genes GATA4, NKX2.5, ACTN2, MYH7 and TNNT2 were significantly higher in scaRNA20-OE-iCMC when compared to normal iCMCs by qRT-PCR. **p < 0.01 ****p < 0.0001, C-iCMC vs scaRNA20-OE-iCMC. (E) Western blotting analysis data show the GATA4 expression was significantly higher in scaRNA20-OE-iCMCs when compared to control or normal iCMCs. GAPDH in Western blotting was used as a loading control. (F) Protein quantification graph shows the GATA4 protein expression. ****p < 0.0001, iCMC vs scaRNA20-OE-iCMC and C-iCMC vs scaRNA20-OE-iCMC. Each bar represents the mean ± SEM of three replicated experiments.

scaRNA20 overexpression in iCMC increased the level of pseudouridylation

To assess the impact of scaRNA20 overexpression on pseudouridylation levels at U28 in snRNA U12, a known target of scaRNA20 retrieved from small nucleolar RNA (snoRNA)-LBME-database (Figure S4A) [40], we designed inner and outer primers for thermal cycler–PCR and qRT-PCR in 5-carboxymethylcytidine (CMCT) treated samples. The schematic representation of primer design is shown in Figure S4B. Semi-quantitative PCR was performed using the designed primer, and the product was resolved on a 2% agarose gel (Figure 4A). The band intensity was measured using ImageJ software (Figure S4C). The ratio (R) was calculated based on band intensity value, reveling higher relative Ψ units in scaRNA20-OE-iCMCs compared to control iCMCs (Figure 4B). We also performed qRT-PCR for U12 primers, where the Ct value was used to calculate the relative Ψ units. This measurement was also found to be significantly higher in scaRNA20-OE-iCMCs compared to control iCMCs (Figure 4C). However, no changes were observed in the relative Ψ units of other snRNA U2 (Figure S4D) targeted by other scaRNAs such as scaRNA4 and scaRNA1.[26] For further details on the quantification of relative Ψ units, refer to Table 2. The qRT-PCR product was resolved on a 2% agarose gel (Figure 4D). Furthermore, we performed immunoprecipitation of total RNA using mAb-PsU, followed by qRT-PCR analysis of U12. This analysis revealed that scaRNA20-OE-iCMCs had a higher level of U12 RNA when compared to control iCMCs (Figure 4E), and the product was resolved on a 2% agarose gel (Figure 4F). These results regarding pseudouridylation quantification suggest that scaRNA20 targets the U28 position in snRNA U12, thereby regulating the expression of cardiac-specific genes. Additionally, to verify whether scaRNA20 influence pseudouridine synthases (PUS1, PUS3, and PUS10), we conducted qRT-PCR analysis on normal iCMCs and scaRNA-OE-iCMCs. Our data demonstrated that there were no significant changes in the mRNA expression of PUS1, PUS3 and PUS10 (Figure 4G).

Figure 4: scaRNA20 overexpression increased the level of U12 pseudouridylation.

Figure 4:

(A) The thermal cycler PCR product for C-iCMC and scaRNA20-iCMC between CMCT treated and untreated resolved in 2% agarose gel. (B) Relative Ψ quantification calculated by band intensity of thermal cycler PCR product. *p < 0.05, C-iCMC vs scaRNA20-OE-iCMC. (C) Relative Ψ quantification calculated by Ct value from qRT-PCR. *p < 0.05, C-iCMC vs scaRNA20-OE-iCMC. (D) Gel image of qRT-PCR product resolved on 2% agarose gel. (E) U12 expression level shows high in scaRNA20-OE-iCMC after PsU-mAb specific RIP by qRT-PCR analysis. ****p < 0.0001, C-iCMC (PsU-Ab) vs scaRNA20-OE-iCMC (PsU-Ab). Mouse IgG is used as negative control (NC). (F) Gel image of qRT-PCR product of PsU-mAb specific RIP sample resolved on 2% agarose gel. (G) qRT-PCR expression of pseudouridylase PUS1, PUS3 and PUS10. There were no significant (ns) difference noticed between cells used for the analysis. ns- C-iCMC vs scaRNA20-OE-iCMC. Each bar represents the mean ± SEM of three replicated experiments.

Table 2:

Sample calculation for pseudouridylation quantification

STEP:1
Sample Inner fragment _Ct-Value Mean Outer fragment _Ct-Value Mean
C-iCMC (−CMCT) 27.112 26.964 26.985 27.020 28.834 29.305 28.666 28.935
scaRNA20-OE-iCMC (−CMCT) 28.304 28.571 28.387 28.421 30.224 30.224 29.775 30.074
C-iCMC (+CMCT) 26.612 26.725 26.810 26.716 27.951 27.957 28.181 28.029
scaRNA20-OE-iCMC (+CMCT) 28.311 28.170 28.001 28.161 30.156 30.225 30.308 30.230
STEP:2
Sample C-iCMC scaRNA20-OE-iCMC
Treatment (−CMCT) (+CMCT) (−CMCT) (+CMCT)
Fragment Outer fragment Inner fragment Outer fragment Inner fragment Outer fragment Inner fragment Outer fragment Inner fragment
Mean Ct-Value 28.935 27.020 28.029 26.716 30.074 28.421 30.230 28.161
STEP:3
Sample C-iCMC scaRNA20-OE-iCMC
Fragment Outer fragment Inner fragment Outer fragment Inner fragment
Ct-Value Difference 0.906 0.305 −0.155 0.260
Ct-Value Efficiency 1.873 1.235 0.898 1.198
Ratio (R) 1.516635151 0.749761712
Relative Ψ units (1/R) 0.659354361 1.659354361

Pseudouridylation of U12 is influencing the regulation of cardiac-specific genes

To investigate the importance of U12 pseudouridylation during cardiac development, we conducted U12-KD experiments in iPSCs and differentiated them into iCMCs. Our qRT-PCR analysis showed that the expression of cardiac genes (ACTN2, GATA4, MYH7, NKX2.5 and TNNT2) were downregulated upon KD of U12 when compared to C-iCMCs (Figure S5A-F). To further substantiate our findings in human cells, we performed additional U12-KD experiments using H9C2 cell line, and the silencing efficiency was assessed by qRT-PCR. The qRT-PCR data indicated a significant reduction in snRNA U12 (p<0.001). Importantly, U12 silencing led to a significant decrease in the expression of cardiac-specific genes in H9C2 cells (Figure S6A-D). For further validation, we amplified the U12 T7 PCR template from genomic DNA and confirmed the sequence by sanger sequencing. The schematic illustration of T7 in vitro transcription of U12 is shown in Figure 5A. The results were aligned with the U12 sequence from NCBI using CLustal Omega and are presented in Figure 5B for human cells and Figure S6E for rat cells.

Figure 5: Transfection of the T7 in vitro transcribed U12 recovered the cardiac function in U12-KD cell.

Figure 5:

(A) Schematic illustration of T7 in vitro transcription of U12. (B) PCR product confirmation by sanger sequence. (C) Flow chart of U12-KD and recovery process during iCMC differentiation. (D & E) qRT-PCR analysis of U12 and GATA4 when the U12-KD-iCMCs treated with three different forms of uridine (UTP, ΨTP and 5-FUTP). *p < 0.05; ***p < 0.001, C-iCMC vs U12-KD-iCMC. ***p < 0.001; ****p < 0.0001, U12-KD-iCMC vs U12-KD-iCMC+U12-UTP. *p < 0.05, U12-KD-iCMC+U12-UTP vs U12-KD-iCMC+U12-Ψ, n= 3 or 9. Each bar represents the mean ± SEM of three replicated experiments.

Furthermore, we sought to recover the U12-KD effect using the T7 in vitro transcribed U12 RNA templates with three different forms of uridine (UTP, ΨTP and 5-FUTP). The flow chart illustrating the U12-KD and T7 RNAs recovery process during iCMC differentiation is displayed in Figure 5C, and for mammalian rat H9C2 cardiac cells in Figure S6F. The qRT-PCR analysis demonstrated that all three forms of U12 transfection were upregulated the U12 RNA expression in the U12-KD cells (Figure 5D), while GATA4 expression was only recovered in the UTP-containing U12 but not in pseudouridylated U12 (ΨTP) or U12 modified with 5-FUTP (Figure 5E). A similar effect was observed in H9C2 cells (Figure S6G-H). We have also quantified the number of beating colonies under a microscope at 10X phase. Our microscopic images and graphical data indicated that the UTP-containing U12 RNA template effectively recovered and significantly increased the number of beating colonies compared to the other two U12 RNAs (ΨTP and 5-FUTP) (Figures S7A-F). These findings suggest that UTP-containing U12 RNA may undergo partial pseudouridylation, possibly at our predicted U28 position of U12 inside the cell and this pseudouridylation regulates the expression of cardiac genes as shown in Figure 4. In contrast, the ΨTP and 5FUTP RNA templates were unable to restore the functionality of the iCMCs. Based on these data, we are confident that pseudouridylation of U12 influence the regulation of cardiac-specific genes.

Molecular regulatory mechanisms of scaRNA20 during cardiac differentiation

We used STRING software[38] to predict protein interactions between H/ACA box-specific core proteins and the cardiac-specific gene GATA4 (Figure 6A). Subsequently, to evaluate the impact of scaRNA20 on the H/ACA box core proteins, we performed a qRT-PCR analysis. Our qRT-PCR data indicate that in scaRNA20-OE-iCMCs, the mRNA expression of DKC1, NHP2, and NOP10 was elevated, while GAR1 was significantly reduced compared to control iCMCs (Figure 6B). Additionally, we observed a noticeable reduction in mRNA expression for WRAP53 and COILIN1 in scaRNA20-OE-iCMCs when compared to both control and scaRNA20-KD-iCMCs. Conversely, there was a significant increase in STAT3 expression in scaRNA20-OE-iCMCs. Furthermore, in the comparison of scaRNA20-KD-iCMCs with both control and scaRNA20-OE-iCMCs, we observed a significant increase in mRNA expression for WRAP53 and COILIN1, accompanied by a significant decrease in STAT3 expression (Figure 6C). Our Western blot analysis revealed a significant increase in activation of pTP53, followed by an increased protein expression of STAT3 in scaRNA20-OE-iCMC (Figure 6D-F). To further examine the molecular mechanism of scaRNA20 in the regulation of cardiac genes via WRAP53-STAT3 pathways, we conducted STAT3 knockdown experiments using a specific inhibitor cucurbitacin I, on C-iCMCs and scaRNA20-OE-iCMCs. Our qRT-PCR data clearly demonstrate that cucurbitacin I-treated cells exhibited a significant reduction in the expression of STAT3, even in the scaRNA20-OE-iCMCs. Meanwhile, there was a decreased expression of cardiac genes GATA4 and TNNT2 in normal iCMCs and scaRNA20-OE-iCMCs that received cucurbitacin I when compared to the untreated iCMC control (Figure 6G). These data provide insights into a potential molecular mechanism of scaRNA20 in regulating cardiac genes via the WRAP53-STAT3 pathways.

Figure 6: Effect of scaRNA20 overexpression in cardiomyogenesis.

Figure 6:

(A) Protein-protein interaction from STRING database. (B) mRNA expression of H/ACA box specific core protein GAR1, DKC1, NHP2 and NOP10 by qRT-PCR analysis. *p < 0.05; **p < 0.01; ***p < 0.001, C-iCMC vs scaRNA20-OE-iCMC. (C) mRNA expression of Cajal specific genes WRAP53, COIL1 and STAT3 in C-iCMCs, scaRNA20 knocked down and scaRNA overexpressed iCMCs by qRT-PCR analysis. *p < 0.05; ****p < 0.0001, C-iCMC vs scaRNA20-OE-iCMC and C-iCMCs vs scaRNA20-KD-iCMC. (D) Western blotting analysis for the expression of STAT3 and TP53. GAPDH in Western blotting was used as a loading control. (E) Protein quantification for STAT3. *p < 0.05; **p < 0.01, iCMC vs scaRNA20-OE-iCMC and C-iCMC vs scaRNA20-OE-iCMC. (F) Protein quantification for phosphorylated TP53 (pTP53). **p < 0.01, iCMC vs scaRNA20-OE-iCMC and C-iCMC vs scaRNA20-OE-iCMC. (G) mRNA expression of GATA4, TNNT2 and STAT3 in iPSCs treated with STAT3 inhibitor Cucurbitacin I at a concentration of 50 ng/ul for 24 hours on day 3 of diffentiation of control-iPSCs and scaRNA20 overexpressied iPSCs. q-RT-PCR data indicate that STAT3 expression was significantly reduced in both scaRNA-OE-iCMCs in the presence of Cucurbitacin I when compared to untreated control cells. These cucurbitacin I treated scaRNA-OE-iCMCs also showed significantly reduced mRNA expression of cardiac specific genes GATA4 and TNNT2. ***p < 0.001, C-iCMC vs scaRNA20-OE-iCMCs. Each bar represents the mean ± SEM of three replicated experiments.

scaRNA20 overexpression maintain the contractility of CMC under hypoxic condition

To simulate an ischemic environment, we exposed day 14 control iCMCs and scaRNA20-OE-iCMCs to hypoxic conditions (3% O2) for 24 hours to investigate the role of scaRNA20 modulated iCMCs under ischemic conditions. We recorded videos of beating colonies both in normal and post-hypoxic conditions (Video S69). The contractility function of beating colonies was analyzed using a non-invasive optical assay by PIV analysis, as previously described by us[3, 33]. Our PIV analysis showed that scaRNA20-OE-iCMCs had increased endurance properties by maintaining contractility under hypoxia, whereas control iCMCs failed to maintain contractility under hypoxic conditions (Figure 7A). Furthermore, hypoxia resulted in a 67% reduction in the beating amplitude, a 76% reduction in the rate of contraction and a 51% reduction in the rate of relaxation in normal cardiomyocytes. In contrast, overexpression of scaRNA20 protected iCMCs exhibited only 28%, 33% and 9% reductions in the beating amplitude, rate of contraction and rate of relaxation (Figure 7B). The hypoxia induced reduction was found to be significant (p<0.01) for each sample, except the reduction in the relaxation rate of scaRNA20 protected cardiomyocytes. We also found that some hypoxia-responsive genes, such as ATF4, HIF1α, and EPAS1/HIF2α, were significantly induced in scaRNA20-OE-iCMCs (Figure 7C-D). These findings strongly suggest that scaRNA20-OE-iCMCs may exhibit tolerance to the ischemia hypoxic environment, which mimics conditions after a myocardial infarction. The capacity of scaRNA20-OE-iCMCs to tolerate ischemia may hold therapeutic potential for damaged hearts.

Figure 7: The effects of scaRNA20 on CMC contractility under a hypoxic environment.

Figure 7:

(A) PIV analysis shows that the contractility is reduced in iCMCs whereas the scaRNA20-OE-iCMC maintained the conztractility under hypoxic conditions. The displacement image shows the magnitude of contraction over time. The Fourier analysis shows the frequency of contraction in beats per second. In the divergence image, the warmer colors indicate higher displacement or contractility magnitudes, respectively. (B) Estimated contraction amplitude (blue) and maximal rates of contraction (green) and relaxation (red) extracted from live microscopic recordings of beating normal and sca-RNA exposed cardiomyocites, before and after hypoxia. (C, D) mRNA expression of hypoxia-responsive genes ATF4, EPAS1, and HIF1α. *p < 0.05; **p<0.01; ***p < 0.001; ns-non-significance, C-iCMC (HYP) vs scaRNA20-OE-iCMC (HYP). Each bar represents the mean ± SEM of three replicated experiments.

Discussion

During MI, cardiac progenitors are lost, and the post-MI milieu can have a negative impact on the therapeutic potential of autologous cardiac progenitors. Manipulating autologous cells to transform them into primitive iPSCs and subsequently differentiating and rejuvenating them into CMCs presents an attractive strategy for stem cell transplantation therapy in cardiac patients. An existing challenge in cardiac cell therapy is the limited availability of safe human CMCs, particularly from autologous sources. In this study, we explored the effect of scaRNA20 overexpression in iPSCs, followed by their differentiation into iCMCs, and then we examined the role of scaRNA20 in cardiomyogenesis, particularly under hypoxia conditions which mimic the in vivo ischemic myocardium. Modification of snRNAs by scaRNAs is known to assist in the alternative splicing of mRNA isoforms of genes involved in heart development, such as GATA4, DAAM1, DICER1, NOTCH2, MBNL1, and MBNL2[26].

The influence of scaRNAs on U2 pseudouridylation and mRNA splicing during cardiac and embryonic development has been previously demonstrated [10]. Notably, scaRNA20 has been implicated in pseudouridylation of RNU12 at the U28 position[41]. Pseudouridylation can be either RNA-dependent or RNA-independent. In RNA-dependent pseudouridylation, a guide RNA, typically a H/ACA RNA, directly binds to the target RNA at a site-specific locus and converts the target uridine into a pseudouridine. On the other hand, in the RNA-independent mechanism, RNA pseudouridylation occurs by pseudouridine synthases, these enzymes recognize the substrate and catalyze the uridine-to-pseudouridine conversion reaction. The fact that scaRNA20 directly interacts with RNU12 at the U28 position is already known and has been reported in the snoRNABase database (ID: SR0000247). Our pseudouridylation quantification data strongly suggests that scaRNA20 acts as a guide RNA that binds directly to RNU12 and potentially mediates the pseudouridylation of the U28 position. To substantiate our claims, we measured the pseudouridylation levels of snRNA U12 at the U28 position. The scaRNA20-OE iCMCs showed increased pseudouridylation levels at this position (U28) compared to control iCMCs. Additionally, we analyzed the expression of three pseudouridine synthases (PUS1, PUS3, and PUS10) by qRT-PCR and found no significant alterations in their expression due to scaRNA20 overexpression, suggesting that these enzymes are not involved in snRNA U12 pseudouridylation. Our results strongly support the claim that the process of pseudouridylation of RNU12 at the U28 position is RNA-dependent and directly mediated by scaRNA20 and not by pseudouridine synthases. Moreover, our in vitro analysis indicated that scaRNA20 overexpressing iCMCs matured earlier than normal iCMCs as evidenced by the early onset of beating colonies on day 7. These scaRNA20 overexpressing iCMCs also exhibited significantly increased mRNA expression of cardiac genes, including ACTN2, GATA4, MHY7, TNNT2, and NKX2.5 when compared to control iCMCs on day 7. Conversely, scaRNA20-KD and U12-KD resulted in defective CMC differentiation.

We further examined the expression of pluripotent marker OCT4 and mesenchymal markers CD105 and CD73 to determine whether scaRNA20 overexpression or knockdown affected the cardiac differentiation process by maintaining the pluripotency/stemness. However, the absence of pluripotent gene OCT4 expression and mesenchymal markers CD105 and CD73 in both scaRNA20-OE-iCMCs and scaRNA20-KD-iCMCs indicates that the altered expression of scaRNA20 does not influence the expression of these non-cardiac genes nor disrupts the cardiac differentiation process. These findings, along with the early onset of beating colonies in scaRNA20-OE iCMCs and reduced number of beating colonies in the scaRNA20-KD iCMC suggest that scaRNA20 plays a significant role in cardiac development and function. Moreover, the higher pseudouridylation levels in snRNA U12, resulting from scaRNA20 overexpression are directly associated with increased expression levels of cardiac-specific genes.

Additionally, our loss or gain-of-function experiments with U12 in both human and mammalian cells demonstrated that U12-KD iCMCs reduced cardiac differentiation. However, rescue of U12-KD iCMCs with the T7 transcribed U12 RNA containing normal UTP improved the expression of cardiac-specific genes and cardiac differentiation, while rescue with U12 containing ΨTP (fully pseudouridylated) or 5-FUTP (lacking pseudouridylation) did not produce the same effect. This suggests that UTP-containing U12 RNA may undergo partial pseudouridylation, possibly modifying the U28 position to Ψ28 after transfection and this partial pseudouridylation influences the function of cardiac-specific genes. In contrast, fully pseudouridylated (ΨTP) and U12 lacking pseudouridylation (5-FUTP) transcripts could not produce the same results.

Furthermore, to assess the pseudouridylatory specificity of scaRNA20 for snRNA U12, we measured the pseudouridylation levels of the major spliceosomal RNA, snRNA U2, after scaRNA20 OE. We found no significant differences in pseudouridylation levels of snRNA U2 between scaRNA20-OE and normal iCMCs, indicating that scaRNA20 does not mediate U2 pseudouridylation and it specifically targets snRNA U12 for pseudouridylation. Our data strongly suggest that scaRNA20 facilitates cardiomyocyte differentiation by directly pseudouridylating snRNA U12. This process regulates U12-dependent alternative splicing of cardiac genes and promotes CMC differentiation. To demonstrate the impact of pseudouridylation of snRNA U12 on the expression of cardiac-specific markers, we performed U12 knockdown and rescue experiments in rat myoblasts (H9C2 cell line). Our findings on human-induced CMCs and the outcomes of these studies with H9C2 cells support the notion that partial pseudouridylation of snRNA U12 is necessary for normal cardiac function and cardiomyogenesis. snRNA U12 knockdown reduced the expression of cardiac-specific markers, and samples rescued with the fully pseudouridylated snRNA U12 (ΨTP) transcript or the transcript lacking pseudouridylation (5-FUTP) showed decrease expression of cardiac gene GATA4. These findings align with previous research demonstrating that changes in scaRNAs expression can lead to altered expression, aberrant transcript splicing, and translation of important genes during cardiac development, ultimately resulting in cardiac defects [25].

Previous studies have shown that depletions of core proteins DKC1, NHP2, and NOP10 destabilize H/ACA RNAs, through GAR1 does not exhibit the same effect in a yeast model [18, 19]. However, our study indicated that scaRNA20 overexpression in iCMC upregulated the mRNA expression of DKC1, NHP2, and NOP10, while GAR1 expression was significantly reduced. COIL is a protein marker for Cajal bodies (CB) and plays a role in CB integrity [42]. COIL forms a complex with WRAP53 and interacts with a conserved sequence motif present in many scaRNAs, suggesting a role as a possible regulator of genes [43, 44]. In contrast, the depletion of WRAP53 increased the levels of p53 [45]. Likewise, in our study, scaRNA20 overexpression led to a decrease in COIL and WRAP53 mRNA expression, activating TP53, which subsequently increased STAT3 expression. Furthermore, our findings revealed that the mRNA expression levels of WRAP53 and COILIN1 significantly increased in scaRNA20-KD-iCMCs, accompanied by a significant decrease in STAT3 expression when compared to both control and scaRNA20-OE-iCMCs. Additionally, when STAT3 was inhibited during iPSCs differentiation, it resulted in a failure to differentiate into iCMCs. Notably, STAT3-inhibited iPSCs overexpressed with scaRNA20 showed a reduced ability to differentiate into iCMCs. These findings demonstrate that scaRNA20 acts through STAT3, an important signaling molecule, to regulate cardiac differentiation. Previous studies have shown that the loss of p53 in cardiac fibroblasts reduces post-infarct vascular density and worsens cardiac function. Moreover, studies have shown that the stimulation of the p53 pathway in cardiac fibroblasts enhances vascularity and improves cardiac function [46], and the overexpression of p53 in iPSC improved cardiomyocytes differentiation, whereas knockdown of p53 decreased the yield of cardiomyocytes [47]. Downregulation of STAT3 has been associated with end-stage heart failure patients [48, 49]. Moreover, multiple studies showed that the activation of STAT3 promotes CMC survival and cardiac angiogenesis in response to various physiological stimuli, strongly suggesting that STAT3 is beneficial for the heart [48, 50, 51]. We have also shown that STAT3 plays an important role in the differentiation of mouse embryonic stem cells into cardiomyocytes [52]. Similarly, many studies revealed an essential role of STAT3 and GATA4 in the trans-differentiation of various cell types into cardiomyocytes [5254]. Our data clearly showed that overexpression of scaRNA20 in iCMCs downregulated COIL-WRAP53 expression, which in turn activated the essential cardiac gene regulator STAT3 through TP53. This mechanism possibly contributes to cardiomyocytes differentiation.

Recent studies have highlighted that iCMCs attain an adult phenotype through maturation [55, 56]. While these studies have primarily focused on electrophysiological endpoints; an important characteristic of a CMC is its contractile ability. Therefore, quantifying contractility is essential for assessing iCMC functionality. The novel cross-correlation method (particle image velocimetry-PIV) developed in previous research enables safe and manipulation-free assessment of CMC contractile function throughout differentiation process without compromising cell quality. [3, 33] Hypoxia serves as a method to mimic the ischemic heart environment in vitro, including oxidative stress, apoptosis, autophagy in cardiomyocytes, [57] and impacting cell proliferation and function during CMC development [58].

To assess the cardioprotective effect of scaRNA20, we exposed iCMCs to hypoxia conditions for 24 hours. The functional properties of scaRNA20-OE-iCMCs were evaluated by measuring their contractility using PIV analysis. Our results demonstrated that scaRNA20-OE-iCMCs maintained contractility under hypoxia, while control iCMCs failed to do so, highlighting the protective effect of scaRNA20 overexpression. These findings suggest that scaRNA20-OE-iCMCs exhibit resilience and adaptability in hypoxic environments, which mimic the ischemic conditions following a myocardial infarction. Consequently, scaRNA20 holds promising therapeutic potential for safeguarding cardiomyocytes in cases of post-infarcted heart damage and aiding in the restoration of normal cardiac function. Hypoxia, a common occurrence following myocardial infarction, is known to trigger apoptosis and autophagy in cardiomyocytes [59]. Recent research has indicated that scaRNA20 partially inhibits apoptosis and cell cycle arrest, providing a potential explanation for the survival of scaRNA20-OE-iCMCs under hypoxic conditions [60]. Conversely, scaRNA20-KD-iCMCs displayed compromised contractility compared to control iCMCs, highlighting the crucial role of scaRNA20 in cardiac development and function. Although the study did not assess the levels of scaRNA20 in normal iCMCs under hypoxia, it is known that hypoxia can influence the synthesis and function of non-coding RNAs [6163], potentially affecting scaRNA20 expression. Furthermore, cardiac hypoxia can impact the expression and function of miRNAs and other non-coding RNAs, with potential implications for alternative splicing and gene regulation in the heart [64, 65]. Additionally, hypoxia-induced tRNA fragmentation, which triggers cardiovascular remodeling, has been reported, and a recent study highlighted the protective role of SNORD113–6 against site-specific tRNA fragmentation through 2'-O-ribose methylation in an ex vivo model of ischemia in intact human arteries [66]. These findings suggest a potential link between cardiac hypoxia and snoRNAs, including scaRNAs, which could be significant in the pathogenesis of cardiovascular disorders. Future studies will focus on enhancing our understanding of the cardioprotective mechanisms associated with scaRNA20 overexpression under hypoxic conditions, as well as exploring the potential pathways through which scaRNA20-OE-iCMCs withstand hypoxia and how hypoxia influences scaRNA20 levels.

In this study, we have reported that overexpression of scaRNA20 in iPSCs enhances the expression of cardiac-specific genes through pseudouridylation mechanisms. This activation of downstream components leads to the differentiation of CMCs and sustains their endurance properties, especially in hypoxic environments. One limitation of this study is the absence of an examination of the effects of scaRNA20 on cardiomyocyte regeneration in the adult heart after ischemic injury. In future research, we intend to investigate deeper into the therapeutic potential of scaRNA20- overexpressed cardiomyocytes by investigating various dosing of cells and timing of administration strategies in a mouse model of myocardial infarction. By addressing these aspects, we hope to contribute further insights into the therapeutic potential of scaRNA20 in cardiac regeneration.

Supplementary Material

1
2
3
4
5
6
7
8
Download video file (6.4MB, mp4)
9
Download video file (17.7MB, mp4)
10
Download video file (18MB, mp4)
11
Download video file (18.3MB, mp4)
12
Download video file (16.1MB, mp4)
13
Download video file (16.6MB, mp4)
14
Download video file (14.3MB, mp4)
15
Download video file (15.7MB, mp4)
16
Download video file (15.5MB, mp4)

Highlights.

  • Small non-coding RNA sequence analysis shows that scaRNA20 is upregulated during cardiac differentiation.

  • The overexpression of scaRNA20 in iPSCs enhances cardiac differentiation.

  • The scaRNA20 knockdown in iPSCs impedes the development of fully functional cardiomyocytes.

  • The scaRNA20 increases the pseudouridylation of snRNA U12 at U28th position, influencing the expression of cardiac-specific genes via the WRAP53-STAT3 pathway.

  • In vitro data under hypoxic conditions, demonstrates that scaRNA20-OE-iCMCs exhibit potential resilience in an ischemic environment, suggesting the relevance for myocardial infarction treatment.

Funding

This work was supported in part, by the American Heart Association Transformational Project Award 20TPA35490215 and the National Institute of Health R01 grant HL141345 to JR and the American Heart Association postdoctoral award 952237 to SP.

List of Abbreviations

scaRNA

small Cajal-body associated RNA

iPSCs

induced Pluripotent Stem Cells

iCMCs

induced Cardiomyocytes

OE

Over-expression

KD

Knockdown

C-iCMCs

Control / Normal induced Cardiomyocytes

scaRNA20-OE-iCMCs

scaRNA20 over expressed induced cardiomyocytes

scaRNA20-KD-iCMCs

scaRNA20 knocked down induced cardiomyocytes

U12-KD iCMCs

U12 knocked down induced cardiomyocytes

Ψ

Pseudouridilation / pseudouridine

snRNA

small nuclear RNA

siRNA

silencing RNA

ncRNA

non-coding RNA

UTP

Uridine-5′-triphosphate

ΨTP

Pseudoridine-5′-triphosphate

PUS

pseudouridine synthase

scaRNP

small Cajal body-specific ribonucleoprotein

CVD

Cardiovascular Disease

TOF

Tetralogy of Fallot

5-FUTP

5-Fluorouridine 5’-triphosphate

CMCT

N-Cyclohexyl-N′-(2-morpholinoethyl) carbodiimide metho-p-toluene-sulfonate

H9C2

Rat cardiac cell line, myoblast

qRT-PCR

quantitative Real-Time Polymerase Chain Reaction

TPM

Transcripts Per Million

PIV

Particle Image Velocimetry

dPBS

Dulbecco’s phosphate-buffered saline

SDS

Sodium dodecyl sulfate

PAGE

polyacrylamide gel electrophoresis

PVDF

Polyvinylidene fluoride

TBS

Tris-buffered saline

EDTA

Ethylenediaminetetraacetic acid

cDNA

complementary DNA

mAb-PsU

pseudouridine-specific monoclonal antibody

DEPC

diethylpyrocarbonate

SSIV-RT

SuperScript IV Reverse transcriptase

RIP

RNA Immunoprecipitation

UDG

Uracil-DNA Glycosylase

Ct

Cycle threshold

SF

Skin Fibroblast

rRNA

ribosomal RNA

mRNA

messenger RNA

ATP

Adenosine triphosphate

GTP

Guanosine triphosphate

CTP

Cytidine triphosphate

CB

Cajal Bodies

cu

Cucurbitacin I

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflicts of Interest

The authors declare no potential conflict of interest relevant to this article.

Supplementary Information

Supplementary information available at Journal of Cell Science’s website.

Declaration of interests

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Rajasingh Johnson reports financial support was provided by National Heart Lung and Blood Institute. Johnson Rajasingh reports financial support was provided by American Heart Association. Selene Perales reports financial support was provided by American Heart Association. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data Availability Statement:

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

References

  • [1].Khan MA, Hashim MJ, Mustafa H, Baniyas MY, Al Suwaidi S, AlKatheeri R, Alblooshi FMK, Almatrooshi M, Alzaabi MEH, Al Darmaki RS, Lootah S, Global Epidemiology of Ischemic Heart Disease: Results from the Global Burden of Disease Study, Cureus 12 (2020) e9349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Batalov I, Feinberg AW, Differentiation of cardiomyocytes from human pluripotent stem cells using monolayer culture: supplementary issue: stem cell biology, Biomarker insights 10 (2015) BMI. S20050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Rajasingh S, Thangavel J, Czirok A, Samanta S, Roby KF, Dawn B, Rajasingh J, Generation of functional cardiomyocytes from efficiently generated human iPSCs and a novel method of measuring contractility, PLoS One 10 (2015) e0134093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Cao T, Rajasingh S, Samanta S, Dawn B, Bittel DC, Rajasingh J, Biology and clinical relevance of noncoding sno/scaRNAs, Trends in cardiovascular medicine 28 (2018) 81–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Esteller M, Non-coding RNAs in human disease, Nat Rev Genet 12 (2011) 861–874. [DOI] [PubMed] [Google Scholar]
  • [6].Samanta S, Balasubramanian S, Rajasingh S, Patel U, Dhanasekaran A, Dawn B, Rajasingh J, MicroRNA: A new therapeutic strategy for cardiovascular diseases, Trends in cardiovascular medicine 26 (2016) 407–419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Samarsky DA, Fournier MJ, Singer RH, Bertrand E, The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization, The EMBO Journal 17 (1998) 3747–3757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Falaleeva M, Pages A, Matuszek Z, Hidmi S, Agranat-Tamir L, Korotkov K, Nevo Y, Eyras E, Sperling R, Stamm S, Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing, Proceedings of the National Academy of Sciences 113 (2016) E1625–E1634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Marnef A, Richard P, Pinzón N, Kiss T, Targeting vertebrate intron-encoded box C/D 2′-O-methylation guide RNAs into the Cajal body, Nucleic acids research 42 (2014) 6616–6629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Terns MP, Terns RM, Small nucleolar RNAs: versatile trans-acting molecules of ancient evolutionary origin, Gene Expression The Journal of Liver Research 10 (2002) 17–39. [PMC free article] [PubMed] [Google Scholar]
  • [11].Kiss T, Filipowicz W, Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns, Genes & Development 9 (1995) 1411–1424. [DOI] [PubMed] [Google Scholar]
  • [12].Nagasawa CK, Kibiryeva N, Marshall J, O’Brien JE, Bittel DC, scaRNA1 levels alter pseudouridylation in spliceosomal RNA U2 affecting alternative mRNA splicing and embryonic development, Pediatric cardiology 41 (2020) 341–349. [DOI] [PubMed] [Google Scholar]
  • [13].Turunen JJ, Niemelä EH, Verma B, Frilander MJ, The significant other: splicing by the minor spliceosome, Wiley Interdisciplinary Reviews: RNA 4 (2013) 61–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].King TH, Liu B, McCully RR, Fournier MJ, Ribosome structure and activity are altered in cells lacking snoRNPs that form pseudouridines in the peptidyl transferase center, Molecular cell 11 (2003) 425–435. [DOI] [PubMed] [Google Scholar]
  • [15].Zhao Y, Dunker W, Yu Y-T, Karijolich J, The role of noncoding RNA pseudouridylation in nuclear gene expression events, Frontiers in bioengineering and biotechnology 6 (2018) 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Enwerem II, Velma V, Broome HJ, Kuna M, Begum RA, Hebert MD, Coilin association with Box C/D scaRNA suggests a direct role for the Cajal body marker protein in scaRNP biogenesis, Biology open 3 (2014) 240–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Enwerem II, Wu G, Yu YT, Hebert MD, Cajal body proteins differentially affect the processing of box C/D scaRNPs, PLoS One 10 (2015) e0122348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Vulliamy T, Beswick R, Kirwan M, Marrone A, Digweed M, Walne A, Dokal I, Mutations in the telomerase component NHP2 cause the premature ageing syndrome dyskeratosis congenita, Proceedings of the National Academy of Sciences 105 (2008) 8073–8078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Dez C, Henras A, Faucon B, Lafontaine DL, Caizergues-Ferrer M, Henry Y, Stable expression in yeast of the mature form of human telomerase RNA depends on its association with the box H/ACA small nucleolar RNP proteins Cbf5p, Nhp2p and Nop10p, Nucleic acids research 29 (2001) 598–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Kiss T, Fayet-Lebaron E, Jády BE, Box H/ACA small ribonucleoproteins, Molecular cell 37 (2010) 597–606. [DOI] [PubMed] [Google Scholar]
  • [21].Kalsotra A, Xiao X, Ward AJ, Castle JC, Johnson JM, Burge CB, Cooper TA, A postnatal switch of CELF and MBNL proteins reprograms alternative splicing in the developing heart, Proceedings of the National Academy of Sciences 105 (2008) 20333–20338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Castle JC, Zhang C, Shah JK, Kulkarni AV, Kalsotra A, Cooper TA, Johnson JM, Expression of 24,426 human alternative splicing events and predicted cis regulation in 48 tissues and cell lines, Nature genetics 40 (2008) 1416–1425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Kalsotra A, Wang K, Li P-F, Cooper TA, MicroRNAs coordinate an alternative splicing network during mouse postnatal heart development, Genes & development 24 (2010) 653–658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Lara-Pezzi E, Dopazo A, Manzanares M, Understanding cardiovascular disease: a journey through the genome (and what we found there), Disease models & mechanisms 5 (2012) 434–443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].O'Brien JE Jr, Kibiryeva N, Zhou X-G, Marshall JA, Lofland GK, Artman M, Chen J, Bittel DC, Noncoding RNA expression in myocardium from infants with tetralogy of Fallot, Circulation: Cardiovascular Genetics 5 (2012) 279–286. [DOI] [PubMed] [Google Scholar]
  • [26].Patil P, Kibiryeva N, Uechi T, Marshall J, O'Brien JE Jr, Artman M, Kenmochi N, Bittel DC, scaRNAs regulate splicing and vertebrate heart development, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 1852 (2015) 1619–1629. [DOI] [PubMed] [Google Scholar]
  • [27].Zhao X, Yu Y-T, Detection and quantitation of RNA base modifications, Rna 10 (2004) 996–1002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Rajasingh S, Sigamani V, Gurusamy N, Rajasingh J, Efficient and Safe Method of Generating Induced Pluripotent Stem Cells from Human Skin Fibroblasts and Subsequent Differentiation into Functional Cardiomyocytes, Methods in Molecular Biology (Clifton, NJ) (2021). [DOI] [PubMed] [Google Scholar]
  • [29].Gurusamy N, Rajasingh S, Sigamani V, Rajasingh R, Isai DG, Czirok A, Bittel D, Rajasingh J, Noonan syndrome patient-specific induced cardiomyocyte model carrying SOS1 gene variant c. 1654A> G, Experimental cell research 400 (2021) 112508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Rajasingh S, Sigamani V, Selvam V, Gurusamy N, Kirankumar S, Vasanthan J, Rajasingh J, Comparative analysis of human induced pluripotent stem cell‐ derived mesenchymal stem cells and umbilical cord mesenchymal stem cells, Journal of Cellular and Molecular Medicine 25 (2021) 8904–8919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Zhao C, Teng EM, Summers RG, G.-l. Ming, F.H. Gage, Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus, Journal of Neuroscience 26 (2006) 3–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Rajasingh S, Isai DG, Samanta S, Zhou Z.-g., Dawn B, Kinsey WH, Czirok A, Rajasingh J, Manipulation-free cultures of human iPSC-derived cardiomyocytes offer a novel screening method for cardiotoxicity, Acta Pharmacologica Sinica 39 (2018) 1590–1603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Czirok A, Isai DG, Kosa E, Rajasingh S, Kinsey W, Neufeld Z, Rajasingh J, Optical-flow based non-invasive analysis of cardiomyocyte contractility, Scientific reports 7 (2017) 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Carlile TM, Rojas-Duran MF, Gilbert WV, Pseudo-Seq: genome-wide detection of pseudouridine modifications in RNA, Methods in enzymology 560 (2015) 219–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Antonicka H, Choquet K, Lin ZY, Gingras AC, Kleinman CL, Shoubridge EA, A pseudouridine synthase module is essential for mitochondrial protein synthesis and cell viability, EMBO reports 18 (2017) 28–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Morales DR, Thomas K, Presser A, Bernstein BE, van Oudenaarden A, Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression, Proceedings of the National Academy of Sciences 106 (2009) 11667–11672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Hendrickson DG, Hogan DJ, McCullough HL, Myers JW, Herschlag D, Ferrell JE, Brown PO, Concordant regulation of translation and mRNA abundance for hundreds of targets of a human microRNA, PLoS biology 7 (2009) e1000238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Szklarczyk D, Gable AL, Lyon D, Junge A, Wyder S, Huerta-Cepas J, Simonovic M, Doncheva NT, Morris JH, Bork P, STRING v11: protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets, Nucleic acids research 47 (2019) D607–D613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Sigamani V, Rajasingh S, Gurusamy N, Panda A, Rajasingh J, In-Silico and In-Vitro Analysis of Human SOS1 Protein Causing Noonan Syndrome-A Novel Approach to Explore the Molecular Pathways, Current Genomics 22 (2021) 526–540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Lestrade L, Weber MJ, snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs, Nucleic acids research 34 (2006) D158–D162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Schattner P, Barberan-Soler S, Lowe TM, A computational screen for mammalian pseudouridylation guide H/ACA RNAs, Rna 12 (2006) 15–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Hebert MD, Phosphorylation and the Cajal body: modification in search of function, Archives of biochemistry and biophysics 496 (2010) 69–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Richard P, Darzacq X, Bertrand E, Jady BE, Verheggen C, Kiss T, A common sequence motif determines the Cajal body-specific localization of box H/ACA scaRNAs, The EMBO journal 22 (2003) 4283–4293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Enwerem II, Velma V, Broome HJ, Kuna M, Begum RA, Hebert MD, Coilin association with Box C/D scaRNA suggests a direct role for the Cajal body marker protein in scaRNP biogenesis, Biology open 3 (2014) 240–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Zhu Y, Sun W, Jiang X, Bai R, Luo Y, Gao Y, Li S, Huang Z, Gong Y, Xie C, Differential Effects of WRAP53 Transcript Variants on the Biological Behaviours of Human Non-Small Cell Lung Cancer Cells, (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Ubil E, Duan J, Pillai IC, Rosa-Garrido M, Wu Y, Bargiacchi F, Lu Y, Stanbouly S, Huang J, Rojas M, Mesenchymal–endothelial transition contributes to cardiac neovascularization, Nature 514 (2014) 585–590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Liu Y, Zhang P, Huang W, Liu F, Long D, Peng W, Dang X, Zeng X, Zhou R, p53 Promotes Differentiation of Cardiomyocytes from hiPSC through Wnt Signaling-Mediated Mesendodermal Differentiation, International journal of stem cells 14 (2021) 410–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Hilfiker-Kleiner D, Hilfiker A, Fuchs M, Kaminski K, Schaefer A, Schieffer B, Hillmer A, Schmiedl A, Ding Z, Podewski E, Podewski E, Poli V, Schneider MD, Schulz R, Park JK, Wollert KC, Drexler H, Signal transducer and activator of transcription 3 is required for myocardial capillary growth, control of interstitial matrix deposition, and heart protection from ischemic injury, Circulation research 95 (2004) 187–195. [DOI] [PubMed] [Google Scholar]
  • [49].Hilfiker-Kleiner D, Hilfiker A, Drexler H, Many good reasons to have STAT3 in the heart, Pharmacology & therapeutics 107 (2005) 131–137. [DOI] [PubMed] [Google Scholar]
  • [50].Jacoby JJ, Kalinowski A, Liu MG, Zhang SS, Gao Q, Chai GX, Ji L, Iwamoto Y, Li E, Schneider M, Russell KS, Fu XY, Cardiomyocyte-restricted knockout of STAT3 results in higher sensitivity to inflammation, cardiac fibrosis, and heart failure with advanced age, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 12929–12934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Levy DE, Lee CK, What does Stat3 do?, The Journal of clinical investigation 109 (2002) 1143–1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Rajasingh J, Bord E, Hamada H, Lambers E, Qin G, Losordo DW, Kishore R, STAT3-dependent mouse embryonic stem cell differentiation into cardiomyocytes: analysis of molecular signaling and therapeutic efficacy of cardiomyocyte precommitted mES transplantation in a mouse model of myocardial infarction, Circulation research 101 (2007) 910–918. [DOI] [PubMed] [Google Scholar]
  • [53].Arminan A, Gandia C, Bartual M, Garcia-Verdugo JM, Lledo E, Mirabet V, Llop M, Barea J, Montero JA, Sepulveda P, Cardiac differentiation is driven by NKX2.5 and GATA4 nuclear translocation in tissue-specific mesenchymal stem cells, Stem cells and development 18 (2009) 907–918. [DOI] [PubMed] [Google Scholar]
  • [54].Shabbir A, Zisa D, Lin H, Mastri M, Roloff G, Suzuki G, Lee T, Activation of host tissue trophic factors through JAK-STAT3 signaling: a mechanism of mesenchymal stem cell-mediated cardiac repair, Am J Physiol Heart Circ Physiol 299 (2010) H1428–1438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Lundy SD, Zhu WZ, Regnier M, Laflamme MA, Structural and functional maturation of cardiomyocytes derived from human pluripotent stem cells, Stem cells and development 22 (2013) 1991–2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [56].Kim C, Majdi M, Xia P, Wei KA, Talantova M, Spiering S, Nelson B, Mercola M, Chen HS, Non-cardiomyocytes influence the electrophysiological maturation of human embryonic stem cell-derived cardiomyocytes during differentiation, Stem cells and development 19 (2010) 783–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [57].Feng Q-M, Shao Y, Jiao R, Wei H-W, Dai M-Q, Xie H, Xu C, Li J-K, Effects of hypoxia on oxidative stress, autophagy and apoptosis in cardiomyocytes, Advances in Biological Chemistry 9 (2019) 54–67. [Google Scholar]
  • [58].Sun Y, Jiang C, Hong H, Liu J, Qiu L, Huang Y, Ye L, Effects of hypoxia on cardiomyocyte proliferation and association with stage of development, Biomed Pharmacother 118 (2019) 109391. [DOI] [PubMed] [Google Scholar]
  • [59].Natua S, Ashok C, Shukla S, Hypoxia-induced alternative splicing in human diseases: the pledge, the turn, and the prestige, Cell Mol Life Sci 78 (2021) 2729–2747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [60].Ma J, Nie K, Redmond D, Liu Y, Elemento O, Knowles DM, Tam W, EBV-miR-BHRF1–2 targets PRDM1/Blimp1: potential role in EBV lymphomagenesis, Leukemia 30 (2016) 594–604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [61].Nallamshetty S, Chan SY, Loscalzo J, Hypoxia: a master regulator of microRNA biogenesis and activity, Free Radic Biol Med 64 (2013) 20–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [62].Moreau PR, Örd T, Downes NL, Niskanen H, Bouvy-Liivrand M, Aavik E, Ylä-Herttuala S, Kaikkonen MU, Transcriptional Profiling of Hypoxia-Regulated Non-coding RNAs in Human Primary Endothelial Cells, Front Cardiovasc Med 5 (2018) 159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [63].Farina AR, Cappabianca L, Sebastiano M, Zelli V, Guadagni S, Mackay AR, Hypoxia-induced alternative splicing: the 11th Hallmark of Cancer, J Exp Clin Cancer Res 39 (2020) 110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Yang KC, Yamada KA, Patel AY, Topkara VK, George I, Cheema FH, Ewald GA, Mann DL, Nerbonne JM, Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support, Circulation 129 (2014) 1009–1021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [65].Sun X, Wang G, Luo W, Gu H, Ma W, Wei X, Liu D, Jia S, Cao S, Wang Y, Yuan Z, Small but strong: the emerging role of small nucleolar RNA in cardiovascular diseases, Front Cell Dev Biol 11 (2023) 1292925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [66].van Ingen E, Engbers PAM, Woudenberg T, van der Bent ML, Mei H, Wojta J, Quax PHA, Nossent AY, C/D box snoRNA SNORD113–6 guides 2'-O-methylation and protects against site-specific fragmentation of tRNA(Leu)(TAA) in vascular remodeling, Mol Ther Nucleic Acids 30 (2022) 162–172. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3
4
5
6
7
8
Download video file (6.4MB, mp4)
9
Download video file (17.7MB, mp4)
10
Download video file (18MB, mp4)
11
Download video file (18.3MB, mp4)
12
Download video file (16.1MB, mp4)
13
Download video file (16.6MB, mp4)
14
Download video file (14.3MB, mp4)
15
Download video file (15.7MB, mp4)
16
Download video file (15.5MB, mp4)

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

RESOURCES