Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2024 Apr 24;10(3):e1462. doi: 10.1002/vms3.1462

Establishment of a mouse allergy model for Culicoides (Diptera: Ceratopogonidae)

Shuncai Bao 1, Xue Lu 1, Shuai Xiang 1, Xiaohui Hou 1,✉
PMCID: PMC11043671  PMID: 38659360

Abstract

Background

Culicoides is a genus of ubiquitous biting midges (Ceratopogonidae). Female midges have blood‐sucking habit. They not only bite and harass humans and animals but also may be an important vector of disease transmission. Therefore, building an animal allergy model caused by Culicoides biting is very beneficial for studying its pathogenesis and exploring the therapeutic methods.

Material and method

Kunming mice were used in this study to build the model and sensitised by two‐step injection of midge extracts. Scratching behaviour and histological examination were used to check the immediate and delayed responses. Immunoglobulin E (IgE) and Immunoglobulin G (IgG) were detected using indirect enzyme‐linked immunosorbent assay (ELISA) assay. Splenic cell proliferation and cytokine production were determined using 3‐(4, 5‐dimethylthiazol‐2‐yl)‐2, 5‐diphenyl tetrazolium bromide (MTT) and ELISA assays. The response of cytokine gene expression to midge stimulation was analysed through quantitative real‐time polymerase chain reaction (qPCR).

Results

Behavioural results revealed a significant increase in scratching frequency among the midge‐sensitised animals (p < 0.05). Histological examination showed more inflammatory cytokine infiltration at the injection site of midge‐sensitised mice comparing to the ones in the control group. The serum levels of IgE and IgG1 antibodies in the midge‐sensitised group were significantly elevated (p < 0.05). After splenocytes were stimulated in vitro with midge extracts, the midge‐sensitised group's splenocyte count significantly increased in comparison to the control group. The midge‐sensitised group's qPCR data revealed a down‐regulation of tumor necrosis factor alpha (TNF‐α) expression and an increase in the expression of interleukin (IL)‐4, IL‐5, IL‐10 and IL‐13 but not in the control group (p < 0.05).

Conclusions

In this study, an animal model of Culicoides–mouse sensitisation was successfully constructed using a two‐step method. The mode of administration of the model was in good agreement with the natural immune pathway, and the immune response induced by the sensitisation of the model was similar to that produced by the bite of a midge.

Keywords: allergy, biting midge, Culicoides, mouse, model

Six‐week‐old mice were sensitised using a two‐step method using Culicoides extract, and the model was evaluated by behavioural, histopathology and specific antibody detection. Immunohistochemical staining showed a significant increase in the infiltration of CD4 and CD8 T cells into the dermal tissue of Culicoides‐sensitised mice, compared to control mice. Serum IgE (p < 0. 05) and IgG1 (p < 0. 05). In vitro stimulation with Culicoides extract induced significant proliferation of splenocytes (p < 0.001), and the mRNA expression of interleukin (IL)‐4, IL‐5, IL‐10 and IL‐13, which were induced by type 2 helper T lymphocytes, was significantly higher than that of the control group (p < 0.05).

graphic file with name VMS3-10-e1462-g008.jpg

1. BACKGROUND

Culicoides biting midges (Diptera: Ceratopogonidae) are arbovirus vectors that feed on a variety of vertebrates (Stokes et al., 2022). Female Culicoides require mammalian blood to produce eggs, and allergic reactions to Culicoides bites are caused by immune responses to Culicoides salivary components secreted during a blood meal. Culicoides saliva contains many proteins, including immunomodulating agents, enzymes and substances that facilitate blood feeding and parasite transmission (Opasawatchai et al., 2020). Culicoides has been shown to transmit a variety of animal‐associated pathogens, including Bluetongue virus, epizootic haemorrhagic disease virus, African horse sickness virus, vesicular stomatitis virus and Schmallenberg virus (Mellor, 2000). In addition, Culicoides can also transmit the Oropouche virus, which causes febrile illness in humans (Tugwell et al., 2021). They are well‐known pests of humans and many other animal species (Wanji et al., 2019).

In addition to significant advances in the study of virus transmission with Culicoides, some exciting findings in allergic reaction study have been reported. Previous studies have shown that re‐exposure of insect bite hypersensitivity (IBH) horses to midges and bites has been found in the studies on Icelandic horses and Awassi sheep with sweet itch producing a specific T helper type 2 (Th2) lymphocyte response, which triggers the proliferation and differentiation of B cells to produce the specific antibody immunoglobulin E (Lehiy et al., 2018; Pessoa et al., 2020). This result offers invaluable insight into the salivary sensitisation of the Culicoides.

The survival rate of Culicoides raised in the laboratory is not ideal; so the construction of animal models with Culicoides biting cannot be met easily, but using Culicoides whole‐body extracts is the only option for the subsequent studies. An intradermal test (IDT) on nine IBH and controlled horses with whole‐body extracts from Culicoides nubeculosus and C. sonorensis was performed in a study revealing that IBH‐affected horses more frequently showed positive IDT result than the controlled horses (Langner et al., 2008). The study on peripheral blood mononuclear cells obtained from IBH‐susceptible horses showed that stimulation with Culicodes whole‐body extracts could induce high levels of interleukin‐4 (IL‐4; Hamza et al., 2007). However, the relationship between midge bite and allergy is not yet fully understood. Therefore, establishing an animal model using Culicodes whole‐body extract would be beneficial for understanding this mechanism and working out the corresponding treatment strategy.

In this study, we aim to build an animal model using Culicoides extract and alum adjuvant immunosensitive mice that would be the first animal model to mimic the allergic reaction caused by the Culicoides bites and an essential tool to elucidate the underlying mechanisms and develop therapeutic strategies for it.

2. MATERIALS AND METHODS

2.1. Collection of Culicoides specimens

The specimens utilised in this study were collected from Ziwei Town, Yinjiang County, Tongren City, Guizhou Province, from July to August 2021 using ultraviolet light traps (purchased from Guang Chu Mei Mie Wen QI, GJ‐106). The light was set at approximately 1.5 m above the ground level from sunset (6:00–7:00 PM) until the next morning (6:00–7:00 AM; Žiegytė et al., 2021). For each site, collecting was conducted for over two consecutive nights. Collected insects were immediately stored in liquid nitrogen and taken to the laboratory. Female Culicoides biting midges were identified and separated from other insects using a stereo microscope (SZ61, Olympus) according to morphological characteristics including antennae and wing patterns (Songumpai et al., 2022) and non‐engorged Culicoides were selected for subsequent whole‐body extract preparation.

2.2. Host animals

Kunming (KM) mice aged 6–8 weeks were purchased from Changsha Tianqin Biotechnology Co. Ltd. and acclimatised for 1 week before the subsequent experiments. All animals were bred in a conventional specific pathogen‐free (SPF) animal room (three to four animals per cage) with a 12/12 h light/dark cycle and food and water ad libitum. The KMs cares and experimental protocols were reviewed and approved by the Animal Research and Ethics Committees of Zunyi Medical University.

2.3. Preparation of whole‐body Culicoides extract

Culicoides arakawae (Arakawa, 1910), C. kinabaluensis (Writh et Hubert), C. tainanus (Kieffer, 1916) and C. punctatus (Meigen, 1804) were selected from the collected midges (Figure 1; Yu et al., 2005). The Culicoides extracts were prepared as follows: approximately 2000 non‐engorged Culicoides specimens were dissolved in 5 mL phosphate‐buffered saline (PBS) pH 7.4 and dispersed on ice using a handheld high‐speed disperser for homogenisation (Van et al., 2012). The samples were sonicated and centrifuged (4°C, 8000 × g, 30 min), and the supernatant was collected and filtered through a 0.22‐mm filter. After filtration, the protein concentration was measured using Bicinchoninic acid (Beijing Solarbio Science & Technology Co. Ltd.) Protein Assay Kit, resulting in 16.12 mg/mL. The sample was aliquoted and stored at −80°C for further experiments (Chen et al., 2009).

FIGURE 1.

FIGURE 1

Open in a new tab

The characteristics of the species wings that are used to prepare whole‐body Culicoides extract, The scale bar represents 100 µm.

2.4. Sensitisation of host animal

Host animals were divided into two groups: midge‐sensitised and control group (20 males and 20 females in each group). The scheme of mouse sensitisation experiment refers to the method described in Lee et al. (2014): on Days 0, 7, 14 and 21, the mice in the midge‐sensitised group were injected intraperitoneally with 200 µL solution containing 20 µg of Culicoides extract and 2 mg of alum adjuvant, while the control group was sensitised by intraperitoneal injection of 200 µL PBS containing 2 mg of alum adjuvant at the same time; on Days 28, 31 and 35, mice in the midge‐sensitised group were sensitised by intradermal injection with 10 µg of Culicoides extract, while the control group was intradermally injected only with PBS; scratching behaviour of mouse was recorded on Day 35; the skin of the stimulated site was taken for the following experiment on Day 40; the spleen cells of the host were separated for the in vitro experiment on Day 42; the mice were anaesthetised using ether on Days 0, 14, 28 and 42, followed by collecting the blood samples from the retro‐orbital plexus and stored at −80°C for the further experiments (Lee et al., 2016).

2.5. Evaluation of scratching behaviour

The fur on the intraperitoneal injection site of mice was removed using a razor. Following intradermal injection on Day 35, a camera was set up for recording the number of scratches in 1 h, including mouth, front paw and back paw scratching (Choi et al., 2020).

2.6. Histologic examination of delayed response

For histologic examination, intradermal challenges on the abdomen skin were inducted on Day 40. After 20 min, 24 h and 48 h, the mice were sacrificed using cervical dislocation, and the challenge site was removed and placed in 10% neutral buffered formalin overnight at room temperature. The skin tissue was dehydrated gradually through 70%, 80% and 95% and absolute ethanol (Guo et al., 2020), then soaked in xylene for 1 h at 55–60°C followed by embedding in paraffin for 1 h. The specimens were sectioned to a thickness of 5 µm using a Leica RM2235 microtome (Leica) and followed by deparaffinisation and haematoxylin and eosin stain. The sections were also stained with rabbit anti‐CD4 (1:200) and rat anti‐CD8 (1:200) monoclonal antibodies (NovusBiologicals) to detect cluster of differentiation (CD)‐maker positive cells: The sections were incubated with peroxidase‐labelled goat anti‐rabbit and goat anti‐rat antibodies and stained in the substrate solution containing 3,3′‐diaminobenzidine (ZSGB‐BIO). Inflammatory cell infiltration was examined using light microscopy, and the images were taken using the microscopic camera system BA400 Digital (Motic Group Co. Ltd.).

2.7. IgE and IgG detection in serum samples using indirect enzyme‐linked immunosorbent assay (ELISA)

Following the protocols of Immunoglobulin E (IgE) and Immunoglobulin G (IgG) ELISA detection kits (Elabscience Biotechnology Co. Ltd.), the levels of the two antibodies in the serum samples were detected.

2.8. Splenocyte proliferation detection using MTT assay

After the spleen was removed from the mice on Day 42, spleen tissues were homogenised in 5 mL of PBS buffer on ice using a 20 mL syringe plunger. The suspension of spleen cells was then filtered with a 200‐mesh sieve, and 1 mL erythrocyte lysate was added to precipitate the suspended cells. The cells were incubated in an ice bath for 2 min and centrifuged at 1000 rpm for 5 min; the supernatant was discarded and cell pellets were obtained. The cells were resuspended in RPMI1640 medium containing 10% fetal bovine serum and 1% double antibody. The cell suspension was inoculated into 96‐well microtiter plates (1 × 107 cells/well). Culicoides extracts with a total concentration of 0, 0.1875, 0.375, 0.75, 1.5 and 3 µg/mL were added. The cells were cultured at 37°C with 5% CO2 for 72 h. The cultures were then incubated with 10 µL 0.5 mg/ml MTT ([3‐(4,5‐dimethylthiazol‐2‐yl)−2,5‐diphenyl tetrazolium bromide]) for another 4 h. After centrifugation, 100 µL dimethyl sulfoxide (DMSO) was added into each well and mixed at room temperature for 15 min to dissolve the formazan dye. The optical density (OD) values of each well were measured at 490 nm using the WD‐2102B enzyme marker (Beijing Liu Yi Biotechnology Co. Ltd.).

2.9. Detection of cytokine expression using qPCR

Quantitative real‐time polymerase chain reaction (qPCR) was used to detect the cytokine expression in the spleen cells. Total RNA was extracted from the cells using the Takara RNA extraction kit, and cDNA was prepared with the FastKing gDNA elimination RT SuperMix kit (Tiangen Biotechnology (Beijing) Co. Ltd.). Each PCR reaction includes 5 µL SYBR master mix (MedChemExpress), 3.6 µL ddH2O, 0.2 µL forward and 0.2 µL reverse primers (Table 1; Lee et al., 2014) and 1 µL template cDNA. The PCR programme includes: initial denaturation (95°C, 30 s); 40 cycles of denaturation (95°C, 10 s), annealing (60°C, 10 s) and extension (72°C, 30 s); and final cycle (95°C, 15 s; 60°C, 60 s; and 95°C, 15 s). SYBR Green qPCR Master Mix (Universal) and AGS 4800 fluorescence quantitative PCR instrument were utilised for quantitative PCR analysis, and the β‐actin gene was used as the internal reference. The relative expression level of the target gene was calculated via the formula 2− ΔΔCT.

TABLE 1.

The primers used in qPCR.

Gene (mouse) Primer sequences Product size (bp)
TNF‐a

F:5’ CAT CTT CTC AAA ATT CGA GTG ACA A 3’

R:5’ TGG GAG TAG ACA AGG TAC AAC CC 3’

 175
IL‐4

F:5’ AGC CAT ATC CAC GGA TGC GAC AAA 3’

R:5’ AAT ATG CGA AGC ACC TTG GAA GCC 3’

 176
IL‐5

F:5’ AGCACAGTGGTGAAAGAGACCTT 3’

R:5’ TCCAATGCATAGCTGGTGATTT 3’

 117
IL‐6

F:5’ CCA TCC AGT TGC CTT CTT G 3’

R:5’ AAG TGC ATC ATC GTT GTT CAT AC 3’

 223
IL‐10

F:5’ CCA AGC CTT ATC GGA AAT GA 3’

R:5’ AGG GGA GAA ATC GAT GAC AG 3’

 155
IL‐13

F:5’ AGA CCA GAC TCC CCT GTG CA 3’

R:5’ TGG GTC CTG TAG ATG GCA TTG 3’

 123
β‐actin

F:5’ GGCCAACCGTGAAAAGATGA 3’

R:5’ CACGCTCGGTCAGGATCTTC 3’

 251
Open in a new tab

Abbreviations: IL, interleukin, TNF‐, tumor necrosis factor alpha.

2.10. Statistical analysis

All experimental data were collected through three or more repeats and expressed as mean ± SD. To compare the results from the two groups, unpaired Student's t test was applied; for multiple comparisons, one‐way analysis of variance (ANOVA) with Tukey post hoc test was applied. The significance of the differences in the data was tested and the results with p < 0.05 were considered as significant. All statistical analyses were performed using GraphPad Prism6 software.

3. RESULTS

3.1. Evaluation of scratching behaviour for immediate response

Midge‐sensitised mice showed significantly more scratch bouts on the abdominal challenge sites than the controlled mice (midge‐sensitised group: 23.09 ± 5.94, n = 11; control group: 11.73 ± 4.90, n = 11, p < 0. 001) as shown in Figure 2.

FIGURE 2.

FIGURE 2

Open in a new tab

Counts of scratches from the mice in the midge‐sensitised and control groups. Results were mean±SD of nine mice from each group (***p < 0.001, n = 11, by Student's t test).

3.2. Histologic examination of delayed response

Following two rounds of sensitisation, intradermal stimulation induced severe oedema in the skin of midge‐sensitised mice within 20 min (Figure 3b,c), while no sign of oedema was observed in the control group (Figure 3a). The oedema was still present in the midge‐sensitised group (Figure 3e,f) but not in the control group (Figure 3d) even 24 h after the intradermal stimulation. Immunohistochemical staining showed that the infiltration of CD4 and CD8 T cells in the dermal tissue of the midge‐sensitised mice was significantly increased, compared to the control group (Figure 4).

FIGURE 3.

FIGURE 3

Open in a new tab

Histologic features of abdominal skins from the mice in the midge‐sensitised (a & d) and control (b & e) group (the areas in the rectangles shown with high magnification in c & f, respectively).

FIGURE 4.

FIGURE 4

Open in a new tab

The infiltration of CD4 and CD8 T cells in the dermis tissue observed in 24 and 48 h after intradermal injection (immunohistochemistry [IHC] 200 ×, Scale bar = 40 µm).

3.3. Midge‐specific antibodies

The ELISA was used to determine the levels of specific antibodies IgE, IgG1 and IgG2a in the serum of mice. The results showed that the levels of IgE and IgG1 in the serum of mice in the midge‐sensitised group were significantly greater (starting from Day 14), compared to the control group (p < 0.05). These levels continued rising as the duration of sensitisation extended (Figure 5a,b). Moreover, from Day 28, the levels of IgE and IgG1 in the mice's serum were significantly increased (p < 0.05) in the midge‐sensitised group. However, as the sensitisation time increased, the rate of increase began to slow down. There was no significant difference in IgG2a antibody level between the midge‐sensitised and the control group (Figure 5c). Therefore, the injection of the Culicoides whole‐body extract resulted in a higher level of specific antibodies in mice, such as raised levels of IgE and IgG1, contributing to allergic reactions.

FIGURE 5.

FIGURE 5

Open in a new tab

Levels of IgE (a), IgG1 (b) and IgG2a (c) in serum from the mice in the midge‐sensitised and control groups (*p < 0.05, **p < 0.01, ***p < 0.001, n > 5, by one‐way ANOVA with the Tukey's post hoc test).

3.4. Splenocyte proliferation detection using MTT assay

After incubating the splenocytes of mice with different concentrations of Culicoides whole‐body extracts for 72 h, the proliferation rate of the splenocytes of mice in the control and midge‐sensitised groups was detected using MTT assay, which showed that the survival rate of the splenocytes of the sensitised mice in the midge‐sensitised group significantly increased, compared to that the control group (p < 0.001), and the survival rate of splenocytes increased following increasing concentrations of midge extracts, The highest splenocytes survival rate was observed when the concentration of midge extract was 1.5 µg/mL (Figure 6).

FIGURE 6.

FIGURE 6

Open in a new tab

In vitro proliferation of splenocyte between two groups (**p < 0.001, one‐way ANOVA with the Tukey's post hoc test).

3.5. Splenocyte cytokine expression

According to the proliferation result, the splenocytes of the midge‐sensitised and the control group were treated with 1.5 µg/mL Culicoides extract. After 72 h of culture, the cytokine expression was detected using qPCR. The results showed that Th2 cytokine (IL‐4, IL‐5, IL‐10 and IL‐13) expression in the spleen cells of the sensitised mice is significantly higher than the ones in the control group (p < 0.01), but there was no difference in IL‐6 expression between the two groups, while there was no significant change in Th1 cytokine tumor necrosis factor alpha (TNF‐α;) (Table 2, Figure 7).

TABLE 2.

The expression of cytokines in the spleen cells in different groups.

Group Interleukin (IL)‐4 IL‐5 IL‐10 IL‐13 IL‐6 TNF‐α
Midge‐sensitised 7.14 ± 2.02 *** 12.14 ±1.11 *** 4.39 ± 0.74 ** 5.71 ± 1.17 *** 3.05 ± 0.58 3.39 ± 0.91
Control 1.13 ± 0.80 1.92 ± 0.82 1.16 ± 0.12 1.35 ± 0.33 1.66 ± 0.94 1.39 ± 0.45
Open in a new tab
**

p < 0.01;

***

p < 0.001.

FIGURE 7.

FIGURE 7

Open in a new tab

Cytokine expression level in the spleen cells of mice from different groups induced by 1.5 µg/mL Culicoides extract (**p < 0.01, ***p < 0.001, n = 4, one‐way ANOVA with the Tukey's post hoc test).

4. DISCUSSION

Culicoides, being a haematophagous insect, the female needs blood from vertebrates to complete reproduction and can transmit the virus efficiently to animals and to other midges (McGregor & Lewis, 2023). After collecting the specimens in the study area, four dominant species were identified: C. arakawae, C. kinabaluensis, C. tainanus and C. punctatus. Culicoides can have an enormous economic impact on animals by transmitting diseases. In addition, their bites can induce itchy and allergic reactions in humans (Sick et al., 2019). Due to the low survival rate of culturing midges in the laboratory, we used a two‐step sensitisation method to construct a Culicoides‐‐mouse sensitisation model (Lee et al., 2014). Behavioural and histological findings indicate that mice sensitised to Culicoides extract exhibit both immediate and delayed allergic reactions, which is consistent with those observed in human studies (Lee et al., 2014). This model is different from the mosquito–mouse model, as in the latter one, the BALB/c mice were sensitised to Aedes. Aegyptiis goes through multiple bites directly (Henrique et al., 2019), which is more similar to natural exposure. ELISA results showed that IgE and IgG1 exhibited more in the experiment group than the control group but not in the case of IgG2a, which is consistent with the findings observed in the mice sensitised to recombinant salivary allergens lack of adjuvants (Barros et al., 2016; Sick et al., 2019). The expression of IL‐4, IL‐5, IL‐10 and IL‐13 in Th2 cells for immune response remained unaltered by (Th1) TNF‐α, which suggests a shift towards Th2 cells in the Culicoides–mouse sensitisation model.

It is good to establish an animal model for allergic diseases; however, it remains challenging to apply it to the natural human sensitisation, as the sensitisation through unnatural pathways may result in varying symptoms, for instance, the nasal and intradermal sensitisation for house dust mite in mouse models showed different results (Dijoux et al., 2023). However, it has been reported that some allergy symptoms can be induced through artificial ways, such as injecting peanut powder to create a mouse model for peanut allergy (Dolence, 2021), or using kiwifruit extract through skin contact to establish a model (Kinugasa et al., 2021). The mouse model constructed in this study may add additional knowledge in the areas of urticaria, pruritus and erythema induced by insect bites.

A mouse model sensitised by vector insect bites was utilised to investigate the effects of antiallergic therapy and the mechanism of allergic pruritus stimulation (Akiyama et al., 2018). Meanwhile, the developed DNA vaccine has demonstrated its ability to block Forcipomyia taiwana bites that cause allergic reactions and protect mice from allergen sensitisation caused by F. taiwana (Lee et al., 2016).

5. CONCLUSION

In summary, a two‐step sensitivity scheme has been successfully applied to construct a sensitive Culicoides–mouse model. The immune response elicited in the sensitised mice closely resembled that observed in humans following midge bites. This mouse model holds great potential as a valuable tool for future research into insect bite allergies and the development of effective therapeutic strategies.

AUTHOR CONTRIBUTIONS

Shuncai Bao: Investigation; writing—original draft; data curation. Xue Lu: Investigation; writing—original draft; data curation. Shuai Xiang: Investigation. Xiaohui Hou: Writing—review and editing; project administration; investigation.

CONFLICT OF INTEREST STATEMENT

The authors have no conflicts of interest to declare.

FUNDING INFORMATION

The National Natural Science Foundation of China (31960102)

ETHICS STATEMENT

This study was approved by the Ethics Committee of Zunyi Medical University.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.1462.

ACKNOWLEDGEMENTS

We would like to thank the people who provided a sampling place for this study. We express our gratitude to the Zunyi Medical University Graduate Student Innovation Program for providing us with funding (Grant Number ZYK:170).

Bao, S. , Lu, X. , Xiang, S. , & Hou, X. (2024). Establishment of a mouse allergy model for Culicoides (Diptera: Ceratopogonidae). Veterinary Medicine and Science, 10, e1462. 10.1002/vms3.1462

DATA AVAILABILITY STATEMENT

Data are available on request from the authors.

REFERENCES

  1. Akiyama, T. , Andoh, T. , Ohtsuka, E. , Nojima, H. , Ouchi, H. , Takahata, H. , & Kuraishi, Y. (2018). Peripheral gabapentin regulates mosquito allergy‐induced itch in mice. European Journal of Pharmacology, 833, 44–49. [DOI] [PubMed] [Google Scholar]
  2. Barros, M. S. , Gomes, E. , Gueroni, D. I. , Ramos, A. D. , Mirotti, L. , Florsheim, E. , Bizzarro, B. , Lino, C. N. R. , Maciel, C. , Lino‐Dos‐Santos‐Franco, A. , Tavares‐De‐Lima, W. , Capurro, M. L. , Russo, M. , & Sá‐Nunes, A. (2016). Exposure to Aedes aegypti bites induces a mixed‐type allergic response following salivary antigens challenge in mice. PLoS One, 11(5), e0155454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen, Y. H. , Lee, M. F. , Tsai, J. J. , Wu, H. J. , & Hwang, G. Y. (2009). Specific IgE and IgG responses and cytokine profile in subjects with allergic reactions to biting midge Forcipomyia taiwana . International Archives of Allergy and Immunology, 150(1), 66–74. [DOI] [PubMed] [Google Scholar]
  4. Choi, D. S. , Ji, Y. , Jang, Y. , Lee, W. J. , & Shim, W. S. (2020). Crotamiton, an anti‐scabies agent, suppresses histamine‐ and chloroquine‐induced itch pathways in sensory neurons and alleviates scratching in mice. Biomolecules & Therapeutics, 28(6), 569–575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dijoux, E. , Klein, M. , Misme‐Aucouturier, B. , Cheminant, M. A. , De Carvalho, M. , Collin, L. , Hassoun, D. , Delage, E. , Gourdel, M. , Loirand, G. , Sauzeau, V. , Magnan, A. , & Bouchaud, G. (2023). Allergic sensitization driving immune phenotyping and disease severity in a mouse model of asthma. Allergy Asthma & Immunology Research, 15(2), 246–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dolence, J. J. (2021). Induction of peanut allergy through inhalation of peanut in mice. Methods in Molecular Biology, 2223, 19–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Guo, H. , Kuang, Z. , Zhang, J. , Zhao, X. , Pu, P. , & Yan, J. (2020). The preventive effect of Apocynum venetum polyphenols on D‐galactose‐induced oxidative stress in mice. Experimental and Therapeutic Medicine, 19(1), 557–568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hamza, E. , Doherr, M. G. , Bertoni, G. , Jungi, T. W. , & Marti, E. (2007). Modulation of allergy incidence in Icelandic horses is associated with a change in IL‐4‐producing T cells. International Archives of Allergy and Immunology, 144(4), 325–337. [DOI] [PubMed] [Google Scholar]
  9. Henrique, M. O. , Neto, L. S. , Assis, J. B. , Barros, M. S. , Capurro, M. L. , Lepique, A. P. , Fonseca, D. M. , & Sá‐Nunes, A. (2019). Evaluation of inflammatory skin infiltrate following Aedes aegypti bites in sensitized and non‐sensitized mice reveals saliva‐dependent and immune‐dependent phenotypes. Immunology, 158(1), 47–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kinugasa, S. , Hidaka, S. , Tanaka, S. , Izumi, E. , Zaima, N. , & Moriyama, T. (2021). Kiwifruit defense protein, kiwellin (Act d 5) percutaneously sensitizes mouse models through the epidermal application of crude kiwifruit extract. Food & Nutrition Research, 15, 65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Langner, K. F. A. , Darpel, K. E. , Drolet, B. S. , Fischer, A. , Hampel, S. , Heselhaus, J. E. , Mellor, P. S. , Mertens, P. P. C. , & Leibold, W. (2008). Comparison of cellular and humoral immunoassays for the assessment of summer eczema in horses. Veterinary Immunology and Immunopathology, 122(1‐2), 126–137. [DOI] [PubMed] [Google Scholar]
  12. Lee, M. F. , Yang, K. J. , Wang, N. M. , Chiu, Y. T. , Chen, P. C. , & Chen, Y. H. (2014). The development of a murine model for Forcipomyia taiwana (biting midge) allergy. PLoS One, 9(3), e91871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lee, M. F. , Song, P. P. , Lin, T. M. , Chiu, Y. T. , & Chen, Y. H. (2016). For t 2 DNA vaccine prevents Forcipomyia taiwana (biting midge) allergy in a mouse model. Allergy, 71(4), 522–531. [DOI] [PubMed] [Google Scholar]
  14. Lehiy, C. J. , Reister‐Hendricks, L. M. , Ruder, M. G. , Mcvey, D. S. , & Drolet, B. S. (2018). Physiological and immunological responses to Culicoides sonorensis blood‐feeding: A murine model. Parasites & Vectors, 11(1), 358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. McGregor, B. L. , & Lewis, A. (2023). Host associations of Culicoides biting midges in Northeastern Kansas, USA. Animals, 13(15), 2504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mellor, P. S. (2000). Replication of arboviruses in insect vectors. Journal of Comparative Pathology, 123(4), 231–247. [DOI] [PubMed] [Google Scholar]
  17. Opasawatchai, A. , Yolwong, W. , Thuncharoen, W. , Inrueangsri, N. , Itsaradisaikul, S. , Sasisakulporn, C. , Jotikasthira, W. , Matangkasombut, O. , Reamtong, O. , Manuyakorn, W. , Songnuan, W. , & Matangkasombut, P. (2020). Novel salivary gland allergens from tropical mosquito species and IgE reactivity in allergic patients. World Allergy Organization Journal, 13(2), 100099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Pessoa, V. , Ramilo, D. W. , da Fonseca, I. P. , Ferreira, M. B. , Marti, E. , & Tilley, P. (2020). Culicoides spp. found near Lusitano stud farms in mainland Portugal which may contribute for IBH studies. Veterinary Parasitology: Regional Studies and Reports, 20, 100385. [DOI] [PubMed] [Google Scholar]
  19. Sick, F. , Beer, M. , Kampen, H. , & Wernike, K. (2019). Culicoides biting midges—Underestimated vectors for arboviruses of public health and veterinary importance. Viruses, 11(4), 376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Songumpai, N. , Promrangsee, C. , Noopetch, P. , Siriyasatien, P. , & Preativatanyou, K. (2022). First evidence of co‐circulation of emerging Leishmania martiniquensis, Leishmania orientalis, and Crithidia sp. in Culicoides biting midges (Diptera: Ceratopogonidae), the putative vectors for autochthonous transmission in Southern Thailand. Tropical Medicine and Infectious Disease, 7(11), 379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Stokes, J. E. , Carpenter, S. , Sanders, C. , & Gubbins, S. (2022). Emergence dynamics of adult Culicoides biting midges at two farms in south‐east England. Parasites & Vectors, 15(1), 251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Tugwell, L. A. , England, M. E. , Gubbins, S. , Sanders, C. J. , Stokes, J. E. , Stoner, J. , Graham, S. P. , Blackwell, A. , Darpel, K. E. , & Carpenter, S. (2021). Thermal limits for flight activity of field‐collected Culicoides in the United Kingdom defined under laboratory conditions. Parasites & Vectors, 14(1), 55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Van Der Meide, N. M. A. , Meulenbroeks, C. , Van Altena, C. , Schurink, A. , Ducro, B. J. , Wagner, B. , Leibold, W. , Rohwer, J. , Jacobs, F. , Sloet Van Oldruitenborgh‐Oosterbaan, M. M. , Savelkoul, H. F. J. , & Tijhaar, E. (2012). Culicoides obsoletus extract relevant for diagnostics of insect bite hypersensitivity in horses. Veterinary Immunology and Immunopathology, 149(3‐4), 245–254. [DOI] [PubMed] [Google Scholar]
  24. Wanji, S. , Tayong, D. B. , Ebai, R. , Opoku, V. , Kien, C. A. , Ndongmo, W. P. C. , Njouendou, A. J. , Ghani, R. N. , Ritter, M. , Debrah, Y. A. , Layland, L. E. , Enyong, P. A. , & Hoerauf, A. (2019). Update on the biology and ecology of Culicoides species in the South‐West region of Cameroon with implications on the transmission of Mansonella perstans . Parasites & Vectors, 12(1), 166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Yu, Y. X. , Liu, J. H. , Liu, G. P. , Liu, Z. J. , Yan, G. , Hao, B. S. , & Zhao, T. S. (2005) Ceratopogonidae of China (Insecta, Diptera) (Vol. 1–2). Militay Medical Science Press. [Google Scholar]
  26. Žiegytė, R. , Platonova, E. , Kinderis, E. , Mukhin, A. , Palinauskas, V. , & Bernotienė, R. (2021). Culicoides biting midges involved in transmission of haemoproteids. Parasites & Vectors, 14(1), 27. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available on request from the authors.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES